Skip to main content

Full text of "Report of the State Civil Service Commission"

See other formats


Google 



This is a digital copy of a book that was preserved for generations on library shelves before it was carefully scanned by Google as part of a project 

to make the world's books discoverable online. 

It has survived long enough for the copyright to expire and the book to enter the public domain. A public domain book is one that was never subject 

to copyright or whose legal copyright term has expired. Whether a book is in the public domain may vary country to country. Public domain books 

are our gateways to the past, representing a wealth of history, culture and knowledge that's often difficult to discover. 

Marks, notations and other maiginalia present in the original volume will appear in this file - a reminder of this book's long journey from the 

publisher to a library and finally to you. 

Usage guidelines 

Google is proud to partner with libraries to digitize public domain materials and make them widely accessible. Public domain books belong to the 
public and we are merely their custodians. Nevertheless, this work is expensive, so in order to keep providing tliis resource, we liave taken steps to 
prevent abuse by commercial parties, including placing technical restrictions on automated querying. 
We also ask that you: 

+ Make non-commercial use of the files We designed Google Book Search for use by individuals, and we request that you use these files for 
personal, non-commercial purposes. 

+ Refrain fivm automated querying Do not send automated queries of any sort to Google's system: If you are conducting research on machine 
translation, optical character recognition or other areas where access to a large amount of text is helpful, please contact us. We encourage the 
use of public domain materials for these purposes and may be able to help. 

+ Maintain attributionTht GoogXt "watermark" you see on each file is essential for in forming people about this project and helping them find 
additional materials through Google Book Search. Please do not remove it. 

+ Keep it legal Whatever your use, remember that you are responsible for ensuring that what you are doing is legal. Do not assume that just 
because we believe a book is in the public domain for users in the United States, that the work is also in the public domain for users in other 
countries. Whether a book is still in copyright varies from country to country, and we can't offer guidance on whether any specific use of 
any specific book is allowed. Please do not assume that a book's appearance in Google Book Search means it can be used in any manner 
anywhere in the world. Copyright infringement liabili^ can be quite severe. 

About Google Book Search 

Google's mission is to organize the world's information and to make it universally accessible and useful. Google Book Search helps readers 
discover the world's books while helping authors and publishers reach new audiences. You can search through the full text of this book on the web 

at |http: //books .google .com/I 



// 



I 



C / -^ / 



^V' 



N 






V^'. 



- V* 



-.•\ 



'* -N 



^T 



LegriBla.M've Document 



STATE OF NEW YORK 



THIRTY-SIXTH ANNUAL REPORT 

State Civil Service Commission 



ConuniM loners 
JOHN C CLARK WILLARD D. McKINSTRY 

WILUAM GORHAM RICE 



ALBANJV 
J. B, LYON COMPANY. PRINTERS 



• , 



THE Kr-V ■," . 

^I-DJCNKOLNDATIOX.- 



19t0 



L 



•. 



STATE OF NEW YORK 
Executive Chamber 

Albany, N. Y., February 10, 1919. 
To the Legislaiure: 

I have the honor to transmit iherewith the Thirty-sixth Annual 
Report of the State Civil Service Commission, the same being 
for the year lOW. 

(Signed) 

Alfred E. Smith. 



TABLE OF CONTENTS 



PAGE 

Report of the Commission 7 

Chief Examiner's Annual Report 29 

Or^nization of the Commission 39 

List of Commissioners, Chief Examiners and Secretaries since the enact- 
ment of the Civil Service Law 44 

Cla£.sifieation table showing number of positions in the unclassified and 

classified sen'ice, except laborers 47 

Civil List 56-661 

Afpe^^dix a. 

List of open competitive examinations 665 

List of competitive examinations to which non-residents or non- 
citizens have been admitted 674 

List of competitive promotion examinations 675 

List of non-competitive promrotion examinations 679 

List of non-competitive provisional examinations 680 

List of non-competitive examinations (rule VTIT, subdivision 10).. 684 

List of non-competitive examinations rated at Albany 686 

List of non-competitive examinations rated by institution boards of 

examiners 689 

Lists of employments under rule VIII, subdivisions 5 and 10.. 693, 694 

List of transfers, competitive class 719 

Appendix B. 

Amendments to State Civil Service rules 727 

Amendments to State Civil %Service classification 728 

Requests for changes in the State Civil Service rules and classifioa- 

tion denied 753 

Amendments to State Civil Service regulations 757 

Appendix C. 

Digest of court decisions relating to Civil Service Law 767 

Opinion of Attorney-General relating to Civil Service matters 770 

[6] 



REPORT 



Albany, N. Y., January 15, 1919 



To the Governor: 



In accordance with the requirement of the Civil Service Law, 
we submit report for the year 1918, being the thirty-sixth report 
of the (lepnrtment. 

The i>ersonnel of the Commission has remained unchanged, and 
with some minor adjustments of positions, the staff of employees 
has been continued. Mr. William V. Fonda, one of the Commisr 
sion's examiners, died October 30th after a brief illness with 
influenza, ajid we take this opportunity to express our appreciation 
of the capable and efficient service of Mr, Fonda during his con- 
nection with the department for nearly five years. Four of the 
reiruhir em])loyees are at present absent on military service as 
follows: Walter F. Reillv; Howard F. Lewis; Ravmond T. 
Jones; and William J. Maher. 

The Commission has held fifty meetings during the year, of 
which tweny-nine were in Albany, nineteen in New York, and 
two in Watertown. 

Ct.assification 

According to the best record obtainable 2,212 officers and 
employees in the state, coimty and village service, not counting 
laljorers, were absent in military service January 1, 1919. This 
is an increase of 1,095 as compared with the total number of offi- 
cers and employees who entered the military ser\Mce during the 
year 1917. The following table shows the classification and 
number of such absentees: 



rnclawified service 
Claamfi«d service: 

Exempt 

Competitive .... 

Non-competitive 

Totals 




1018 



17 

48 

1,433 

714 



2,212 



[7] 



8 



Report of the State Civll Service Commission 



The total number of positions subject to the State Civil Service 
rules on January 1, 1919, not including laborers, is 19,115, a 
decrease of 513 as compared with the number of employees on 
January 1, 1918. This apparent decreajse is undoubtedly more 
than accounted for by the additional 1,095 officers and employees 
absent on military service January 1, 1919. As these persons 
have a continued relation to the service, the Commission decided to 
carry their names in the civil list, and to indicate absence from 
employment by a star. The nam^ of the 2,212 absentees are 
not counted in making up the table showing number of positions 
in the unclassified and classified service on January 1, 1919. 

The accompanying table shows the classification of positions 
January 1, 1919, as compared with that of January 1, 1918, with 
increase or decrease in each class : 



Decreaae 



UnoUasified aervioe 
Classified service: 

Exempt 

Competitive .... 

Non-competitive 

Totals 



1918 


1919 


Increase 


1.416 

1.478 

10.405 

6,329 


1.504 

1.492 

10.006 

6.113 


88 
14 






19,628 


19.115 


102 



399 
216 



615 



Total net decrease, 513. 

Changes in Classification 
Exempt Class 

During the year seventy-five positions were added to the exempt 
class, of which number thirteen were mandatory exemptions 
under the provisions of section 13 of the Civil Service Law. 
Sixty-one positions, some of which were obsolete or unfilled, were 
stricken from the exempt class, leaving a net increase of fourteen 
in the number of exempt places. 

This increase is more than accounted for by the exemption 
of sixteen positions of director. Department of Farms and 
Markets, made necessary by the reorganization of the Depart- 
ments of Agriculture, Foods and Markets, and Weights and 
Measures. Section 27 of the act in relation to Fanns and Markets 
provides in part as follows : " There shall be a director of each 
bureau, who shall be deemed to occupy a confidential position 
to the ^ouncU ^nd^the commissioner in charge of the division in 
Tfiiich sttch blireau.!^ included, and may, therefore, be appointed 



Eeport of the Commission 9 

without competitive examination." It is our opinion that the 
word " may " in the foregoing provision of the law mnst be con- 
strued as meaning "must," in view of its connection with the 
other words in the sentence, and that exempt or noncompetitive 
classification of the position of director of each bureau was, there- 
fore, mandatory upon the commission. 

The following table shows the changes in classification of posi- 
tions in the exempt class during the year 1918 : 



DETAXTMEirr. Omcm oe 
I nb titu ti ow 



Btnkiiif department . 



County judge. ChautauquA 

county. 
Coonty derk, KinsB county. 



District attorney. Queens 

county. 

County court, Bronx county 

CommiMbner of charities 
And corrections, Erie 
eounty. 



Commiauoner of elections, 

Monroe coimty. 
County clerk. Queens 



District attorney. Rich- 

mood county, 
oorrocate, Westchester 

county. 
I)irtriet attorney, Onondaga 

county. 

Sorane court, appellate 
viviiion, second depart- 
ment. 

> ood conunission 



DiitricC attorney, Suifolk 

county. 
8«preine court, aiipellate 

wvinon, seoond judicial 

apartment. 
•uNic service commission, 

•ecood district. 
*OMd erf supervisors, Al- 

bany county, 
'^ood conunission 



County attorney. West- 
">e«ler county. 



Position added to 



Fourth assistant district 
attorney; stenographer 
to the district attorney. 



Assistant director, Buffalo 
oflBoe, bureau of distri- 
bution and transporta- 
tion. 

One assistant district at- 
torney. 

Three assistant deputy 
clerks. 



One confidential investi- 
gator. 

First deputy county at- 
torney; second deputy 
county attorney; secre- 
tary. 



Position stricken from 



Stenographer to the superin- 
tendent. 
One clerk or stenographer . . 

Chief clerk of law depart- 
ment; chief clerk of certi- 
ficates, satisfactions and 
mechanics' liens; one assist- 
ant deputy county clerk. 

One deputy JMsistant dis- 
trict attorney; one chief 
clerk- one investigator; one 
stenographer. 

One confidential court at- 
tendant; one stenographer 
and tjrpewriter. 

Deputy superintendent of 
penitentiary; deputy sup- 
erintendent of the poor; 
deputy superintendent, 
county home and hos- 
pital; secretary, oflBoe of 
superintendent of poor. 

One clerk 

Financial clerk; deputy fi 
nancial clerk; calendar 
clerk. 

One special mrasenger and 
subpoena server. 

The transfer tax assistant . . 

One confidential clerk 

One attendant and crier — 

Hearing and publicity clerk. 
Clerk of the works 



Date 
approved 

by 
Governor 



Feb. 
Feb. 
Feb. 



Feb. 
Feb. 



16 
16 
16 



Feb. 16 



20 
20 



Feb. 


20 


Feb. 


20 


Feb. 


20 


Feb. 


20 


Jan. 


18 


Jan. 


22 


Jan. 


2 


Jan. 


24 


Feb. 


14 


Feb. 


16 


Feb. 


16 


Feb. 


20 


Feb. 


16 



10 



Eepokt of the State Civil Service Commission 



Dkpartmknt. Office or 
Institution 



Special county judge, Mon- 
roe county. 
Food commiasion 

ComraiBsioner of agriculture 



Foods and markets 

Superintendent of ^^ eights 

and measures. 
Department of farms and 

markets. 



Position added to 



One confidential clerk. . . . 

Assistant secretary, New 
York office. 



Supreme court, first judicial 

district. 
County treasurer. Suffolk 

county. 
Register. New York county. 



Commissioner of elections, 

Niagara county. 
Department of excise 



Position stricken from 



Commissioner of agricul 
ture; commissioner of 
foods and markets: sec- 
retary; counsel; deputy, 
division of agriculture; 
deputy, division of foods 
and markets: secretary, 
division of foods and 
markets: 17 directors of 
bureaus; 3 special de- 
tectives. 



Private secretary , 



Deputy ; secretary 



Food commission 

Farms and markets 

SheriflF, Monroe county . . . . 

Attorney general 

Health officer, port of Now 

. York. 

Supreme court. King^ 

county. 
Commissioner of recorda, 

Bronx county. 
Comptroller 



Public service commission, 
first district. 

Commiasion on feeble- 
minded. 

Industrial commission .... 

Rankint deparnr*nt 

Board of port ward mt. . . . 

Attorney gen3ral 



Cashier in office of special 
deputy commissioner 
for county of Bronx. 

Five confidential agents . 

One director of bureaus.. 

Private sftcretary 

One confidential clerk. . . 



Two deputies; one detective: 
secretary; counsel, bureau 
of licenjcs; chief investi- 

gator. bureau of licenses: 
ve special detectives. 

Deputy; secretary 

Deputy: second deputy. . . . 



One confidential attendant . 



Two special deputy registers: 
chief satisfaction clerk; 
chief clerk; one assistant 
deputy register. 



Date 
a ^proved 

Governor 



One confidential telephone 
operator. 

Ono deputy; one superin- 
tendent. 



Cpnservation commission. 



Court of anp^als 

Mohansic Lake Reservation 
Department of farms and 
markets. 

County clerk, Bronx county 

State comptroller 

Board of suD*»r visors. .\1- 
banv county. ' 

Superintendent of weights 
and measures. 

Deoartment of narcotic 
drug control. 



One assistant secretary to 

the commission. 
Secretary 

One assistant counsel . . . 

One deputy 

Clerk-typist 

Three deputies: three as- 
sistant deputies attor 
nry general. 



Chief disinfector. 



One court and tr'i.-<t fund 
examiner. 

One assistant electrical en- 
gineer. 



Messenger . 
Secretary . . 



One stock transfer tax 
examiner. 



First deputy; second 
deputy; third deputy; 
secretary. 

'S^ College of Foreatry, Secretary, board of trua- 
SyrAcuse Uaivenity. / tees; asaistant treasurer.^ 



One deputy attorney general ; 
five assistant deputies at- 
torney general. 



Director, bureau of farmers' 
institutes; director, bureau 
of the Rochester office. 

Equity clerk; one confi 
dential stenographer. 



Architectural advisor. 
Second deputy 



Feb. 
Feb. 
Feb. 



Feb. 
Feb. 

Feb. 



Oct. 



16 

16 

8 



8 
8 

8 



Feb. 


16 


Mar. 


5 


Mar. 


12 


May 


8 


May 


8 


May 
June 
June 
June 
June 


20 

1 

1 

1 

28 


June 


28 


June 


28 


July 


9 


July 


9 


July 


26 


July 
July 
Aug. 
Oct. 


20 

31 

3 

31 



31 



Nov. 
Nov. 
Nov. 


15 
15 
15 


Dec. 
Dec. 


16 
10 


Dec. 


16 


Dec. 


16 


Dec. 


10 



\ 



Dec. 3o 



Repobt of the Commission 



11 



Non-competitive Class. 

The non-competitive class includes that large number of posi- 
tions which fall between the competitive class and the labor class, 
position; for which some examination is practicable, but because 
of location, low salary, or otherwise, open competitive examina- 
tion would not attract candidates. The number of positions, or 
rather number of titles of positions, added to the non-competitive 
class is seventy-four, and the number of positions or titles stricken 
from the non-competitive class is twelve. 

The following table shows the changes made in the non-competi- 
tive class during the year 1918: 



DVAITIttNT. OtFICB OK 

iNanrunoN 



Stttking department . 
Food comnuasion . . . 



Deptrtment of Newtown 

BAtUefield Reservation. 
Ua Mnatorium, Monroe 

0001^. 

Cwnmiawoncr of reeords, 

New York county. 
Acrieohurml esqwriment 

itotioii, Geneva. 
CaoKnration oommianon . 
OHida eonntjr hoapital. . . 
Food eamnuMion 



Position added to 



One confidential examiner. 

Five aasistanta to borot^h 
chairman, food council. 
Greater New York. 

Custodian 



Position stricken from 



Two confidential examiners. 



Cooinusnoner of charities 

and corrections. Westches- 

t«r county. 
Comminioner of charities 

and eorrectioiis, Westches- 

•« county. 
OMtment of highways, 

Oaondsca county. 
UtehwortE ViUace, Thiells. 
uduslrial farm, Niaiara 

eoQBty. 
DepsTtment of health 
ggpytment of health 
FwclisaiBg agent, Erie 

eounty. 

S^oetsry of state. . . 
Tu 



Housekeeper. . 
One mechanic. 



Bio-chemist. 



One chauffeur 

Laboratory technician. . . 

Assistant to the lower 
Manhattan borough 
chairman of food council 
of Greater New York. 

Meatcutter; baker 



Orderly 



One general machinist. 



Butcher. 
Farmer. 



Crmstivatioii commission . 
"franaatonr for wcunen, 
» Bedford Hills, 
wh officer, port of New 

York, 
wth officer, port of New 

York. 
P^Mtment of charities and 

eonectioos, Erie county. 
(^Uttitsble, penal and re- 

lormatoty mstitutiona ex- 

eq>t State prisooa. 
Wets' sod Siulora' Home. 

Bath. 



Five technioal assistants. 
Six laboratory helpers . . . . 
Chauffeur 



One foreman of laborers. . 
One addressograph oper- 
ator. 

One chauffeur 

Chauffeur 



One foreman painter. 



Janitrcss 

Assistant steam engineer. 



Clerk to the treasurer. 



Date 
approved 

Go^^rnor 



Boarding officer. City Island. 



Feb. 
Jan. 



Feb. 

Feb. 

Mar. 

Mar. 

Mar. 
Mar. 
June 

June 
June 

June 

June 
June 

June 
June 
June 

June 
June 

June 
June 

June 

June 

June 

June 



16 
2 



16 

20 

5 

11 

11 

12 

1 

1 

1 



1 
1 

1 
1 
1 

1 
1 

1 
1 

28 

28 

28 

28 



\ 



June 2& 



12 



Eeport of the State Civiir Service Commission 



Department, Office or 
Institution 



Department of excise. 



Craig Colony, Sonyea .... 
Women's Relief Corps 

Home, Oxford. 
Monroe coimty tuberculosis 

sanatorium. 
Department of health .... 
Great Meadow prison .... 
Dannemora State hospital 
School of agriculture, Farm- 

ingdale. 

Sing Sing prison 

State comptroller 

Auburn prison 

Dannemora State hospital. . 

Niagara county sanatorium. 



Pleasant Valley sanatorium, 
Steuben county. 



State hospital commission . 



Commissioner of charities 
and corrections, Eric 

court'.'. 

Commissioner of charities 
and corrections, Erie 
county. 

Public works 

Manhattan State hospital. . 

Conservation commission. . 

Conservation commission. . 

Pleasant Valley sanatorium, 
Steuben county. 

Pawling sanatorium, Rens- 
selaer county. 

Monroe county tuberculosis 
sanatorium. 

Commissioner of charities 
and corrections, West- 
chester county. 

Rocky Crest sanatorium, 
Cattarauf^us rounty. 

State Colleste of Forestry, 
Syracuse University. 



Position added to 



Head laundress. 
Cook and baker. 



One chauffeur 

Farmer 

Driver and chauffeur. . . 
Matron or housekeeper. 



Driver and chauffeur 

One bank messenger .... 
Chauffeur and coachman 
Fireman and dynamo 

tender. 
Cook; fireman; interne; 

laboratory assistant; 

laundry man; laundress; 

orderly. 
Cook; laundr>'man; jan 

itor; bookkeeper and 

stenographer. 



Nurses at the county hos- 
pital. 



Trained attendant. 



Three chauffeurs. 
One fireman .... 
Forest rangers . . 
One chauffeur. . . 
Laundress 



One matron and head 
nurse; laboratory as- 
sistant. 



Position stricken from 



One clerk: two stenographers 
in the detective bureau. 



Assistant resident physician, 



Interpreter and transporta- 
tion attendant. 



Date 
approved 

Governor 



June 2ft 



June 
June 

July 

July 
July 
July 
July 

July 
July 
July 
Aug. 

Aug. 



Aug. 

Aug. 
Aug. 



Sept. 
Nov. 
Nov. 
Dec. 
Dec. 



Housekeeper 

Nurseryman; foreman. 



Interne 

Three fellowship students. 



Dec. 
Deo. 

Deo. 
Dec. 



2» 
2S 

9 

9 
9 
9 
9 

26 

26 

26 

3 



3 
6 



Sept. 21 



21 
15 
30 
16 
16 



Deo. 16 



16 
30 

30 
30 



State College of Forestry 
Syracuse University 

On November 20, 1918, the Attorney-General advised the dean 
of the New York State College of Forestry, Syracuse University, 
Syracuse, N. Y., that in his opinion the employees at the coUe^ 
were in the civil service of the State of New York and, therefore, 
subject to the provisions of the Civil Service law and rules. 

Upon receipt of a copy of the Attorney-General's letter on this 
subject, the Commission arranged a conference with the dean 



Report of the Commission 13 

of the Universih' for the purpo e of considering the classificiitioii 
of positions at the College and immediate application of the pro- 
visions of the law and rules to the present members of the staflF. 
As the result of this action resolutions were adopted December 12, 
1918, and approved by the Governor December 30, 1918, extend- 
ing the provisions of the Civil Service law and rules to the 
offices, places and employments at the State College of Forestry, 
Syracuse University, effective December 16, 1918, and the per- 
sons holding positions in the classified service were continued 
therein without examination in view of the opinion of the 
Attorney-General rendered in January, 1911. 

As the result of this action forty-one positions were added to 
the civil service of the State. These positions are divided in 
classification as follows: Unclassified service, 22, being pro- 
fessors, instructors, and directors; classified service, exempt 2, 
competitive 15, noncompetitve 2. 

EXAMIXATIOXS 

During the year 1918 there was a total of 17,355 applicants; of 
these 10,050 applied for open competitive examinations, and 
1,290 for promotion competitive examinations. As compared 
with the year 1917 the total number is less by 3,609. 
Total number of open competitive examinations held. . . . 394 

Promotion competitive examinations 150 

Xumber of provisional appointments 660 

Xnmber of appointments under Rule VIII, section 10 . . 571 

Number of noncompetitive promotions 154 

Number of noncompetitive papers rated by the oflSce 

examiners 671 

Number of noncompetitive papers rated by local ex- 
aminers 3,823 



The considerable increase in the number of provisional appoint- 
ments under Rule VIII, section 4, and of appointments under 
Rule Vlll, section 10, is explained by the difficulties encountered 
in securing competitors for places carrying small compensation 
owing to war conditions. This situation is also reflected in the 



14 Repokt of the State Civil Service Commission 

large falling off in the total number of competitors in open com- 
petitive examinations. 

The statistics relating to examinations for the year 1918 as 
compared with the year 1917 are as follows: 

1917 1918 

Open competitive examinations 318 394 

Promotion competitive examinations 152 150 

Provisionals 483 660 

Noncompetitive, Rule VIII, section 10 158 702 

Noncompetitive papers rated at Albany 596 671 

Noncompetitive promotion 110 159 

Noncompetitive papers rated by local boards. . . 5,443 3,823 
Applications for oj)en competitive examinations. 12,281 10.050 
Applications for promotion competitive examina- 
tions 1,893 1,290 



Suspension of the Rule Requiring Competition 

The Commission is authorized by section 15, subdivision 2 of 
the Civil Service Law, to suspend the rule requiring competition, 
upon satisfactory evidence that competitive examination in such 
cases is impracticable. This authority has been exercised in 
but four cases during the year. There were seven cases of sus- 
pension of the rule during the year 1917, five during the year 
1916, and three during the year 1915. 

The persons appointed without competitive examination dur- 
ing the past year, under the provision of the law referred to, are 
as follows: 

Dr. Mary Schwartz Rose, Columbia University, New York, 
N. Y., deputy director of conservation bureau. State Food Com- 
mission, March 11, 1918, salary at the rate of $3,000 a year, for 
not less than three-fourths of her time. Dr. Rose, who was ap- 
pointed in place of Frederick E. Breithut, similarly excepted 
from examination during 1917 at salary of $4,000 a year, had 
previously been designated as home economies leader for New 
York city by the United States Food Administration because of 



Report of the Commission 15 

her nation-wide reputation as a teacher in this field, and also 
because of her valuable service to the home economics section of 
the United States Food Administration. Dr. Rose is a Fellow 
of the American Association for the Advancement of Science ; a 
member of the home economics committee of the Charity Organ- 
izations Society of ^'ew York Citv, and was a member of the 
technical advisorj' committee of the bureau of eonser\'ation of 
the State Food Conunission. The emplo\'nient of Dr. Rose 
was also approved by Mr. Hoover of the Federal Food Board. 

Charles R. Vanneman, Albany, N. Y., engineer of grade cross- 
ings, Public Service Commission, Second District, August 1, 
1918, $5,000. Mr. Vanneman is a gniduate civil engineer and, 
at the time, was employed by the Public Service Commission, 
Second District, as chief of division of steam railroads, $4,500 
a year. The Public Service Commission said that it was its 
intention to combine the duties of said position with that of 
engineer of grade crossings during the period of the war, thereby 
effecting a saving to the State at a time when construction work 
is necessarily curtailed to some extent. Mr. Vanneman, while 
employed by the Public Service Commission for eight years, 
acquired a working knowledge of the railroads throughout the 
State which was possessed by few persons, and the temporary 
consolidation of the two positions could not possibly be achieved 
by appointment of one who had not a broad knowledge of rail- 
road problems and familiarity with the Public Service Law and 
the details connected with its enforcement. The Commission, 
however, in suspending the nile requiring competition in this 
case, provided that the exempt position of chief of division of 
steam railroads should not be filled (lurinc: the period of the exist- 
ing war with the German Empire and its allies. 

Albert H. Mowbray, Wollaston, Mnss., chief actuary. State 
Industrial Commission, October 1, 1018, $0,000. The vacancy 
in this position was due to the resignation of Joseph IT. Wood- 
ward, who had been appointed some time before when the ])osition 
of chief actuary was exempt. The State Industrial Commission 
certified that it had been advised by persons prominent in the 
insurance world that it would be almost impossible to secure com- 
petitors in an examination owing to the fnct that the position 



16 Report of the State Civil Service Commission 

requires a person of such high and recognized attainments as an 
actuary. Also, that it had been informed by prominent insurance 
men that Mr. Mowbray possesses the necessary' qualifications and 
is best fitted to fill the position. Mr. Mowbray graduated from 
the University of California in 1904 with a degree of Bachelor 
of Arts and honorable mention in mathematics and physics, and 
soon after he entered the actuarial department of the New York 
Life Insurance Company. In 1905 he was enrolled, after an 
examination, as an associate of the Actuarial Society of America, 
and in 1910, after an examination, was admitted as a Fellow. 
From April 1907 to September 1908, Mr. ^Mowbray was actuary^ 
of the North Carolina Insurance Department, and from Septem- 
ber 1908 to June 1910, was actuary of the California Insurance 
Department. Upon his resignation from the latter position he 
was engaged in consulting actuarial practice and as instructor 
at the University of California in mathematics and insurance. 
On January 1, 1913, Mr. Mowbray became actuary of the Massa- 
chusetts Employees Insurance Association, now the Liberty Mutual 
Insurance Company, and afterward served as secretary, and later 
as vice-president of the company. 

William B. Landreth, Schenectady, N. Y., ex)rLSulting engineer, 
State Engineer and Surveyor, December 16, 1918, compensation 
at the rate of $6,000 a year while actually employed. This posi- 
tion became vacant by resignation of Mr. Ripley, who had been 
appointed under authority of ;resolution of this Commission 
adopted February 25, 1916, suspending the requirement as to 
examination. Mr. Landreth, from 1881 to 1807, was engaged 
on railroad, paving and general municipal engineering work. 
In 1897 he entered the department of the State Engineer and 
Surveyor and was promoted through the various grades, holding 
the positions of special deputy State engineer and deputy State 
engineer. His many years' experience on canal construction work 
gave him exceptional qualifications by training and experience 
to take up the duties of consulting engineer. Mr. Landreth 
resigned the position of deputy State engineer to accept the posi- 
tion in question. 



Report of the Commission 17 

Service Record Rules 

Chapter 653 of the Laws of 1917, passed May 25, charged the 
Civil Service Commission with the duty of prescribing and sub- 
mitting to the Governor for his approval Service Record Rules. 
The essential provisions of that chapter are as follows : 

All departmental agencies of the state government, 
whether known as departments, institutions, boards, com- 
missions, or otherwise, shall keep and report service records 
and ratings of employees, for the purpose of recording in 
terms of quality, quantity, and other factors, the relative 
efficiency of employees engaged in the same or similar lines 
of work, under the rules and regulations prescribed by the 
Civil Service Commission. The Civil Service Commission 
shall, within nine months after this act takes effect, prescribe 
suitable rules and regulations for the keeping, reporting, and 
reviewing of the ser\'ice records and ratings of emj)loyees in 
the classified service; of the state and shall enforce the same. 
It shall use such service records as a factor in promotional 
examinations from grade to grade, and as a basis for deter- 
mining the rendition of satisfactory service necessary for 
advancement from one rate to another. Such rules and regu- 
lations and any modifications thereof shall take effect when 
approved by the Oovornor. A personal board shall, when 
required by the C^ivil Service Commission, be established in 
each departmental agency of the government for the purpose 
of assisting the Civil Service Commission in enforcing the 
several provisions of the Civil Service law. The members of 
such boards shall consist of state officers or employees and 
shall serve without pay. Other conditions governing the 
membership and conduct of such boards shall be prescribed 
by the Civil Service Commission. 

Immediately after the passage of the Service Record Law a 
special committee was appointed to proceed in the formulation 
of rules for submission to the Grovemor. This committee con- 
^i^^tod of Commissioner Rice, who had given much attention to 
the subject of clerical efficiency in the public service, both when 
^^ was a member of the United States Civil Ser\'ice Commission 
and since that time. 



18 Keport of the State Civil Service Commission 

The general principles proposed by the committee had the 
careful consideration of the Commission through several months, 
and were approved by it. Subsequently rules in a tentative form 
were discussed at a meeting of the National Asembly of Civil 
Service Commissions, and wore submitted to rej)re^entative3 
of municipal and other State commissions throughout the country. 

As a result, while some minor changes were suggested, the 
system proposed by this Commission had general approval, and 
the rules in substantially the existing form were transmitted to 
the Governor February 21, and approved by him June 28, 1918. 

In brief the rules provide for a rating of each employee in 
the State service subject to promotion. This rating is made 
by a section chief and is based upon recorded capacity and daily 
faithfulness in work. The form of the records is subject to ap- 
proval of the Civil Service Commission. The rules also provide 
for appeals to a board in which employees are represented and 
the final decision on ratings rests with the Department head. 

Capacity, inchidiiifi: nccurncv as shown bv the emploveo in the 
particular work he performs, is the basic element of rating, but 
the time elements of promptitude and regularity of work are also 
considered. Capacity has four times as much weight as the time 
element in the final rating. 

During the year personnel board;^ have been appointed by sixty- 
six agencies, and of these twenty-six reported ratings for the 
four months' period ending October 31, 1918. Reports from 
other boards are now in course of submission. 

In its Inst annual report the State Civil Ser\nce Commission 
expressed it^'elf substantially as follows: That the civilian serv- 
ice of the State ought to be arranged so as to develop a force of 
highly competent and expert employees cannot be denied. That 
such develo])ment does not ordinarily result under the present con- 
ditions is manifest. There are exceptions to the general rule, yet 
anyone, having even moderate private business experience and 
looking into the usual clerical service of the administrative, 
judicial or legislative offices of the State and of our municipal- 
ities, which are the greatest corporations that we know, becomes 
conscious of the lack of the development of minor employees 
into an efficient body of public sor\'ants possessinsr the spirit and 
ability to conduct public work with accuracy and rapidity. In 



Heport of the Commission 19 

other words, there is no pervasive and thorough-going attempt 
in these offices to develop among employees qualities of special 
industry and inventiveness as applied to the work they perform. 
Thus there is little or no appeal in our public service to ambition 
except in the matter of salary. It follows that not only is public 
money often wasted, but what is in reality much more serious, 
the awakening of employees in the lower grades to do increasingly 
better work is neglected and the actual development of their 
faculties and capacities in large measure lies dormant. In a well 
managed public office knowledge of the best prevailing commercial 
methods of doing work ought to be stimulated, and acquaintance 
with and trial of these private methods should constantly improve 
the transaction of public business. 

By its system of service record rules New York State has 
become the pioneer in the endeavor to apply to public employ- 
ment some of those principles of recording the comparative value 
of service among clerical and administrative employees which 
prevail in the best conducted large private enterprises. Our 
State is thus not unmindful of its obligations to develop the best 
service for the people who provide the salaries for civil employees, 
but it is recognizing also its obligation to employees themselves 
by setting before them standards which will tend to make them 
more useful citizens in every relation they may now or hereafter 
hold either to the State or in private employment. 

Finally, by the adoption of these service record rules there 
has been inaugurated a significant advance in the application 
of the principle of demonstrated merit in our Civil Service and 
that that principle has been more clearly applied in promotions 
as required by the Constitution of the State. 

Decisions and Rulings 

During the existence of the Civil Service Commission it has 
had to decide many questions involving an interpretation of the 
Civil Service law and rules. 

By authority given by chapter 571, Laws of 1918, we have 
caused to be prepared a code or digest of decisions and rulings 
which gives an orderly and systematic presentation of the same 
from Mav 23, 1883, to Januarv 1, 1919, based on the law and 
niles in force at the time the action was taken. 



20 



Report of the State Civil Service Commission 



The compilation has been prepared by John C. Birdseye, an 
employee of the Commission for thirty-five years, and for more 
than eighteen yeai^ its secretary. Mr. Birdseye's long, devoted 
and intelligent service gave him special qualifications for the 
work involved. The pamphlet is now being printed for free dis- 
tribution to appointing oflScers, heads of departments and insti- 
tutions, and to other persons interested. 

Municipal Civil Service Rules 

There are fifty-nine cities in the State, all with local civil ser\'- 
ice commissions working under special civil service rules, except 
the city of Sherrill. These rules to a large extent are identical 
or similar, but there is still a wide diverfcenc^ in the classifica- 
tion of positions. These apparent inconsistencies are explained 
by local conditions involving questions of salaries and duties. 
Constant supervision of the administration of the Civil Service 
law and rules by the Municipal Civil Service Commissions, is 
considered most important, as in this wny the local commissions 
are helped in their work, and the State Commission informed 
as to the way in which the law and rules are being observed. The 
commissioners and their representatives were able to visit and 
confer with the commissions in thirty-nine cities during the past 
year. In each case a written report of the inspection was rendered 
and copies sent to the respective mayors and commissions, atten- 
tion being called to any recommendations made. The cities visited 
are: 



Auburn 

Beacon 

Cohoes 

Fulton 

Glens Falls 

Hudson 

Kingston 

Middletown 

New Rochelle 

Oneonta 

Poughkeepsie 

Saratoga Springs 

Watervliet 



Albany 

Binghamton 

Coming 

Geneva 

Gloversville 

Ithaca 

Little Falls 

Mount Vernon 

Norwich 

Plattsburg 

Rensselaer 

Schenectadv 

White Plains 



Amsterdam 

Canandaigua 

Elmira 

Glen Cove 

Homell 

Johnstown 

Mechanicville 

Newburg 

Clean 

Port Jarvis 

Salamanca 

Troy 

Yonkers 



Repobt of the Commission 21 

In general, the Municipal Civil Service Commissions have 
advanced in the application of the law and rules, but in a num- 
ber of the smaller cities considerable difficulty was experienced in 
securing a sufficient number of applicants for competitive places. 
The rules for a number of cities were amended to meet new con- 
ditions, but in every case the competitive system of appointment 
was continued or extended whenever possible. 

An entire revision was made of the Civil Ser\'ice mles for the 
cities of Kingston, Middletown, Ecnsselaer, and Yonkers. Rules 
for the latest city, Glen Cove, were approved April 11, 1918. 

Civil Service Commission 
Middletoivn 

On January 31, 1918, a representative of this Commission 
visited the city of Middletown and had a conference with the 
Municipal Civil Service Commissioners and others with reference 
to the administration of the Civil Service law and rules. At this 
conference there were present Civil Service Commissioners 
McBrair and Raasch ; Fred J. Herres, President of the Common 
Council; Corporation Counsel Servin; Rev. E. Van Dyke Wight, 
Miss Florence Davidge and Miss Florence M. Nearing, repre- 
senting a citizens^ committee interested in the administration of 
matters relating to public charities. 

A report concemng this conference was duly submitted to us 
with certain recommendations. As the i^esult thereof the mem- 
l^rs of the Municipal Civil Ser\'ice Commission were cited to 
appear before the State Commission in New York February 21st, 
at which time they were given an opportunity to make a personal 
explanation and to file papers in opposition to amendments to 
the classification of the service of the city of Middletown which 
the State Commission deemed it advisable to make. At this 
meeting the Mayor and Corporation Counsel addressed the Com- 
mission and filed papers in opposition to certain changes pro- 
posed. Miss Davidge, Dr. Wight and a Mr. Millspaugh were 
also present and favored the changes, particularly classification 
in the competitive class of the position of Commissioner of Chari- 
ties. The Mayor and Corporation Counsel agreed to submit for 
consideration of the State Commission, revised rules and claaaifir 



22 Report of the State Civil Service Commission 

cation of the Civil Service of the city of Middletown on or before 
March 16, 1918, and it was, therefore, directed that the matter 
of classification of the positions mentioned in the citation of the 
State Commission, be deferred. 

The revised rules for the city of Middletown as adopted by 
the Municipal Commission and api)iuved by the Mayor March 21, 
1918, were considered at meeting of the State Commission held 
March 21, 1918. On motion the rules were approved as pre- 
sented, except in so far as they related to the inclusion in the 
unclassified service of the positions of Commissioner of Public 
Works and Commissioner of Charities; and inclusion in the 
exempt class of the position of cashier or assistant to the city 
clerk and collector. The State Commission was of the opinion 
that under the terms of the present charter of the city of Middle- 
town, the Commissioner of Public Works and the Commissioner 
of Charities are not strictly heads of departments by virtue of 
section 9 of the Civil Service Law. The State Commission was 
also of the opinion that as the position of city clerk and collector 
is in the competitive class, it would be inconsistent to classify 
one of his subordinates as exempt. For these reasons the classi- 
fication proposed for the positions named was not approved, and 
it was recommende<l that the places be included in the com- 
petitive class. 

Xo further proceedings were taken in this connection until 
June 1st, w^hen a representative of the department, by direction 
of the Commission, again visited ^Middletown to ascertain what 
steps, if any, had been taken to comply with our suggestions. An 
examination of the records of the local commission showed that it 
had taken no action of any kind concerning the positions named. 
It was contended by the local authorities that the Commissioner 
of Charities and the Commissioner of Public Works are heads 
of their respective departments, and, therefore, in the unclassified 
service, and that action by the State Commission as to the 
classification of these places is not within its jurisdiction. 
It was further stated that the position of c^ishier or assistant 
to the city clerk and collector should be in the exempt class, 
and that the State Commission has no right to hold that the 
position should be competitive. It was learned that the city 



Report of the Commission 23 

clerk was paying the salaries of the Cammissioner of Charities, 
Commissioner of Public A\'orks and cashier or assistant in his 
office, without the certification of the Municipal Civil Service Com- 
mission, and that no litigation was contemplated by the munici- 
pal authorities to determine the legality of the classification as 
competitive by the State Commission of the ix)8itions named. 
At a meeting of the Commission held June 7th, a further 
report concerning the situation in relation to the administration 
of the Civil Service law and rules of the city of Middletown 
was received, together with recommendations as to litigation 
thought desirable to determine the several questions involved. On 
motion the report was received and ordered transmitted to the 
Attorney-General, with request that he institute on behalf of the 
Commission such proceedings as he might consider necessary and 
advisable to bring about a settlement of the controversy as to the 
proper classification of the positions of Commissioner of Public 
Works, Commissioner of Charities, and clerk or assistant to the 
city clerk and collector. As far as we are informed the Attorney- 
General has not acted in this connection. 

Laborers — State College for Teachers 

On May 22, the Commission gave a hearing on the complaint 
of Thomas F. McGraw, as to the emplojinent of laborers at the 
State College for Teachers, Albany, N. Y. Upon the statement 
submitted, it appears that persons were employed as " laborer 
and watclmian," who devoted at least three- fourths of their time 
for seven months of the year to work which pro{)erly beh^nged to 
a competitive employee. 

The complaint was sustained and action taken to require that 
appointments be made to the places in question as the result 
of competitive examination. 

Chapter 211, Laws of 191?> 

This act provides for separate eligible lists for j)ersons in 
I'^doral military, naval or marine Hervice, and reads as follows: 

"All persons whose names appear upon any eligible list 
made pursuant to this article and who have entered or shall 
hereafter enter or shall obligate themselves to enter the 



24 Report of the State Civil Service Commission 

federal military, naval or marine service or who shall be 
re(}nired by draft or coiii>eri])tion to enter the federal service 
in anv canacitv iuid who bv reason thereof shall be unable 
to accept appointments made from names appearing upon 
any such list shall be entitled to have their names continued 
and placed on a separate eligible list for the same position 
resulting from an open competitive examination and names 
from such separate list shall be certified for apiK)intment 
at such times as such service shall cease before certification 
is made from any subsequent eligible list with the same force 
and effect as if such persons had been so certified before 
entering federal service as aforesaid. The eligibility for 
certificate for appointment of a person whose name appears 
on such eligible list entitled as herein provided shall continue 
for a period of one year from the date of his honorable dis- 
charge from such service." 

Considerable difficulty has already been encountered in admin- 
istering this statute. We are unable frequently to obtain a clear 
record showing that an eligible could not accept an appointment 
on account of absence in the military or naval service. Appoint- 
ing officers report many cases where they have been unable to 
obtain information as to the wishes regarding appointment of 
persons away from home on militaiy duty. We are inclined to 
give these candidates the benefit of any doubt, and when an 
appointment is made of a person whose standing on the list is 
lower than that of one who is absent on war service, upon a proper 
statement, to consider that the absentee was unable to accept for 
that reason. In all cases a complete record is essential in order 
that the law may be properly administered. 

In applying this law, a question arose as to the interpretation 
of its ju'ovisions and the Attorney-General was asked for his 
opinion on the follow^ing: 

Inquiiy: What persons are entitled to have their names i)laced 
upon the special eligible b*s-s provided by section 22-a of the 
Civil Service Law ? 

The Attorney-General hns given the following o]>inion: 

" Section 22-a of the Civil Service Law as added by chapter 
211 of the Laws of 1918 provides that all persons whose 



Keport of the Commission 25 

names appear upon any eligible list and who enter or obligate 
themselves to enter military service and who ' by reason 
thereof shall be unable to accept appointments made from 
names appearing upon any such list ' shall be entitled to be 
placed upon a special list, etc. 

This does not mean that eveiy man who underwent mili- 
tary obligations while his name was on a list is entitled to 
go on a special list for a year. It means that a man whose 
name was on a list and who was unable to accept appoint- 
ments because of his military obligations, is protected. But 
it does not contemplate protecting a man who would not have 
had an opportunity to accept or decline an appointment, had 
he not entered military service. If a man were so far down 
on a list that his name was not reached for certification dur- 
ing his absence, or if he were on a list from which no appoint- 
ments were made or certifications requested, during his 
absence, he would not have lost any opportunity nor suffered 
any prejudice because of being away, even if section 22-a 
had not been enacted. The purpose of this section, like that 
of section 245 of the Military Law, is to protect civil service 
employees or candidates, who enter military service, against 
prejudice — not to give them advantages they would not 
have enjoyed had they remained at home. 

By section 22-a a man who incurs military obligations and 
hy reason thereof is unable to accept appointments, is entitled 
to protection; but only when his inability to accept is by 
reason of his military obligations — not when his inability 
to accept was caused by the fact that he was not certified or 
eligible to certification, or by the fact that there was no 
appointment to be accepted. 

The special list provided for should consist of names only 
of persons who were eligible to certification and were not 
certified because absent or who were eligible to appointment 
and declined appointment because of military obligations." 

Legislation 

The Commission renews its recommendations of hist year re- 
garding amendments to the Civil Service Law, as follows: 



26 Report of the State Civil Service Commission 

a. Amend section 11 by striking out the mandatory requiremenl 
for printing in the annual report of the State Commission all 
rules adopted for cities. Under this provision we are obliged to 
print rules for all new cities, as well as the revised rules for other 
cities, approved during the year. Compliance with this section 
of the law largely increases our j)rinting account, and it is of no 

.value to any one as the rules are published by each local com- 
mission for general distribution. Essential amendments to 
municipal rules would be printed, we assume, without statutory 
direction. 

b. Revision of section 11 so as to j)rescribe three as the number 
of members of a municipal civil servMco commission, with a definite 
term of three years arranged so that the term of one commis- 
sioner shall expire on the olth of Deceml)er of each year. Exj)eri- 
ence would indicate that a fixed tenu of ofiice, with overlapping 
periods, is most likely to give good results. 

c. A new section making it a misdemeanor for a candidate in a 
civil service examination, conducted by the State or a Municipal 
Commission, to intentionally accept or use any information or 
assistance imparted by another candidate, or any other person, 
or to use, attempt to use or have in his possa^sion during the 
examination any book, pajx^r or data, which would assist in any 
way in answering the examination questions. The present law 
makes it a misdemeanor for one candidate to aid another candi- 
date, but it does not reach the i)erson who wilfully cheats by co[)y- 
ing from the papers of another, or from paj)ers which have been 
smuggled into the place of examination. 

d. Chtinging the time for filing annual reports by municipal 
civil service commissions from January IHth to Februar\^ Ist. 
This extension of time will be helpful to the local commissions 
and will in no way delay our work in this respect. 

Conclusion 

The Commission desires to express a])preciation of the spirit 
in which its work has been received by appointing officers, and 
the co-0])eration of nnnnci]>al commissions, in its eflForts to make 
the system which they together administer a practical instrument 
for securing efficient conduct of the jaiblic business. It is under 



Report of the Commission 27 

particular obligation to the Attorney-General, and his deputies, 
for advice and assistance, and to representatives of the Civil 
Service Reform Association. 

Accompanying this report will be found the civil list, the chief 
examiner's rcjwrt, tho ii ual statistics concerning examinations, 
and other matters which are reHiuircil by law to be published. 

Respectfully submitted, 

JOHN" C. CLARK, 
WILLARD D. McKINSTRY, 
WILLIAM GORHAM RICE, 

State Civil Service Commission. 



REPORT OF THE CHIEF EXAMINER 



To the Commission: 

The Chief Examiner herewith submits a report of the work 
done imder his supervision during the year ended December 31, 
1918. 

During the calendar year 1918, there were 17,355 applications 
for examination 'filed, and 14,390 persons actually examined as 
shown by the following table: 



KIND OF EXAMINATION 



1. Open competitive 

2. Promotion competitive 

3. Promotion ncm-competitive 

4. Provisiooal. rule VIII — paragraph 4 

5. NoDHsompetitive, rule VIII — paragraph 10 

6. Examinations for non-competitive positions rated at Albany 

7. Examinations for non-competitive positions rated by local 

boards in hospitals and institutions, etc 

8. Total number of persons examined 

9. Number of applicants who failed to appear for examination . 
10. Nuoal)er of applications rejeotod 



Total number of applicants. 



Number 

of 

examinations 



394 
150 



Number 

of 

candidates 



7,193 
1.182 
159 
660 
702 
671 

3.823 



14.390 
1.502 
1.463 



17.356 



The following table gives the above statistics in another form 
and in greater detail : 



KIND OF 
EXAMINATION 


Number 
of 

examina- 
tions 
held 




NuMBBB or Applicants 


-■ 


Passed 


Failed 


Absent 


Rejected 


Total 


1. Open oompetitiTe 

2. PkooBOtioin oompetitive 
2. PftimoCion nonHX>m- 

petitxTe 


394 
150 


5.068 
909 

154 

660 
671 
670 

8.823 


2.125 
273 

5 

isi 

1 


1.420 
82 


1.437 
26 


10,050 
1.290 

159 


4. Rule YUl-A, provia- 
inoal 




660 


S. RuleVIII-10 

«L N-C. rated at Albany. 
7. N-C. r»tad by local 

DoardSa •■••■■••■•• 




702 
671 

3.823 








Total applioants. . . . 


11,865 


2.635 


1.502 


1.463 


17.365 



[29] 



30 



Eeport of the State Civil Sbbvicb Commission 



Comparative Statistics 

Examinations 

1914-1918 



kind of examination 


1918 


1917 


1916 


1916 


19] 


Ooen comDOtitive 


7.193 
1.182 
159 
1.362 
4.494 


8,775 

1,693 

110 

641 

6,039 


13,488 

1.264 

84 

729 

3.740 


18,911 

833 

82 

480 

2,745 


1( 


Promotion comDotitive 




PromotioD non-couiDotitive 




Under rvUe VIII 


1 


Non-comDOtitive 


* 
* 






Total examined 


14,390 
1,502 
1.463 


17,258 
1,953 
1,753 


19,305 
1.919 
2,462 


23.051 
3.948 
2.894 


2 


Failed to appear 


1 


Rejected 


i 






Total applicants 


17.355 


20.964 


23.686 


29.893 









* No statifltics kept. 

The most noticeable fact disclosed by the above table is 
steady decrease since 1915 in the number examined in open C( 
petitive examinations. The decrease is no doubt largely, if 
entirely, due to conditions brought about by the war. 

Number of Competitive Exwminatioiis Held 

1914-1918 



Open competitive 

Promotion competitive 

Total 



1918 


1917 


1916 


1915 


394 
150 


318 
152 


237 
137 


245 

41 


544 


470 


374 


286 



19 



Provisio7W'l Examinations 

The following table shows the number of persons examined 
competitively for provisional appointment under Rule VIII, f 
graph 4, during the years 1912 to 1918 inclusive. 



1912 
1913 
1914 
1915 
1916 
1917 
1918 



** Decrease. 



Number 


Inoreaaein 


Inon 


appointed 


number 


per c 


311 


67 




768 


467 




1,108 


340 




472 


♦636 




236 


♦236 




483 


247 




660 


177 





Repobt of the Chief Examiner 



31 



Examinations under Rule VIII, Section 10 

Civil Service Rule VIII, section 10, reads a^ follows : 

" Whenever a vacancy exists in a position in the competi- 
tive class, and an open competitive examination duly adveiv 
tised does not result in an eligible list of at least three names 
for such position, the head of the office may nominate a 
person to the commission for non-competitive examination, 
and if such nominee shall be certified by the commission as 
qualified, he may be appointed to fill such vacancy. In case 
there is a person serving in such a position under provisional 
examination, and no one applies to compete with him in an 
open competitive examination duly advertised, the pro- 
visional appointment of such person may be made permanent." 

The following table shows the number of persons qualified for 
such appointment during the last seven years. 



1912. 

1913. 

1914.. 

1915. 

1916. 

1917. 

1918. 



Number 


Increaae in 


qualified 


number 


40 
64 




24 


36 


♦28 


27 


♦9 


21 


*6 


156 


135 


671 


415 



Increase 
per cent 



60 
♦44 

♦25 
♦22 
156 
376 



•Decrease. 

The increase in the number of appointments under rule VIII, 
swtion 10, during the past two years, as shown in the preceding 
table, was due principally to the absorption of the available skilled 
labor supply into war activities and the consequent lack of compe- 
tition in examinations. This increase was also due in some meas- 
We to the large number of appointments made to fill temporarily 
4e places of those State employees who were called into the mili- 
tary service. 

Competitive Promotion Examiualions 

During 1918 we examined 1,182 competitors in 150 promotion 
examinations, an average of about eight competitors per exami- 
^tion. In 66 examinations there were fewer than 4 com- 
petitors per examination thus practically eliminating the element 
of competition. 



32 Repokt of the State ChQil Sekvice CoMUisaiON 

Aid to Municipal Commissions 
Several of tte municipal civil service commissions were, 
their request, given assistance by this office during the past 
in the matter of preparing questions and rating papers in co 
tion with various examinations. The Chief Examiner is al 
glad to render this aid, and he is very willing at any tii 
respond to any request from municipal commissions for assis 
in this connection or in any other way in which he can 
service. 

Examinatiatus — No Appointments 
A list of competitive examinations held during the year 
resulting in eligible lists from which no appointments ha- 
yet be^i made 



Report 07 the Chief Examin£B 



33 



Date 

held 



Jvljr 6 

July — 
Aug. — 
Aug. 3 
Aag.- 
Aog. 31 

Aug. — 
Aug. 31 

Sept. 23 
Apt 30 
Sept. 28 
Oct. 5 
Oct 2 
Oct. 8 
Oct 8 
Oct. 2 

Oct a 

Oct. 3 
Oct. 8 
Oet 5 



Oct. 16 
Oct. 5 
Nov. 9 
D«. - 
Dec. 7 
Dec 7 



TiTLB OF EXAUnfATION 



Supervising transit inspector, crade 9, promotion, public service conunis- 
aion, first district 

Teacher, department of eharities and corrections, Westchester county 

Accountant, |p>ade 7, promotion, BrooJdyn btate hospital 

Entry clerk. State fair commission 

Fireman, city and county hall, Erie county 

fitead earpentor, Rome eustodud asylum 

Instructor in shoe making, industry 

Senior assist snt physician, Rome euatodial asylum 

Supervising inspector of steel, grade 9, promotion, public service comniis- 
sion, first district 

Game protector, Clinton county 

Game proteetor, Cortland county 

Game protector, Herkimer county 

Engineering inspector, pubUc service commission, first district, and others . 

Game protector, Erie county 

Game protector, Fulton county 

Game proteetor, Uamiiton oounty 

Game protector, Niagara county 

Gaiow protector, Qneens eounty 

Game protector, Rockland county 

Game proteetor, Sehoharie county 

Gas engineer, or chief gas inspector, public service commission, second 
district 

Stenographer, district attorney's office, Kin^ county 

Supenntendent of county agncuHural exhibits, Btate fair commission 

Patrolman, village of Hastings-on-Hudson 

Assistant steam engineer, Westchester county service 

Junior clerk, grade 3, promotion, public service commission, first district . 

Special investiigator, department of lahar 



Number 

of 
eligibles 



5 
10 
2 
32 
6 
6 
2 
4 

2 
5 
1 
3 
10 
3 
3 
1 
2 
1 
2 
2 

3 
3 

7 
2 

10 

24 
9 



Lack of Satisfactory Competition 

War conditions have accentuated the diiRcnlty of securing 
applicants for State Civil Service positions. The lack of ap 
appropriation for newspaper advertising has always made a prob- 
lem of the matter of bringing examinations to the attention of 
people throughout the State/but even in Xew York city, w^here 
examinations are usually given considerable publicity by the press, 
the number of candidates during each of the past two yeai*s was 
only about 25 per cent of the number for the year 1916. Our 
<»uiitrv's call to service in the recent AVorld War drew millions of 
inen from all walks of life ; people remiaining at home had all they 
could do to keep the w^heels of home industry turning ; the ranks 
of our State Civil Service were depleted, and it was difficult, even 
inipossible in some State activities, to maintain the necessary 
number of employees to keep the State's machinery running. 

Advertisement of Civil Ser\'ice examinations met with little 
^<5j> onse at a time when everyone's attention was centered upon 
^he war. The Civil SciTice of the State, moreover, was placed 



34 



Keport of the State Civil Service Commission 



on a war basis, and war economies were introduced, 
employees in many offices cheerfully assumed extra duties to 
on the work until the boys at the front could return to 
positions. And now that the war is won, and the attenti 
people diverted again to civil life, a larger number of appl 
for State positions may be expected in the coming year. 

The following table, showing preponderance of cand: 
examined in New York city and Albany over candidates 
where in statewide written competitive examinations, show 
need for an appropriation for a more extensive up 
advertising. 

Number of Candidates Examined 



year 


New York City 


Albany 


Elsewhere in Stats 


Number 


Per cent 


Number 


Per cent 


Number 


Per cent 


1916 

1917 

1918 


9.521 
2.464 
1.994 


68.6 
41.4 
36.3 


2.187 
1.549 
2,147 


15.8 
26.0 
39.2 


2,170 
1.937 
1,343 


15.6 
32.6 
24.5 



Repeated examinations for certain positions during 1918 
a very decided falling off in number of candidates. 



TITLE OF POSITION 



Aarintant bacteriologist 

Assistant bacteriologist 

Assistant medical officer, health office, port of 
New York 

Assistant medical officer, health office, port of 
New York 

Assistant physician, regular or homeopathic. . . . 

Assistant physician, regular or homeopathic. . . . 

Assistant physician, regular or homeopathic 

Assistant phsrsician, regular or homeopathic. . . . 

Assistant superintendent, bureau of employment 

Assistant superintendent, bureau of employment 

Bookkeeper and accountant, Nassau county 

Bookkeeper and accountant. Nassau county — 

DiiA>ursing clerk, collector of canal statistics 

Clerk to collector of canal statistics 

Engineering in8i>ector, public service commis- 
sion, first district and other departments 

En^eering in8i>ector. public service commis- 
sion, first district and other departments 

Guard at Industry 

Guard at Industry 

Junior accountant, public service coinmisi»ion, 
first district 

Junior accountant, publi'' service commission, 
first district 



Date of 

eiamina- 

tion 


Number op 


Passed 


Failed 


April 27 
Oct. 5 


5 
12 


13 

1 


Jan. 26 


2 


4 


May 25 
Feb. 23 
Mar. 30 
April 27 
Mav 26 
April 27 
Aug. 3 
Jan. 26 
April 6 
April 27 
Oct. 5 


1 
7 
3 
2 
4 

32 
5 
2 
3 

12 
5 


i 

1 
1 
1 

28 

5 

2 
5 


June 29 


15 


28 


Oct. 6 
Jan. 26 
Aug. 3 


10 

16 
7 


2 

2 


May 25 


9 


2 


Oct. 5 


J 


^ 1 



Rejected 



Kepokt of the Chief Examiner 



35 



TITLE OF POSITION 



Jdoior engineer, grade 8, public service commis- 
feioD, first district 

Junior engineer, pjade 8, public service commis- 
sion, first district 

Junior engineer, grade 8, public service commis- 
sion, first district 

Laboratory apprentice 

Laboratory apprentice 

Lock operator 

Lock operator 

Lock operator 

•Lock operator 

Lock operator 

Lock operator 

Lock operator 

Lock operator 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Matron (cottage) 

Patrdman, village of Larchmont 

Patrolinan, village of Larchmont 

^upenriaing nurse, department of health 

^'uperviaing nurse, department of health 

Library assistant, State library 

Libniy assistant, State library 



Date of 
examina- 
tion 



Feb. 28 

June 29 

Nov. 9 
April 27 
Oct. 5 
Feb. 23 
Mar. 30 
April 27 
May 25 
June 29 
Aug. 3 
Oct. 
Nov. 
Jan. 
Feb. 
Mar. 
April 27 
May 25 
June 29 
Aug. 
Aug. 
Oct. 
Nov. 
Dec. 
Jan. 
Aug. 31 
Feb. 23 
June — 
May 25 
Nov. 9 



5 

9 

26 

23 

30 



3 

31 
5 
9 
7 

26 



Number of Candidates 



Passed 



114 

16 

9 
14 
2 
14 
9 
14 
14 
9 
5 
11 
6 
7 
7 
8 
3 
4 
9 
4 
8 
3 
4 
1 
5 
2 
6 
7 
8 
2 



Failed 



79 

39 

7 
2 



27 

20 
9 
3 

12 
7 
3 
7 
3 
2 
1 
I 
3 



5 
2 



Rejected 



Total 



193 

55 

16 

16 

2 

42 

29 

23 

17 

21 

12 

14 

13 

10 

9 

9 

4 

7 

9 

4 

8 

3 

4 

1 

6 

2 

9 

7 

13 

4 



Advertising Examinations 

The need for effective advertising of examinations has never 
^n so pressing as at present. 

The only publications which give adequate public notice of 
^ur examinations are those which are published by parties who 
3re interested in conducting courses of instruction or in selling 
Wks designed to assist candidates to prepare themselves for 
examinations; there are two such weekly periodicals published 
'Ji Xew York Citv, but none elsewhere in the State. The 
''<iilies in Manhattan and Brooklvn conduct Civil Service columns 
♦'^^d, no doubt, give as much space to such matter.=? as can properly 
■^ afforded gratis. 

^Wspapers published in up-state cities and in the rural dis- 
^ficts give little or no information about Civil Service matters 
Notwithstanding our time-honored practice^ of sending l)roadcast 
throughout the State, newspaper notices of each general series 
^f examinations. 



36 Report of the State Civil Service Commission 

What is the remetly i Undoubtedly the only remedy is for the 
legislature to provide an appropriation for newspaper adver- 
tising.* 

Examinations of general interest should be advertised suitably 
in at least two newspapers in every city of the State, and in a 
number of the papers in the districts outside of cities. Examina- 
tions for technical positions (such as medical, engineering, chemi- 
cal, electric-al, accounting, etc.) should be adveilised in journals 
published in the interests of those technical lines of endeavor. In 
this way only can these examinations be brought to the attention 
of the public. There still remains, however, the problem of reaeh- 
ing the best qualified, for such are usually already employed and 
not looking for an opportunity of change. Probably the best 
avenue of approach to this chiss is by suitable advertising in 
special and toclmical pul)lications. 

Xeeds of the Examinations Division 

In again reporting the needs of the examinations division as 
regards additional rooms, fixtures and employees, thei Chief 
Examiner- calls attention to the Second Report of the Senate 
Committee (theHorton Committee) on Civil Service, transmitted 
to the Legislature January 3, 1917, as follows: 

Personnel pp. S, 10, 20, 20, 30, 31, 39. " The volume of 
work is altogether too large for the present personnel. * * * 
The examining division is undernianneil. * * * The 
examining staff is underpaid. * * * The examining 
force should be greatly strengthened. * * * In the 
large examinations for clerical positions, the examining force 
is so inadequate that clerks and stenogi-aphers are pressed 
into service to rate such subjects as spelling and arithmetic 
The rating of one examiner is not checked or reviewed by 
another examiner or l)y the Chief Examiner, except in rare 
instances. The ratinir made bv one examiner is not checked 
bv another. This is due to the fact that there is not sufii- 
cient forc^ to do it. There must be at least one check on all 
original ratings, l)efore the system is free from obvious 



criticism. 



4f * 



♦As already rerommenfled in tho Seconi Report of the Senate Committee on CivU Service 
transmitted to the Legislature January 3, 1917. 



Report of the Chief Examiner 37 

" The limitations of the staff d^iiand a constant shifting 
from one assignment to another and at times a concentration 
of the entire force on one or two classes of work * * * 

" The present staff is entirely inadequate even for the per- 
formance of the functions contemplated by the existing law 
and rules in the three following respects: Character inves- 
tigation, departmental studies, and medical and physical 
examinations. * * * Therefore any criticism of methods 
and standards of the Commission must be tempered by a 
consideration of all these facts and the statement that,, on 
the limited appropriation available, it is impossible to intro- 
duce advanced methods in administration and high standards 
of examination." 

Additional Rooms aivd Fixtures, pp. 30 and 31. **The 
examining division has not adequate equipment or space for 
the proper conduct of its work. The files used for records, 
papers of candidates, etc., are without locks and not properly 
suited to the purpose for which they are used. There are 
not enough of them to contain the materials which it is neces- 
sary to file, many of the papers being packed in drawers. 
* * * A separate room should be assigned to a custodian 
of papers, which should be given out to other employees only 
on definite orders signed by the Chief Examiner or one of 
his assistants, and every precaution taken to avoid any y)ossi- 
bilitv of abuse. * * * The lack of modern mechanical 
devices for doing computation is worthy of comment." 

In summarizing, it would seem unnecessary" to make any addi- 
tional statement in the matter, so well has the Senate Committee 
outlined the need for a sufficient number of well-paid employees, 
modem equipment and additional space. 

The Chief Examiner's report for 1916 contains the following: 

" If the work of the Civil Service Commission is to reach 
the standard of efficiency which its importance demands, it is 
essential that provision be made for the employment and 
retention of competent examiners, on substantially the same 
salary basis as those engaged in work of a similar grade in 
other departments. 



38 Report of the State Civil Seuvice Commission 

"At present the examining work is much handicapped by 
insufficient and inconveniently arranged rooms. Xearly all 
of the work of rating papers is done in Room 605 on the 
sixth floor, while the other work of the division is done on 
the fourth floor. The resultant inconvenience and loss of 
time are, in the aggregate, a serious handicap.*' 
Present conditions are practically the same as in 191(>. 

Respectfully submitted, 

H. X. SAXTOX, 

Chief Examiner. 
Albiinv, Januarv 31, 1010. 



ORGANIZATION OF THE STATE CIVIL SERVICE 

COMMISSION 



The Commission 
John C. Clark, President. 
Willard D. HcKinstry. 
William Gorham Eice. 

Adminis:ration DiTision 
John C. Birdseye, Secretary. 
George R, Hitchcock, Assistaiit Secretary. 
Julia M. Ryan, Chief Clerk. 
Jacob E. Finkelstein, Hearing Stenographer. 
Loretto A. Ilearley, Stenographer. 
Justina M. Grogan, Stenographer. 
A. Christine Curran, Stenographer. 
Laura M. Boyne, Stenographer. 
Helen R. Haines, Stenographer. 
Anna T. Bums, Stenographer. 
Emily R. Kearney, Stenographer. 
Frances M. Devanna, Cleric. 
Grace E. Bausch, Clrrh. 
Raymond Jones, Clerk. 
William J. Maher, Clerk. 
Charles F. Murphy, Clerk. 
Alma M. Hunter, Clerk. 
Ruth Bennit, Junior Clerk. 
^abel E. Hidley, Telephone Operator. 
^^amuel B. Viner, Messenger. 

Examinations Division 
Harold X. Saxton, L.L.M., Chief Examiner. 
John W. Root, A.B., Examiner. 
H«iry S. Knight, A.B., Examiner. 
Frank H. Densler, Engineering Examiner. 
Herbert E. Hayes, C.E., Examiner. 
Edward J. Hogan, Examiner. 

[391 



40 Report of the State Civil Service Commission 

Gertrude Harder, Examiner. 
Bertha Weir, Examiner. 
Catherine C. Geier, Stenographer. 
Margaret Van Cott, Stenographer. 
Juliette C. Hines, Stenographer. 
Winnifred A. Kelly, Typewriter Copyist. 
Howard F. Lewis, Typewriter Copyist. 
Lillian Barash, Typewriter copyist. 
Lucie I. Vine, Junior Clerk. 
Walter F. Reilly, Page. 
John J. A. Donohue, Page. 

Local Examiners and Institution Boards of Examiners 

Local Medical Examiners 

Albany — J. M. Mosher, M.D., 170 Washington avenue. 

Amsterdam — Arthur V. H. Smyth, M.D. 

Auburn — A. F. Hodgman, M.D., 26 South street. 

Batavia — H. A. Morse, M.D. 

Binghamton — Charles K. Seymour, M.D., 115 Front street. 

Buffalo — William T. Getman, M.D., 155 Allen street 

Caimndaigua — J. H. Jewett, M.D- 

Elmira — R B. Howland, M.D., 306 Lake street 

Glens Falls — W. J. Hunt, M.D., 21 Notre Dame street 

IIomell—G. W. iritchell, M.D., 21 Church Street 

Ithaca — C. F. Denman, M.D., 116 West Seneca street. 

Jamesioum — Morris N. Bemis, M.D., 210 Prendergast avenu< 

Kingston — E. H. Loughran, M.D., 25 Main street 

Loch port — Allan N. Moore, M.D., 70 Niagara avenue. 

Malo7W — John A. Grant, M.D., 92 West Main street. 

Newlmrg — William J. Carr, M.D., 280 Liherty street 

New Fort — Louis R. Wetzmiller, M.D., West Side Y. M. C. A 

318 West Fifty-seventh street, New York cit;v\ 
Ogdensburg — W. Grant Cooper, M.D., 62 Caroline street. 
Olean — J. E. K. Morris, M.D. 
Oneonta — Marshall Latcher, M.D. 
Plaftshurg — J. D. McKinney, M.D., 40 Court street 
Poughheepsie — George nomingway, M.D., 331 Mill street. 
Rochester — C. A. Huher, M.D., 51 Monroe avenue. 



Obqaitization of State Civu. Sekvicb CoicioasiON 41 

Saraiog<^ Springs — Arthur J. Leonard, M.D. 

Synaue — Joseph C. Palmer, M.D., 600 East Genesee street. 

*«(»— H. H. Shaw, M.D., 13 Winston building. 

^atertown — F. R. Calkins, M.D., 4 Cleveland building, Arcade 

Btrset. 
WAife Plains — Sylvanus Purdy, M.D. 

LOOAL EXAMINSBS 

Amrierdam — J. R. £elton, Teacher, High School 

Auburn — Harry A. Crofoot, High School. 

Btnghamton — Pauline W. Elsbree, 514 Chenango street 

Buffalo — Albert O. ,Allgeyer, 556 EUicott square. 

CobkAai—Eaul D. Hewea, High School. 

Dunkirk — Harry D. Eighty, 425 Swan street 

ihnira — H. F. Northrup, 771 Maple avenue. 

Glem Falls — Chester A. Moody, Principal, High School. 

Bomell — Samuel B. Whitney, 30 West Genesee^ street 

Ithaca — John D. Collins, 213 East State street 

J(mestown — Carl La Salle, Teacher, High School 

Kingston — Patrick H. CuUen, 101 West Chester street 

Lockport — A. V. Muller, 86 Ontario street. 

Lowville — Gertrude M. Dean, LowviUe. 

Malone — Arthur E. McClary, People^s Bank building. 

^'ewhurgh — Ira D. Minard, 207 Third street 

^'ew York — George C. Franciscus, 165 Broadway. 

Jforwich — Frank R Wassung, Principal, High School 

()gdenshvrg — Margaret H. McCarthy, 101 Carolina street. 

Okon— Bert E. Albert, 122 Fulton street 

()nemta — George L. Gibbs, Attomey-at-Law. 

Omega — Frederick Leighton, Principal, High School 

Phttshurg — Geo. K. Hawkins, Principal, State Normal School 

Port Henry — C. F. McMaster, Principal, High School. 

PoMam — Allan N. Roberts, 33 Pierpont avenue. 

Poughleepsie — Charles Guenther, Principal, School No. 2. 

Riverhead — Earl B. Robinson, Principal, High School. 

Rochester — R. O. Cook, Rochester Business Institute. 

Syracuse — John V. Meath, 703 McBride street 

I'tica — Charles V. Bbokhout, 1506 Kemble street 



42 Eeport of the State Civil Service Commission 

Warsaw — George W. Glasier, Principal, High School. 
Watertovm — Mason M. Swan, 36 Savings Bank building. 
White Plains — A. C. Butler, Attomey-at-Law, Realty Building 

NON-COMPETITIVE ClASS ExAMINERS IN StATE ChABITABLI 

Penal and Kefobmatory Institutions 

Albion, Western House of Refuge for Women — Etta E. Falkei 

William B. Dye, May E. Crothers. 
Auburn Prison — Robert R. Westover, Lee N. Taplin, George C 

Opdyke. 
Batavia, State School for the Blind — Minnie J. Gould, Williai 

C. Casey, Julia S., Loomis. 
Bath, State Soldiers' and Sailors' Home. — J. McConnell, C J 

Williams, Paul Betowski. 
Bedford, State Reformatory for Women — Margaret S. Hallec] 

M.D., Mary S. Sprague, Mary R. Moore, Ira M. Fish. 
Buffalo, State Institute for Study of Maligna/nt Diseases — Clai 

A. Maclay, Burton T. Simpson, M.D., Katherine M. Danne 
Clinton Prison — J. B. Ransom, M.D., Charles D. Van Ori^ei 

T. F. Coultry. 
Elmira State Reformaiory — Frank L. Christian, M.D., Ivan 1 

Smith, G. A. Shepardson. 
Health Officer, Port of New York — George L. Nicol, Han 

Rabey, James Dillon, Stanley B. Doyle, M.D., Frederick ] 

Lee, M.D., C. S. Hudson, M.D., P. J. Johnson, ^^E.D. 
Hudson, New York State Training School for Girls — Mi 

Minnie J. V. Hogan, Grace N. Sullivan, Lenna J. Craddoc 
Industry, State Agricultural and Industrial School — Julia i 

Ganiard, Miss C. L. CoUson, M. J. Carr. 
Iroquois, Thomas Indian School — Halla Wells, John C. Bre 

nan, Elsie Hayward. 
Letchworth Village, Thiells — Daphne W. Perkins, Harrv i 

Storrs, M.D., Henry L. Weber. 
Naponoch, Eastern New York Reformatory — George Deyo, ] 

B. Hoombeck, De Vere E. Smith. 

Newark, State CAistodial Asi/lum for Feeble-Minded Women- 
Anna Wamecke, M.D., Gertrude M. Palmer, Mrs. Vesta I 
Gilmartin. 



Organization of State Civil Service Commission 43 

Ussining, tSing Sing Prison — Daniel J. Hickey, Thomas J. 

ilclnerney, Thomas F. Egan. 
Oxford^ Woman's Belief Corps Home — Harriet D. Myers, 

Ednah C. Ryder, Hazel A. Derx. 
Raybrookj State Hospital for Incipient Tuberculosis — Harry A. 

Bray, M.D., J. J. Farrington, Linda Clelland. 
Rome, State Custodial Asylum — Fred S. Smith, Mrs. Lonia A. 

Hay, Mary L. Seymour. 
Sonyea, Craig Colony for Epileptics — G. Kirby Collier, M.D., 

William X. Trader, M.D., Arthur L. Shaw, M.D. 
Syrocase, State Institution for Feeble-Minded Children — Julia 

E. Church, Magdalen Reinehr, L. J. Hutchison. 
Vi'est Haversiraw, State Hospital for Crippled and Deformed 

Children — P. Henry Fitzhugh, M.D., Gertrude A. Hoxie, 

John J. Nutt, M.D. 



4 



State Hospitals for Insane 

Binghamton State Hospital — Margaret M. Bloxham, Peter P. 
Lineen. 

Brooklyn State Hospital — Joseph Smith, M.D., Mary E. Patter- 
son, Jesse C. Cotter. 

Buffalo State Hospital — WiWisim W. Wright, M.D., Elsie M. 
Lytle, Frederick L. Wright, M.D. 

Central Islip Stale Hospital — William F. McDonnell, Horatio 
G. Gibson, M.D., Charles M. Burdick, M.D. 

Dannemora Stale Hospital — James H. Kurtz, John R. Ross, 
M.D., Roger Dexter, M.D. 

Gowanda State Homeopathic Hospital — Frederick P. Schenkel- 
berger, Earl V. Gray, M.D., Joseph F. Shea. 

Kings Park Stale Hospital — Jennie B. Gibson, Charles S. Par- 
ker, M.D., Charles S. Pitcher. 

Manhattan Stale Hospital — Dwight S. Spellman, M.D., John R. 
Knapp. M.D., Philip Smith, .M.D., Chester Waterman, ^f.D., 

^Mieawan Stale Hospital — William A. L. Thomas, Joseph W. 
Moore, M.D., Blakely R. Webster, M.D. 

^Uddletown Stale Homeopathic Hospital — Robert C. Woodman, 
M.D., William E. Kelly, M.D., Ida J. Mintzer, :\r.D. 



44 



Report of the State Civil Sbbvics Commissiok 



OgdensHmrg, St. Lawrence SUUe Hospital — Lewis Webb, Artlnu 

G. Lane, M.D., Hyman L. LeriB, M.D. 
Ptmghkeepeie, Htidson River Stmte Hospitel — Willis E. Menri- 

man, M.D., John H. Heilman, Leona E. Todd, ^anehe 

DcMiis, M.D. 
Rochester State Hospital — Calrin L. West, Willard H. Veeder, 

M.D., Francis MeHugh, Agnes L. Toomey, (Jertrude F. Link. 
Utica State Hospital — George H. Tom^, Jr., M.D., CharleB A. 

Mosher, Bessie B. Tibbetts. 
Willard State HospUtU — Thomas J. Cnnrie, M.D., William H. 

Montgomery, M.D., Allen M. Smith. 



COUNTT Lf8TITUTI02f8 

Department of Charities and Corrections, Westchester Co. — 

Calvin Derrick, Forrest S. Lunt, Ruth Taylor. 
lola Sanatorium, West Brighton, Monroe Co. — Edward P. 

Baumann, Jennie M. Vail, Eugene N. Nesbitt. 
Oneida CamUy Hospital, Rome — Margerenia Thomas, Rodney 

F. Kent, Eleanor M. Blust. 
Otkondaga Home and Hospital, Syracuse — Nellie DriscoU, 

Charles MuUin, M.D., Elmer E. Van Benthuysen. 
The Onondaga Sa^natorium — Frederick L. Slocum, Anna M. 

Harlfinger, V. M. Parkinson, M.D. 



List of Commissioners, CUe^ Examiners and Secretaries since the 
enactment of the Civil Service Law, May 4, 1883 



NAME 



Andrew D. White 

AuffiiBtua Schoonmaker. . . 

Henry A. Richmond 

J«kn Jayt 

Dsniet E. Sickk»t 

Georse H. Treadwell 

James H. Maaamg 

JokB A. Sleich«r 

Wiliam A. Poole 

Alexander C. Euntaccf • . • 

E. Prentiss Bailey t 

Willard D. McKinstry 

Do Fovool Van VIcet 

WiltaH A. Cobbt 

Silas W. Burtt 

George P. Ix>rd 

William Miller Colliert... 
Cuthbert W. Pound t 




Date of 
appointment 



Ithaca. . . . 
Kingston . . 

Buffalo 

New York. 
NewToriK. 

Albaay 

Albany 

Albany 

Cantoa.... 
Elmira. . . . 

rtica 

Watertown 

Ithaca 

Lockport . . 
New York. 
Dundee . . . 
Auburn . . . 
Ithaca. . . . 



May 
May 
May 
May 

Dec. 
U^c. 
Dec. 

Dec. 

Dec. 

Dec. 

Nov. 

Nov. 

Feb. 

Jan. 

Mar. 

Jan. 

Feb. 

June 



4. 1883 
4. 1883 
4, 1883 
23. 1883 
28, 1887 
28. 1887 
28. 1887 

16. 1889 
20.1889 
30, 1889 

17. 1892 
17. 1892 
li. 1803 
22. 1.S95 

&. 1895 
20. 1896 

2. 1899 
12. 1900 



Date of termination 
of 



Declined appointment 
Resigned June 1» 1887 
Removed Dec. 28, 1887 
Removed Dec. 38. 1887 
ResiKBed Dee. 30. 18W 
Resigned Dec. 16, 1880 
Rceitfned Dee. 30; 1889 
Resigned Nov. 17, 1892 
Resigned Nov. 17. 1803 
Resigned Feb. 14, 1893 
Resigned Jaa. 3, 1895 
Resigned Jan. 8, 1896 
Resigned Jaa. 81,1865 
Deceased May 29. 1900 
Removed Jan. 11,1901 
Resigned Jan. 26, 1899 
Resigned June 1, 1903 
Resigned Jan. 2. 1906 



fPrrivdnnt. 



Oeoanization of State Civil Sbevice Commission 45 



CLASSIFICATION 



Ttble showing nttmber of positioiu in the unclassified and classified service, 

except laborers, January z, 1919 



DEPARTMENT OR INSTITUTION 



Stats Dspajitments 

Afneohurml experiment station, Geneva 

Airiettlture, Long Island, school of, Farmingdale. 

Ainctthure, school of. Morrisville 

Airiettlture, Schoharie, school of, Coblesldll 

Afrieolture and domestic science, school of, Delhi. 

Aitfaiteeture 

Attorney-general 

^ikini 

fibid, eommisaion for the 

Bridie and tunnel commission 

BroDX Plukway commission 

^irities, board of 

Uril service commission 

Comptroller 

CooKTvation commission 

Qeetioas, superintendent of 

Rmhiiming examiners, board of 

EsgiDeer and surveyor 



Unclas- 
sified 



Executive 

Fiir commission 

Finos and markets, department of 

Feeble-minded, commission on 

F|k bland Park commission 

HmsI supervisor of state charities 

Food commission 

Fonitrv. college of, Syracuse University. 
GeBertI Herkimer Home commlsnon. . . . . 

want eottsge. Mt. McGregor 

Heshh. 



HesHh coundl, public 

Hetkh officer, port of New York 

Kchway commission 

Hoqiital development commission 

Hoiptal commission 

JMtitute for study of malignant disease . 

Iviuttrial commission 

Iniarsnce 

^pd office, commissioners of 

"Ubttry training commission 

Mohansic Lake Reservation commission 

Homunents commission 

^*reotic drug control, department of . . . 

NtBtical school 

gi*csrs Reservation commission 

Jwt wardens, board of 

imoD 



^*QB commission 

^jnn, board of parole for 

^2'pi'** commission on new 

^|wstion commission 

|>{duatric institute 

nalie buildings 

^uiie buildings, trustees of 

|wSc sendee commission, first district . . . 
^wie service commission, second district . 

pwlic works 

2*^ commission 

^^^kr mansion, trustees of 

yoettrj' of state 

ux commission 

J«»«»r 

}^BiT«sit7 of the State of New York 

^Mbiogtoo's headquarters, Newburgh . . . 
** •tkias Glen Reservation 



8 
36 
19 
17 
24 

1 

1 

1 

5 

a 
3 
11 
3 
1 
1 
1 
5 
1 
1 
2 

8 

10 

3 

5 

1 

3 

22 

4 

3 

1 

7 

1 

1 

8 

3 

7 

10 

1 



Clamitibd Sbbvick 



I 



3 
5 

4 
1 
9 
5 
9 
1 
7 
3 
tf 
8 



3 

5 

5 

I 

3 

10 

1 

3 

1 

31 

10 

7 



Exempt 



4 
51 
7 
1 
2 
4 
1 



99 

8 

86 



11 

68 
7 
5 

26 
1 
1 
4 

14 
2 



31 
15 



3 
1 
8 
9 
3 
1 
1 



4 
17 

2 

2 
11 

1 



1 
1 



5 

1 

40 

14 

23 

1 



11 
3 
2 
9 



1 



Com- 
petitive 



20 

7 

4 

3 

2 

77 

75 

69 

17 



24 

60 

33 

177 

266 

34 

1 

270 

107 

46 



259 

2 

1 

20 

154 

15 



213 



32 
380 



45 

7 

688 

136 



Noncom- 
petitive 



.ii|40 



17 

1 

23 

4 

2 

16 

3 

8 

57 

1 

•1.088 

108 

323 

i 

151 

101 

11 

352 

2 

1 



39 
2 
2 



12 



34 

2 

56 



6 
1 



6 
2 



1 
33 



19 

13 

1 



14 



Total 



6 
13 

1 
21 

1 
40 



3 
1 



147) 



68 
45 

2* 

20 

2® 
82 

127 

?2? 

167 

2^ 

2o 

255 

6 

4 
250 

4§g 

«? 

29 
715 

1*6 

6 
5 

P 

ft 





48 Report of the State Civil Service Commission 

Table showing number of positions in the unclassified and classified senrice. 

except laborers, January z, 19 19 — {continued) 



DEPARTMENT OR INSTITUTION 



State Coxjbts 

Appeftls, court of 

Claims, court of 

Supreme court 

Supreme court, appellate divieion . 
Supreme court, appellate term. . . 

Sujpreme court ref ereoe 

MneellaneouB reporter 

State reporter 

Supreme court reporter 



Statb Hospitali for TBS Inbanc 

Bin^amton 

Brooklyn 

Buffalo 

Central Islip 

Dannemora 

Gowanda 

Hudson River 

KingePark 

Manhattan 

Matteawan 

Middletown 

Rodieeter 

St. Lawrence 

Utioa 

WiUard 



Unci 
sified' 



State iNanruTiOKia 

Auburn prison 

Clinton prison 

GrMit Meadow prison 

Sin^ Sing prison 

Albion, house of refuge 

Batavia, school for the blind 

Bath, soldiers' and sailors' home 

Bedford, reformatory for women 

Elmira reformatory 

Hudson, training school for girls 

Industry, agricultural and industrial school 

Iroquois. Thomas Indian school 

Napanoch. Eastern New York rcformator>' 

Newark custodial as^ylum 

Oxford, women's relief corps home 

Ray Brook, hospital for incipient tuberculosis . . 

Rome custodial asylum 

Scnyea, Craig colony « 

Syracuse, institution for feeble-minded children . 

Tlidells, Lctchworth village 

Valatie, farm for women 

West Haverstraw, hospital for crippled and de- 
formed children 



An>any. . . 
Brockport . 
Buffalo. . . 
Cortland.. 
FVedonia.. 



NORai AL SCHOOUi 



New Palts . 
Oneonta. . . 
Oswego — 
Plattsburg. 
Potsdam . . , 



Total state service , 



10 

5 

76 

25 



6 
1 



7 
7 
7 
7 



7 
7 
7 

7 



7 
7 
7 
7 
7 



7 
7 
7 
7 
7 
7 
15 
7 

'7 
7 
7 
7 
7 
7 
7 



CLASSinEO Skrvick 



Exempt 



78 
36 
49 
40 
42 
47 
36 
50 
40 
33 
55 



1.235 



4 
4 
4 
4 



Com- 
petitive 



35 


1 




2 


12 




114 


336 




64 


33 


2 


3 


8 




4 


6 




1 


4 




3 


6 






84 


884 




26 


184 




2» 


271 




46 


575 




9 


92 




27 


123 




99 


481 




50 


558 




72 


681 




15 


140 




31 


264 




23 


246 




32 


274 




28 


301 




32 


300 



4 
1 
3 



3 
3 



4 

i 



1 
1 
1 
1 
1 
1 
1 
1 
1 
1 
1 



894 



132 

133 
53 

125 
26 
25 
39 
50 

104 
60 

114 
16 
33 
22 
11 
8 
27 
39 
25 
21 
1 

11 



7 
1 
2 
1 
2 
1 
1 
2 
2 
2 
1 



Noncom* 
petitive 



7.505 



Total 



16 



5.807 



■- 



46. 

19 
525^ 
134 

6. 

la 

6. 

s. 

9- 



488. 

167 



101 

157 
477 
618. 
710- 
155. 



27«. 
818> 
336. 
839 



8 


144- 


7 


184 


1 


68^ 


1 


110 


19 


62 


15 


47 


86 


187 


45 


losr 


3 


117 


48 


lip- 


83 


ids 


17 


4a 


2 


38. 


68 


97 


14 


85. 


81 


4fr 


198 


t» 


106 


156- 


67 


99 


50 


78. 


3 


S 



8^ 

88. 

62. 

42 

45 

49 

88. 

58. 

42 

86. 

57 



15.441 



». viBSi^iri.]'/?:?lj 



50 



Report of the State Civil Sebvice Commission 



Table showing niiinber of positions in the nnclassified and classified sei 

except laborers, January i, 1919 — (continued) 



department or institution 



MoNBOB County — {Contintisd) 

Special county judge 

Ck>urt house 

County engineer 

District attorney 

Elections, board of 

Monroe county suiatorium 

Library, appeOate division 

Penitentiary 

Purchasing agent 

Sheriff 

Superintendent of the poor 

Supervisors, boud of 

Surrogate 

Treasurer 



Namau Countt 

Child welfare, board of 

Commission on government of county , 

Commissioner of jurors 

County clerk 

County comptroller 

County court 

Dtstriot attorney 

Elections, board of 

Mosquito extermination commission. . 

Sheriff 

Superintendent of the poor , 

Supervisors, board of 

Surrogate 

Treasurer 



Unclas- 
sified 



New York County 

Commissioner of jurors 

Commissioner of rec<nds 

Commissioner of records, surrogate's court . 

County derk 

Court of general sessions 

District attorney , 

Public administrator 

Register 

Sheriff 

Surrogates 



NiAGABA County 

Commissioner of jurors 

County clerk 

County court 

County suiatorium 

District attomnr 

Elections, board of 

Highways, oommissicmer of 

Sheriff 

Superintendent of the poor 

Supervisors, board of 

Treasurer 



Onbida County 

Child welfare, IxMud of 

Commissioner of jurors 

Comptroltor 

County clerk 

County court 

County hospital 

District attorney 

Eguatisation, board of 

Highwasrs, department of 

Sheriff 

Superintendent of the poor 

Supervisors, board of 

Surrogate 

Treasurer 



1 
1 



1 
1 
1 
1 
1 
1 



1 
1 
1 
1 
1 
2 



1 
1 
2 
1 
I 



1 
1 
1 
1 
7 
1 
1 
1 
1 
2 



1 
1 
1 



CLASBincD Sbrvics 



Exempt 



1 
1 



1 
1 
1 
1 



1 
1 
1 
2 



1 
1 
3 
2 
1 



7 
1 



3 
5 
2 
2 
2 



1 
1 
1 
2 
1 
2 
5 
2 
1 



1 
1 
2 
1 



2 

3 

2 

5 

17 

84 

2 

5 

5 

13 



1 
2 



3 
2 



2 

i 



1 
1 
2 
2 



1 

4 
3 
2 
1 



Com- 
petitive 



12 
6 
4 
3 
7 
3 

10 
2 

18 

10 
3 
9 
5 



13 
3 
1 
6 



6 



Nonoom- 
petitive 



19 

4 
11 



30 

41 

19 

83 

86 

94 

7 

118 

9 

73 



1 
12 

4 
2 



6 



2 
2 



1 
1 



3 
2 
5 



1 
2 



5 
7 
5 



25 



27 



10 



21 



Classificatiox 51 

Tibk ihowini nambei of poiitloos in the nncUssified and cluiified wirice, 
except Uboren, Jannary i, igig — (eoniinutid) 



52 EEroRT OF THE State Civil Service Commission 

Table tkowi^K aiunber ti p— i ti oM im the unclaaaified aai clasaified wi 

ezoept lAborers, January i, 1919 — (continued) 



DEPARTMENT OR INSTITUTION 



UneUs- 
eified 



Suffolk Coukty 

Auditor 

Child welfare, board of 

County clerk 

County court 

District attorney 

Ejections, board of 

Sheriff 

Suffolk sanatorium 

Superintendent of the poor 

Supervisors, board of 

Surrogate 

Treasurer 



UuSTEa COUNTT 

County clerk 

County court 

District attorney 

Elections, board of 

Highways, department of 

Superintendent of the poor 

Sopervisors, board of 

Surrogate 

Treasurer 



We8tch»ter County 
Commissioner of charities and corrections. 

Commissioner of jurors 

Comptroller 

County attorney 

County clerk 

County court 

District attornev 

Elections, board of 

Register 

Sheriff 

Supervisors, board of 

Surrogate 

Treasurer 



County probation officers, county sealers of 
weights and measures, and county superintend 
ents of highways in counties the entu-e ser\-ice 
of which has not been classiSed: 

Probation officers 

Sealers of weights and measures 

Superintendents of highways 

County tuberculosis sanatoriums in counties the 
entire service of whieh has not been classified: 

Broome county. Mountain sanatorium 

Cattaraugus county, Rocky Crest sanatorium 

Chemung county tuberculosis hospital 

Chenango county tuberculosis hospital 

Fulton eounty. Summit View sanatorium.. . . 

Jefferson county sanatorium 

Montgomery county tuberculosis hospital. . . 

Ontario county, Oak Mount sanatorium .... 

Oswego county tuberculoais hospital 

Saratoga county. Homestead sanatorium. . . . 

Schenectady county. Glearidfrc sanatorium . . 

Steuben county. Pleasant Valley sanatorium. 

Tompkins county, Edward Meanj' sanato- 



rium 



Co inty visiting nurees in counties the entire ser- 
vice of which has not been classified 



Total county service. 



1 
1 
1 
2 
1 



1 
1 
1 
1 



1 
1 
1 
2 



4 

1 
1 



1 
1 
I 
2 
1 
1 
5 
1 
1 



225 



CUUMIFIKD SkRVICB 



Exempt 



1 
1 
3 
1 
3 
3 



1 
1 
2 
1 



1 
1 
1 
3 



4 
1 
1 
1 



3 
1 
1 
4 
3 
1 
6 
3 
2 
2 
1 
3 
2 



580 



Com- 
petitive 



Noncom- 
petitive 



14 
2 
1 



2 
5 

7 

4 

3 

16 



5 
1 
1 



2 
1 
1 
4 

1 



22 
2 



10 

4 
1 



22 
9 
2 



20 
42 
44 



1 
1 
1 
1 
1 
1 
2 
2 
1 
2 
1 
1 



2.259 



• ■ • « • 

• » • a • 

'9 

• • • • * 

• ■ • « « 



26 



• • 



•5 
9 



8 

8 
3 
5 

11 
8 

14 
8 



296 



Classification 



53 



lAk showing number of positions in the unclassified and classified sendee, 
except laborers, January x, '19x9 — {concluded) 



DEPART&fENT OR INSTITUTION 



VILLAGES 



luON 

ThiitMt, board of 

Poliee department 

fin department 

H«dth. board of 

light eommiarioners. board of. . 
fiener commiaaionerB, board of . 
Street commweionew, board of. 
^•tcr mmmiwioners, board of . 



^ OaBININO 

Tnuteee. board of 

we department 

Water commiarionerB, board of. 

^hh, board of 

street department 



T^Qrteee. board of . 

|Wth, board of 

^ department 

Hiibwiy department 

Wice department 

Water commiauoners, board of , 



- POBT CnSTSB 

i^tttee^ board of 

Hedth. board of 

R» department 

Jofiee department 

wreet department 



Undaa- 
nSed 



CLABsmsD Skbticx 



I 



7 

1 



Total villace senrioe 

Weitchester county, towns and villages, police 
wnrioe 



Grand total. 



15 



Exempt 



9 



9 
3 



44 



3 



1 
1 



2 

1 



2 
1 



18 



1.504 



1.492 



Com- 
petitive 



6 
2 
2 

4 
1 
1 
2 



1 
5 
9 
1 
3 



1 

4 
1 
1 
11 
9 



5 
2 
1 
16 
1 



89 
153 



10.006 



Noncom< 
petitive 



Total 



6 



10 



10 
7 
3 
8 
5 
1 
1 
2 



18 
7 
9 
2 
3 



12 

4 
7 
1 
13 
9 



16 
6 
2 

19 
1 



161 
153 



6.113 



19.115 



On January 1, 1919, there were 2,212 persons on military duty, as shown 
^ the records of the Commission, as follows: Unclassified service 17; 
exempt class, 48; competitive class, 1,433; non-competitive class. 714. These 
positions are not included in the fore^oin^ table. 



CIVIL LIST 



OF THE 



STATE, COUNTY AND VILLAGE SERVICE 
Classified Under the State Civil Service Rule 



JANUARY 1, 1919 



ASTERISK (*) INDICATES THAT PERSON IS ABSENT ON MILITARY DUTY 

EXEMPT CLASS REVISED TO MARCH 1, »19 



[55] 



56 



Refobt of State Civil Sebviob Commission 



e 








o 



50 

O 



8 



01 
0» 



iO o o 
Ot ot ot 



.J lo e« ef off mS a» of ^ 

•H pH *H ^4 «m {Q 

Ot OtOtOtOtOIOt90t 

V4 ^4 V4 ^ ^4 0Q 



3 



•3 




a 
« 



>3 






o 

a 



£0 



lllflil :| 



» 






a .M 



Ik. .S 



u 



I 

3 

O 

s 



8SS 
ill 



S oB 00 9 



w * ^ 

iii 

*i« *H v4 

a - a 



I 



J 



I til 

• o • 

2: 

fc 

& 

a 

6 



a 

Q 






Owl 

• ■a 



"3 W W 

fl o • 
« ^ ii 

If 

n 00 ao 



Classified Civil List — State Depabtments 



57 



888SS888888888S8S 

c o c o o e Q 
a « S S X c r« 



<D S o fp O do 
Ok a» 9 V e« 1^ 



O O Q 

o «o O 
o Ok e» 



8888888888888588 



88 



8 






©^•^iowe«i^^tH»^i-^^«^co^«-t»^ 






e« CO 



e ic M >4 



as 



« X — o •-• »o 



^4 «M ^4 l>4 O 



gQQ^«3^X00^OQ0^I^O<-i^O 
«o«oSo»o>o»aia»o>o>a»aDa»ooa 



<roctot^«t>»cQt>»^cinoo^Ac«c« r-oo5ior*ooeo^oooi-«»>»o«-'»cto 

e9saioototoi>Bflboooi9Qcaoaboo vbaotoo&ootokakoiakakwooa* 






1^ W I"* •- o 







-t^^ooss ao 



flw g2 S?. »^w 



o 
t 






e 
a 



'o^S? 






^ ^ a be 



a 




Sjlllll 




O 







o 






.fi TJ ~ 5 

•c o g 5 ^ 




^ »-• •^ 




68 



Report of State Civil Service Commission 



d 

o 

a 
E 

cS 




« § J! 



! § a 



s 



o 

»»« 
O 



88888SS8S88S8888S3SSSSS8 



888 



8 



8 

o 



88 






10 O «H 






t^W^1-*W^wt»iiOt^ 






ce 



^^"^ 



9 
a 



Ok a *» 



a 






o 

0» 



Oi9O>CiO)00OiOkOkOkOft 









»-i i-i oo ^ >o >c t^ 



c 

01 



1-^ 










o 



c ^ „ 

PL, O fa . fa 

S o 12 ^ ^ 



I 

«^ 

^ fa 






a 

QQ 

fa 



a 

a 

n S *S 



^■S 



5 " 

1(2 



a 



9 

M 

fa Ed fa 



it a 



"- =3 « o £ o j^- j= '^-' :? 






W O 03 ^ -g -O ^ 

9 (o tf (ti »^ aS ^ 



s 

E 

es 



la 

ft, 73 




•§ 



.9 



« « O O • « 0) 

X X U3 ^ ^ X U3 

u o o o o o o 
a a c a 

9 'S 





S S '§ ^ i 






.2 



♦* ♦» sf c. 

.2 .28 * 5. 



- - — — o o flj "" a 



5 ^ ■£ -s 5 § g 5 

IS'!-. 




•al 



Ci.A8siPii£D Civil, List — State Depahtmests 



8S8S8S8SSSSS8SSSeS8SSS388 



-^^r.«o 


«oe»:c»»K:r«««o^i^oc«j-. ««ex»«x,»««cc 


S22S2 


S222££2S222222222£a22S222£222 


mt- 


immmmmmiiiimm 


rt ft. n B 


«o«.= MS!Coot-«oct-t- = KaiKooo«P-««»Ka5«t-„ 








■ i5 I 

t-^=» = -' l| ||x| 

llll l< JoJ* 




60 



Repobt of State Civile Ssrvicb Comiussion 



Ui 

Q 

< 

CO 

1-4 

O 
O 



a 

o 

'3 



o 
O 



5-3 



5 



a 






lie 
a s ft 

§•8 



88S§8§ 

<^ ^ S 5 fi P 
a 9 2 o e M 



88 

88 



8 - 

c .M a 

*s 9 5 

s a •'^ 



t^ «P »o 
«-< IM ^^ 

Ok G a» 

w* ^-t f^ 


h- cc o 

wt f^ r^ 

Oi Oi a 

^^ ri^ «-< 


Mar. 14 
July 1 
Nov. 19 


Jan. 16 
July 1, 
Dec. 27, 


Mar. 14. 1917 
June 7.1916 
Nov. 19. 1915 


Jan. 16. 1917 
Jan. 22. 1916 
Dee. 27. 1916 



N 





1.800 00 


CO 

•H 

o 

i 

z 


April 5.1916 
Aug. 18.1911 
Aug. 18.1911 
Aug. 18.1911 
May 11,1918 
May 11. 1918 
April 1.1916 
July 1. 1917 


CO 

Ok 

i 

z 


April 5.1915 
Aug. 18.1911 
Aug. 18. 1911 
Aug. 18. 1911 
May 11.1913 
May 11. 1918 
April 1,1916 
July 1, 1917 



a 
>> 



pq 



?2 



o 



O 



00 



. J* 

5 0- j3 






3 0) 0) 

dp 

I £ 

■I Ct 



a 

o 

O 



M 



9 sa 



ft; -c *i 
S 3 « ^ 



8 






s 



8 

E 



a 



Si 

Q ^ ^ o S 
-: * '^ "S^ i5 ffl 



« « g g 2 e 
?. S £ •£ O ^ 








o ^ 



^^ ^ t. • ;2 c • 

Q •< Q » p4 tz: h 



z 

o 



O 



S a« 

. c c 

»- Si i o s 
Si £ 6 G C -5 

I S I *8 1 1" 

tt ago «< '<0 



C 



■E 



1 



o 

a 
CQ 



mm ^^mm 

« - — 



Classiyixd Civil List — State Departments 



61 



S88888888S8 
S 5 •* « 8 S 



o o 8 8 

o 9 3 s 

■* 5 :1 2 

^ S 00 « 



888888 



h- as ^ 



§ 



^ ^^ m4 rm r^ w^ 



O 9 O O O 01 


1^ 

01 

9^ 


Ok 




01 


o 

•4 


«4 M M M 


• 
«4 


»4 


V4 


• 
f>4 


• 
^4 


m 


r^ 




^ 

►^ 


>» 
5 


3 




•^ •• p* »• 


«4 




1^ 


o» 


o 

Oft 




00 

o 


•«•*•< WH 


*4 




«i4 


«H 


• 


» 


• 


July 
July 
July 
July 


X K >k 

512 


"3 


K 

3 


1 





« 00 « CO 

*M *4 ^>l W4 

o a» o o 

^4 *M r4 vM 

• •> • • 

^ ^4 ,.4 lO 



>» ^ 



J3 ♦* 
Ea, O 



t-) tf> .-• W) 

•-» fi^ A O 



« « 



XI S3 = 

■s-a:3 



la's X.' e : S-H-aa 



a S 15 13 IS 



a 






-< • 



8 



336 



a 



c < at 
fc 55 C « O -< 00 O 






I- 



».l 






S „ 



CO o^ A 

MT3 




C 
0) 

e 

a 
T 

K 

o 
m 

E 



1 = 
SI 

O "o 
OS > 



•Qeq93r}or«xaor«»-90 
OkOoooiaoAotaaob 



s 



iQiOiOiOQ00b<-«^*MM^fH 
M M CI -^ 

ft § § 3 ftJ-333 o-S-d 



« r« 00 00 

Ok Ot 9 0> Q 

3 
o 



OkAOIOtOOSiOtOOtOOb 



o 

a 

O 
CO 



« 


lO 


•c" 


• 

2 


iC 


00 




00* 


-^ »o 


oo' 


i-T 


•^ 






N 


M 


N 


t^ 




C4 


»^ 








1 


1 

< 


• 
e 


8 


9 


1 

< 


i 

s 




Sept. 
Sept. 




•t 

^ 






s 

O 

o 

o 

» 

u 

CO 



I! 

--0 

J-3 



.a 



^ i: ^ 73 38 • 
Jc SiB J 5 I 

a eS * g "^ 3 




^ 
ofi 



jC 



■5 






s. « 

2 ^ 

- 3 

u a! 

«M 3 

0^ 



< '2 



■c 3 



cS 
'^ *^ 

a -3 

•si 

H "3 



I 






a 

3-i 



T3 

u 

■I 
o 



•o a 



.s 

to %m 

S 2 



s s s a 



a a a 



h hi 

2 ® 

3 3 



62 



Repobt of State Civil Service Commission 



•n 



I 

I 

Q 
O 

o 

CO 



H 

CO 

a 

o 



s 

o 

o 
o 
n 

CO 



a 
o 

I 

a 




•g-a-p 
g-8 



^ s I 

111 



I 



^ 



3 



z 

o 

H 

03 



88S8888SS 88 



I 



O 
CI 












>» >» ^. ^ 

333 « 

l>) »-9 Mi, 



-^ T^ "^ « -^ 



Ss 






00 r« 

(O od 

a* a» 

(O 00 




8 



M 

o 
O 






5 1 






s 
c 

O 



S H 



S -5 u *» 



S 

a 
o 

s 







a 



I' 
1. 

OQ U 



01 



•c 



tft t* I* 

*4 v^ mH 

a» a» 01 



»« o « 

mH aii^ *i« 

0» 01 Ok 



MS 00 00 00 g* ^ 

i 



Si o « 

< Em fa 



fa c *< 



K3 

01 






•O I* t* 

1-* ^m r-^ 

O) a» o 



1^ o « 

(M 1^ p^ 

01 a» Ok 



kO 00 00 00 



<< fa fa 



I 



as 

III 



M 
O 

S 

H 
OQ 



5 

1 



=3 




|«5 

a 01 « 



o 

o 

o 
n 

CO 






I 



OQ 



. a 



? Ji 



S « / "O 

COM 

'^ ;^ •• 



i 

•c 
. o 

III' 



I 



Classified Civjl List — State Depaktmekts 



63 



8888S888888888 88888 8S 



55 

eo CO 



!§§§ 



8 888S3 



O I* 



m aO ^ ^ iM 






■• « 10 »• 






w *0 ^4 p^ *-i iM 



SSli « &« s-t s-t & 






o?; 






r« a» <-< e t» 

W4 *i^ ^4 ^4 ^4 

Ok O Ok O Ok 



^ ^ fe •-» fe 



r* » •-• N »» 

w4 aii^ ^4 t^ v^ 

Ot 0> 01 Oi o> 



•« P« KJ 



*MlO*0«^lO*>ltM•^l•^ 



« N « 1M «-^ i-l 






Xi 



9 o 



O Ok 

a» o» 
11 



eo 

a 

« 

ro 
eo 



^ 


r* 


f 


00 


«D 


^^ 


f-4 


^4 


»-< 


»-^ 


o 


a» 


a 


o 


O 


m4 


•ii4 


p^ 


*<^ 


fM 


o 


C^l 


* 


d 


* 


•— 


CM 


t^ 




C4 


c 


>» 




c 


>k 


«t 


3 


w« 


es 


d 


>^ 


•^ 


#4 


-9 


•-» 



* In. ^ X O 

«M »^ »M t^ »^ 

o> o> o> a o 

t^ ^H fii* p^ ,M 

« CM fld c» V 

1^ ?■» -N CM 

3 3 -s 5 s 



•^ »-» «< 



! 



a * • J8 



! 

s 







-31 




! 



M 




•gal's 

<3 c ^ fl 



g3 



a 

U3 






a 




^ pC4 C^ 24 0) 







^•8 
"I 



o 



» 






iss-5 







- 5 -S •£ 



oc 




64 



Report of State Civil Sebviob Commissioit 



a 
o 

i 

a 

o 
O 



a 



g 






a d 




a 

2 



888SS8S888888888888888888S 



o 



O 



II 



8 



§§§§ 



§§i§g§§§ll§§§ 



•^ w 



M 



M M e« 



jililliiiliiiiiiliiililiil 




CLAssiriBD CiTii, List — Statk Depabtkeitts 



65 



83S3383 3 8333SS3888S3S338 S SS SS 8 88 S 3 
lUiiil I 3§ll§§l§§l§§§§§§i 



M N e« M M C« C* 



C< 



M C« CI CO ^ ^ v^ 



2009^00 o ot<*b-b-f^a»oc«r«^tN.e«'<rQec9aoe>ic>«x^«3aoe>»eoao 



-r»H aa (^ t^ ^ ^ 



;?*• 



*«h*r«e«e*»h**Hr^ 



2;X 



C* (O to «o 
M •^ M ^ 



01 *^ CO v4 V4 v^ v4 



•<«• o 



I iimiliiiiiiiiiiiiiiliiii 









•-• e# •^ b» t^ 



h*t^e«c«a»h^<dc«<di4c»«du;i«roi«o«otN^ao«oV 



<<< 



-< 55 ^ -< oB 5i -< -< 4 



iH^. 



3 



III 



d 

at 











H c* 5 o cS SS 









9 









if 

CO X 



9 «* 8 ^B 
- a 2 S 

<* << a H S & 




•St 



a jj 

ill 



0) 










So fl a a a a a 
9 o o o O Q Q 

2 V t^ o p o o 

E| g 2 2 S| 
«• ^ -5 2 «: II ^ 

8 8 If a a 3 1 

SS8 8 8 8 8 i 

'S "5 -S "3 "S "S "S "3 




8 

•a 

5 



9 




s s • • 
^ as 



& d « 



8" 




iiliilil 

iliiiii 



:3 a 

00 a 



a a -ja .3 

III! 




Ills 

mm* '0^ *0* 

M M M 
o o o 

CO GO X H 



533 



s ^ 

o 9 

•5 .^ 

4 *-• •^ 

Si § 5 

X o « 

W M o 



a 

E 
*»< 

09 
U 






o 



I 

3 

T5 

C 
eS 



^ S a 

i 
3 






5 



66 



Eepobt of State Civil Seevice Commission 



50 



•9 

1 



T5 
& 



9 " 

g-8 







o 

H 

o 



88SS8S8S8S888888888S8888SS 



8 



8 



cs 



COW'-'CICOMW-^^ 






»-• eo »o 
C4 ct 



•-» >^ •-» 



2 % J >» > >. >» 

§^43,?33 
z •-» •-» 



•< N, 









«S§oio»(»Sc>»o22222225*2SJ22222 



M M C« «-• 



O 



C4 



jo^o»ggo;o-«-««-o 



M 



3 33iS»23353»S ^^^-/S a «r{^5^ 







5 ^ S 5•« 
•< < -? X »*5 




%; ^ V ^ •>* 



c T 





« 



IS 






Classified Civil List — State Departments 



07 



SiSSiSS 

a n o 00 00 to o 



o 



s 



NSImv^p^ ^^ to »H 



S§88S88§888SS888§538 

00000000000000000300 



OO to O (D O *D 



CO o o to lO iQ lO to IC iC lo' to ^ 



» N t. O « O C9 

M M I-* (H O *^ *^ 

9 a 9 O 3> Ok o 



• V • O .: ^ • iv 



« N N '^ N « O 

-< ^ -^ O Q « 5 

e o o o S 00 o 



Na»Hx^f-ioi»^ 



•c g 









< 



a 



i a J 8 



gS gt-8r- ?« 



slfcl 



2 *• IT* 



*• >. b 

e •? }: 



h *• 



£ S 



er 
c g « 



ii|HI|i 






^?» 






c 






c 
»-9 



o»ot^to>-4ioroiOoo«Dtotoorot^3Ct«L'^ »C3 



a 


lO 


»^ 


•o 


•4 


»o 


CO 


O 


•O 


o 


»c 


»o 


« 


»>. 


h- 


« 


r^ 


^"i 


o 


o 


v^ 


v^ 


1— 


f-4 


v^ 


1-H 


•>4 


i>^ 


^^ 


Vi>4 


r^ 


w^ 


VH 


•>4 


»-4 


«M 


v4 


p^ 


•>4 


I^ 




o 

• 






o 

* 


«-4 


* 






0» 




a 


«-4 








3» 

^« 

■» 

CO 


5> 




9 


c 


• 

J3 




3 


a 


• 


08 


• 

c 


• 

a 


4J 

a 


d 


• 

c 


■»a 


• 

c 


■*i 


>. 


'M 


e 


(3 


a 


4 


£ 


V4 




4 


s 




A 


eg 


08 


08 


o 


O 


•^ 


O 




OS 


08 






CO 



2 







« IS .a o 



o ^ 5 w ^ 

^ Ks o ^ "5 

«t« to ^ »• .9 

<-■ lA O ^ U 



a 
> 

o 

« 

C 

o 



> 

e 



6 s 

8^ 



5 



OQ 



^6 

OQ ;^ 



S5g 



^ g 

00 O 






s « 



o 




c 
o 

e 



^ r_"i •** 

^ 8° 

Jtf 4 CI 












e 






a a 

rt" ^ ea >^ «* 
» •-» Cm 1-4 ^ 



— X 



•g* 



OS • 

ou a 



2 



c 



333333333333333333 = 3 



68 



Refobt or Statb Cmi. Skbvicb Cohkission 



8 

•a 

I 

e 
6 




•»^ 






|s 



f 

St 
••* 

^« 

K 

8 



I 

H 
O 

o 




o 



OQ 
O 



8SS888S888SS 



^ ^ ^ CO 90 ^ 



sss 



« •* ^ 



833838388 

5 2 o 8 8 e 



^4 V4 ^4 fi^ 99 *^ (^ 



O^ 0> 0> 0> O Ok Ok 0> Ok O 0> Ci 



90 ^ e< 



•*» •*»^ "^ < i^ 



s 



i^d a 



•^Z i^ »» »^ 2 



■oeosa>>*r»aor«QOOico 

^^ ^^ ^^ •* w^ m^ *-• w^ !>• w^ m^ ^^ 

OS OB OB OS O OB Oi Oi 0> OB Ok Ok 




a»O0B0K0Be>0B9C» 



a 



sf s 




•H CO ^ e«i 



a a ($ c ^^ 
jc 3 a* « ? 9 



5 « 5"^ 3^ S"? S j 



M 




I n 



!•? lis 

SSaSH « 



2 

^* «•► eo 




5 2-^^ 






to 



s«^ 




C» ^ IM 






0) 









5> 

< 



•ookioaiiAK»eo*o*o 

Ok0900BOK999 



< ^ OQ . 
- 0* ^ CO < 






i 

II 

«i QB 

P «• g| 




tl lllli 



e 

9 






•b % 



>>>>>> 






^11 

• '•J 4i> ** ai ? V S 

"I'-S'l-lll 
•S = = = g||s 

Hi 



3 3 

a 




CioasiFizu Civil List — State Depabtmbxts 



69 



888 



« « N 

M «4 «4 

• a » 

«4 P4 p4 

• • • 

ill 




8S8SS8S8888SS8SSSS8S88S8 



a 

I 



o 





3 «8 

S 4B 



2 3 3 3 

2 2 2 s « 






° ® « >: X 
t to ** 

2 ti-? 



js .5 

t, *> S 

|§ 
•c -x; 

« 6 



s 

c 
6 

a 
•s 

e 




§ig§S§§§§§i 



»« to 



^^CQN^^MCO^^COCO 



ssa|iasl5ss5ss||s|s||||| 




a 



a 









•8^ O *J 



9 
d 



9 2 2 3 6 -5 -S 



I 



-I 



s 



d 
^ X X X 3 «g '3 



J J J 8 
.ti ^ "^ ^ 

*y* •" •"» ••• 



o c c o 



70 



Rbpoet of State Civil Service Commission 



d 

o 

a 
6 



sit 



a _ 






.SOD 

S E a 



55 



»5 

O 



00 

O 

P4 



85i3S§8§88S8SS§8SS8S88SS88 



ioiduSM»i?5oQQO 



OOQOQ*0(6id 



8 



o p c o o 

Q C^ ?l <M M 

B5 CO CO CO w 



coronneoe>ic9e«e«e«cicoeocii-«e« 



C9iOiOM9iOtr3iOiOOiOOiOC90*^000 



o M ^ o o •<» le 

*<4 ^rf V4 ^14 Vi4 ai^ ^4 

9 O O Ok Ok 9 O 









>» *? ♦i ^ X « 









C9iOiOiOiO>0*0*OOiOtDiAC4aOeOOO>OAOCIOOOeOiQ 



«o ^ 



M ** «0 

«-• « ^ 



-^w el ^^N^wei N 

lllJSJ 51-88 «|sg« si ?-S-8|-|gS|g 









« o • 

M ja J3 

O. O. A 

&u 

o o o 
a a a 

5 5 5 

CO 00 oo 



« c; V 

^ .a .a 

C. O. Q. 

o o o 

a d 

ii ® s 

'*' «rf 'd 

00 00 00 




00 09 



Classified Civil List — State Departments 



71 



^^i2B2S888S88 888 88 88888888 






CO 



8 S e^i 



o _ ^ 

M C4 O O 



^ s s s 

r* r* t» t» 



o o 



ss 



<0 iQ lO 






< e *: a 
5 « 5 



■» ►n ^ ►n 












lllll^ 



>» >» ft. & 



c»:ill^ 




:o : : 

. . n . 






2 ca 



:5S>i| &J 



i ^ < JO ^ ^ 

' . - ^ a ^ 

*; ^ .5 03 M *i ft* 






5 ^ ^ 



? 



« 3 



43 

e 

2 

> o 



£-IJs 

!* ■* .^ .lis 



I 

M 

2 - 
a o 

. o 

us 
So 

IJ 






S 



I 

•< E 



(5 



M 

o 

ca 
o 



s 



3 " b 



§ 



g JO' 



■ii^sa^"*^!!! 






< •< S tt 



Jill 



5 

a 

s 
g 

o 



£• « fc t & 6 



9 2 d 9 d 

J3 ^ ^ J3 J3 ^ 
>, ^ >k >t >t >t 

OO0O6O 

M J^ M M M M 

t« h la b b M 

000000 

» H » ft > ^ 

o « « o o • 



Ss « d b' S3 S' « 



lllliiiiiiiiiiili 




^iiiiiili- 

QOdoooaooocoooooQ 




S I s 

000 

•4 •€ -s 

A O. O. 

•5 jS "5 






9 









00 to 00 

^N pH f-« 

O) o> o 

^4 ^4 1-« 

• • • 

«0 O (O 



a 
«s 



a 



^ 00 
^4 v4 9114 

o» O) a» 

^H ^4 ^4 

• • • 

>o ^ <e 






08 



H S O 



O 



fs 






e 
c 

e 
•n 



9 



>> 9 ♦* 
3 Q- 2 



72 



Rkpokt of State Civil Service Cujimissiox 



o 

T 

H 
Pi 

P 
O 



i 



a 
o 



e 

o 
O 






C o Qi 

P 2 g 

d i 



O M 






5 

cS 

Q 



|8 



Is 

c C 






2: 

o 



CO 

o 



8888 



•* CO «H ^ 



00 t* o ■««• 

•^ *i4 wH «-4 

o o o o 



CI -^ ^ o 

3 3 C« *2 

-^ »^ •-» ^ 



00 r* »-• ^ 

^^ »>^ ^^ r^ 
O O Ot Ct 






9t at 



^ >* >* ^ 

3 3 3 "^ 
•-5 "^ ♦-» ^ 



>^ 



> 
< 



1% 






1 



a 



e 

3 
V 

a 






V 7 






«o ►r -f c« 

«9 ^ 9< to 



-2 



I 






^ o « a 



8 

o 



1*;: 

•c *« 



Iff 






•o a 

O O 



•s-a 

a 

V V 

<3a 



S8383S8S883383833833 

|8888§8888|3| 



•"* • S 2 •"" a S -^ -^ S --' S 2 8 '^" 8 -^^ -"* '^" 2' 

llalllsllalsssllllll 



^ «o r* oo ^ ^ « 

^ ^ »^ © -J gj ^ 

» Ok Ok 9k 9 « Ok 



i-4«ocoaot^eeoia9 
SOkOkCkOkOkOkOkak 



4 1 £ *; ^ o 1 :3 £ s £ s 



lllllll 




a 

K 

3 






OD S M ^ 2 S »H 



g * flQ J 




nil 

* . h; ►-! S 





J< JM J< 

kl l« k 

u o c 

111 

115 

fr fi. A 



O. 



li 






3 ^ a .« jj ? e 5 -e o ^ 




Classified Civil List — Statb Depastmests 



73 



K >» X >> K >> 



5 5 « J '« «8 Jl el 
^ "O "C "O "O "w t3 



'^'*8S8S8SS8S8888S88SSSS8SSS8bS8§SS38S8 



»»^Ortir»coioccr*ao-^-*c« 






J52 



M) ^ «i4 ^H O >0 



w 






to 00 00 r^ CO 

•i« »^ C* t-" 



r^ •« o *« ^ lO 



2 1^ I a o 4 (^ S I o ^'^ 2 < :S S :2 (5 5 ^ ^e5 Q ^ •? * 2 z o Q :^ -< (2 2: Q ^ 






~ V * » « 

2 •^ •^ v4 f^ 






o ?0 






<S 1^ -^ O -4 <-• 









£ZQ*:? 




^S oi 00 cc 



• 



JjQdedeaoecaecSecSeeSeeeeBa 

C ^9 *** *3 ••* '^ *•* *3 *** *** '^ *!S '^ *S *"^ *^ *^ *3 *^ *** *S *23 *SJ *^* *S *JI *!3 



6 S 



E = 




<^llHHHHb3;s3B4UHSqBCHHNHHHHBaHB9HHN 




e e 

s'i 



Of « 

d c 



s 



c 

E 
« 



»HU^\A\A\A\iX 




(4 



Keport of State Civil Skhvice Commissiox 



I 



i 



Q 





a 






o 






•5 






i 






g. 






S 






o 






O 








a 




S 


o 


•s 


•S 


•? 


s 


8 


0. 


m 
Q 


a 


a 

i 




» 


a 




5 


8 


o 




> 


5 

s 


i 

e 


u 

S 




«• 


> 




a 


S 




o 




S 




4A 


c 


•m 


a 


£ 


o 


t) 


1 


«> 


6 


g 


•** 




i 


••* 


1 


JS 




« 




2 

O 



CO 

O 

P4 



jS Ji jS Ji «« eSCtf «3««^ tf0 IS 

o.o.c.afi.ao.aD.ao.o.o.ao.a 

88888888888S88S8 

j-^ -^^^ ^^ ^ ^^^.^ 

5 S a -^ 8 2 S S -^ S -- »- -^ 2 8 " 



Vii4 


g r* 


^ 


«p 


o 


oo 


Vi^ 


^ 00 


00 


r* 


« 


•* 


CI 


U9 


^N 




«M 


^i 


V4 


^i^ 


»ii* 


O '^ 


8 

^*4 


t-4 


^i« 


*H 


p*4 


Ok 


a» 


8 c» 


o» 


2 






o 


2» c» 


v4 






O: 


bC 


* 


• • 


* 


* 

CO 


• 


C4 




c5S 


• 




* 


• 

OO 


8 


• 


• 

3 


Aug. 
Oct. 


• 

< 


a 
4 


• 

> 
o 


4.4 


C 

0. 

-< 


Nov. 
Sept. 


a 

a 






• 

> 
o 




• 

t 

o 




I 



75 O ^ ^ < . 

'3 d -c ^ a 2; ^ S5 *^ c 



9 
JS 






t b & I s t 

(3 B S a e 

a s fi § g E 

SI 3 1 s s 




.9 
6 

a 



a a 
E 

M M 



8 



S 



S 






8 






O 

i 

a 

I 

a 

3 






O 

2 



1 



HHHUHH»HUHHUHE£UU 



d 

1 
a 

-a 

a 

I 

o 
O 



eo ^ X t^ » 

^i« »i« jjj "^ "^ 

o> o <^ c. o 

^« Vi^ '^ V.4 «« 

« trT w ^ « 

I 8 ^ c^ 

i-» G < Z •^ 

CO ^ OC t« X 

f.^ Vi^ ^^ a^ ^4 

Ok Ok Ck C) o> 



2^ U3 CO ^ S 

i si ^^ 



g 

H ^ 

>< ■> 

O Q 

2 I 

o 



o 

•a 



« CQ 4^ ;a 

Q^ si 
® W T S 
•* 3 r* 



k: 

3 

cJ 

> 

C 

Q 

E 



£ 






CO '^ "^ ^4 



1 

-• E 



f s 



®. w J s ^ 

« > 3 ^ IB 

*• >» ^ 2 — 

fe c -r i '- 

8 a ^- 5 ^ 

oS C ^ c 



jS .A JS ja X 

g§:M 



Classified Civil List — State Departments 



75 



8 



3 



888888888S88880 
08° 

S CO w 



88 



000 

9 o 00 



i 



J8 

U3 



?: 



o 



C 










5 

< 



> 




fc 

■ 

N 

H 



2 

a 

E 






CtO>CiO>ObOkO>OkOk90}OOkO>Cb 
N ^ M 



>>>>>» 






^01 ^ C« C4 

• • • • • 



s 

o - 

I 



> 
o p 



3 






e a 

5 o 

- ■•» 

«i 00 

00 c 

•<: ^ 

^ 1-4 ^ ^ <0 



e 



o J 

*5 3 55 • 
^ - r ► 

IS § a 'g J» 

* 1^ 



o 
2 



i| 



a 



CO 

1^ 



1^ o ? 






8S . 



o 



GO 

•5 



s;;8S(C 



•h 

o 9 » S3 8 ^ 






s' 



o 



« ^ S^ S3 

§ « C 4> " h 
#& < H» U H» •< ;« 






O -g cu S ^- • 
2^ ^.j S •< 



a 
o 

e 



e 






dS bH 






c 



J 3 

•2 a 



^ g 

. " a 

c s 

c> a. 

e c 

« «» 



«M JS 



o 

o 



.a X 









3. 



000 

SEE 
00c 

S K S 



« o 
o o 



« 

s 

c 



21 



c 

Ml 



221 



(D (C CD 90 

o r* c ^ 

Ok O O 9> 



« cc ^^ -^ 

N M (N 

c( cS c S 



• O O 0» Ci 

• p-« .H ^« •-• 

'C w w w "^ 
(g e< M c« 

9 ds >t >i • 
• « c9 eS B 



> 

s 

OQ 

a 

b 
S 



% 
p 



hs:§s^ 


:ud6 ^ 


d>*>i>J : 





W 00 OQ 5 



•§ I 5 5 -^ 

S g § g 

c a kJ .J "^ 

= S e^ M »*l 

>-J « 10 '<«' Z 




•o ,S JB B 
O S < U 



a 
.a 
o 



O 




66666 



re « 



s-^ 






•• 

s 



> 3 



•J 






5 5 



or ^ 

• • 



1"^ 

r « 

O «-4 
— t* 



as 

« • 



I s 



T6 



RxFOBX OF State Civil Service Commission 



a 

o 

■a 

a 
s. 

6 

o 
O 




- 2 - 



I - 

•3 •. & 
M « a. 



a 

fit 

2: 



888 



M M N 



818 

§■* = 



•a 



r» r* t>. 

o o ^ 
o c» o> 



r* t* o 



^^q 



MS 9 3» 

O 9 S 



9 as 



s x 



a 7 



h» r* r* 

o o -^ 
Oi a o> 



► r« CO 

v« <-4 r^ 

9 :9 S 

*» "^ »^ 






g 



•O <0 at 
9 9 



3 C a 

S << 



• 

OQ 



• 



5-1 

^ •'3 a 

»— »-j "^ 



•T3 ?3 



> 

hOeS 

s la & 



o 



O 



d 



4* « 



<.^ ^^ v^ 

mt tm u 

C «. 4) 

e c c 
e o o 

J.S 

«« ^* «« 

e c e 
C £ 6 

S66 






-J 



§ 



lb ?. 

c c 

3 S 

c o 



t 1 >? ^ 

.2333 

bc 3 a s, 



88888888888S888 

•^ O '^ o o c 

2 a 2 5 S S 

©• W ** €▼ © u! 






e^ 



o«Ok.'2aoic^oe^«««o^or«o 

0)00)AO^O)OOo®90k90kOk 

^wV«oo*H»-rir>^©'oo»Hisreo 
•^ M ?i ?j 1-1 ?* -^ ei 



•fe *i ^.b 



X > 






00090>00>00k0000>0>0 



•r M 



M W 



f! v! o .^ 



► >» > 







:^ T c •" *• 



c 5 

c w 
4' C 



u 



> 









»C0 






^ & b b ^ 
x: J3 ^ U3 X 

o o c 



I 

-^ ^ » Bi a ft a 

c a es a g 
oc S ao oS fi 



00 00 



Classified Civil List — State Dxpabtherts 



77 



8S888SS888 
S8g§|SS|8| 



888S8S8888S888 



9Q S 



o 



i§ i i i 



«^ CO M ^4 Pi4 ^4 ^4 



^<^«^e4-4^C)ri^«H 



^ 



8cilN8SSSS 






« 00 • t-i .H 



•^ p^ "H ao "H 



M 




° <3k g a ^ a 

-> X 2 X O OD 



— S?^ «»• 



00 






•^ •-» 



■^ ^m ^^ ^^ ^m 

a a a a o 

QQ 00 (n 00 IQ 



a o 
- a 



QO«r^M^o«»or«'« 






. 00 a f^ »C 09 « 



00 -4 *4 

^ ee 



g« a 00 00 to "^ «o 

«« M •i^ Oi M -4 



*M ;o ^N *^ 



S5n8Sf2 






'^ii^4 




i 



a 

1|» 






|0|£ 



« 

a 

a 
< 



I 

o 
l» 

^ f S 



8 






■» U, v^ i-» »■» 



I-, c^ « 

til 

III 

•-> "^ < 



3 

> 




s |! b « « 
«< s S ^e ^ 




S> •> M k« 

tin 



• V 



•* "n »» "-» 




SI 



•S -S -1 -9 -s .g 

if Ini 




O ^ U H »« M M 

(« U H M H« W 



•« 1^ •» 

a o» ea 



»^ 1^ •» r^ lo 

•^ •- »H « ^ 

A Oi 0> O C> 



a«c:««si52'« 







: : 5 






Sn S 

X » ^ 

»^ eS oS 



oo 


a| 


• 


r * 










f-4 »4 


oq'oo 


0« 


II 


§-3 


1 


^ -^ 


«• 


ss 


ss 


S 



JS 



m 



e 

;s a 
^4 



t 



c 
d 



e 









:S5 

II 

11 



<<<WiO 









g.-3 I I e o o o "B 

tt X •m •»• fi e 

* r C C i 

o ^ .2 § 

V - - " w w 

oa W W W VkW 





78 



Report of State Civil Seuvice Commission 



a 
o 
.3 



6 

6 



« S i; 

a fi 

a 

^ 8 

|i| 






i 






S 
2 



o 



CO 

O 



>» >» ^ 

•5 "S -o 

sss 

c5 w CO 



r« «o lO 

V4 ^H V4 

0> 0> Ob 

^N ^H «ii4 

m • • 

^ r^ 00 

^ tf « 

t« <0 lO 

V4 1-4 i-^ 

Oft Ok O) 

^H ^H <M 

m • * 

•* r^ CO 



^ 




3? 


&ff 


a 


s? 




•a -5 






s ^ 


S ^ 


S 


S Z 


a E 


a & 


s 


e s 




•n -S 'S 'B 

I £ S S 
o2oooooooooo 

0000k0i0k0)0>90k0k0k0 

• • • • • ■ * ■* _ • • » * m 

cl^^^r«•Hr^QOoo^to<oo 



s 



C is > *• ► J5 "C 



|a ^ X ^ 
S a Si a 



Z 



» CD 

■ o 

H 

CD H 



■a 

IS 

Q W 



00 

6t, to 



i^ I J^ ^ J 



<: 2^: 04 S m 



oo 

3 



I 






^ 
o 










^^31 




^ ^ -i S fi ff J S w c3 5 > 




isii 







c. 

CD 

O 



a 



^1 1 



5 



QQ 



O S 

s 

H 



i 

o 






si 




Classified Civil List — State Departments 



78 



§8 
88 



88888888888888888888388888888888 



^ 



CO »« 



s 

o 



o 
o 



«0 C9 



CO CO 50 CO C* CO 



o 



s 



Q Q -* 
S 00 00 



§88 

« r* « 



3 
3 



o ^ 
a a» 



|^r^t^XK00«OO<DC4 

OaOOC>OOOCbO«0 



OO^COCOiOt«>A003000XOOOOaOU3iO 



ft o 






oe oo 



r^9r^«ocoi^a»c«oe4 

OOQAOOOOOOOOOOi 



• O 

e c 

3 d 



aoooo^coO'^t^>ooo»«»« xooaotocie) 

SO^^'-*«^^^'^*^*^»h«^-^«m30»H'^*^"^QO 



U3 



& 



Q tfi ft w^ r-4 I ^4|Pi^^4 



^*i 



^ tv f4 90 



2®i:sgg 



OC w^ w^ w^ f^ r^ 



CO lO O ^H ^H 1-4 









a 
« r 

r *** 
00 " 

i 8 

(. ce o 

s — 

•l 
a 
c 




8 



■ 





1 


• 

QQ 


as 


c 
5 




1 


• mm 


<S 






•o 


o 


r* 


-4 




3 






•51=9 



fa 
.- £ 

I » 

s-S-g ^ _ 

•S "5 -S § -2 



.3 

o 



S f3 

o o 



o 's 



.3 .3 .2 S 5 
> > > 5 .S 

^ ^ ^ 2 "3 



a 

I- 

O u 

••3 



8'ca 'dacaa 

^ :? - =" - c -n -5 C jl 

OQ(B»nSda}%aocn 



« "S -fi -^ -o 
S o. a o. o. 

I III 

€ o a e a 



ao.o.ao.ao.c.aQiaaa 

& 1 1 & § m 1 1 1 II 

ooooooooooooo 
qocaaqaaaa-^" 

aQeaOQaQQQaQQQCQOQSO 



s a a 

c o « 

.«« .<J ^ 

CQ OQ X 



.a .a .a .a 2 

>k >> >k >i 13 

a a a a. ^ 

8 8 8 8 I 

b fc« k) u ^ 

c 0) a> Cf 4< 
4i4 *4 «j ^ e< 

• •4 BW^ '^ -v^ JS 

II I III I 



80 



Hepobt of State Civil Sebvicb Comscissioh 



•J 

i 

s. 

a 



c 

q5 - 

d 






g-s 8 

^ c s 

■SI 



1 



-& 



o 



CO 

o 



8888888S888S888888S88S8888 

§$SS88888Sii§IS§^S§S§§§i§§ 



c« 



51 



9 rr 



•«» « 



IIIIIIIIIIIIIIIIISllll<'^ 






^^^^<O^*^♦^O>'-••-'^*^^00«O »^0 










I3|i|5ll5ill5alll 



E 

s 



c 
a 




Classified Civil List — State Departments 



81 



SSSS8S 



to o 



888 



•o ^ ^ 



888888S8S8888S8883888 
8888888 



CO 



C4 ?l 1^ O A 



O O 2 N 

~ cb 00 r* 






^NC4ne«e>ie<ic«i-«t-i ^^^^.^ 



X 


^ t* 


X 


oc 


00 


wm 


*• 


*N 


«M 


«itf 


«M 


V* 


e 


et 


e 


et 


c» 


"• 


«« 


^« 


»* 


VM 


1-* 


•^ 


• 


AA 


e 


^^ 


•i^ 


M 




M 








> 


j^ 


>» 


*! 




w 


:?.i 


3 


^ 


l£ 


< 


oc 


♦ t- ao 


00 


X 


*4 


•ii* 


*N 


mm 


■■rt 


PM 


o 


94 


C 






CS 


to 


• 


p» 


c 


^* 


* 


N 




N 


wm 






Nov 
Feb. 


3 

-J 


Feb. 

Sopt. 

Aug. 






•< iO w 2 



>t eg 

< J 

. 93 



a a 






S"2 

" c 



e S e 

r ■ 5 C ^ 

*■ 5 o c 9 * 



K 
C 
« 



nil 



*^ •-• r^ 
o » oi 



U3 ^ ^ 

fa b. Ik 



r^ le le 

^4 v^ *H 

O Ok » 



•c -fi >£ 



^taioooaoaox^^e<eo*o«or^r*oo 

OftOi9kObOCtOkOlO>Ci9C>0>0000 



•H^^^«0«©i-<»^ 






I 



^ jO 



&» ►^ »n 



M 
3 
< 



|9& 

oB *< -< 






9 C o _tt> 






fa OfaS < dS»^ 



^Qr««o-r$toooootox«-4^e<co>ototO(»oo 

OD9'^db09S>ObO)OOkOftO)OOCbOOO>00 

44fa-<-5'<'?fao<oSS-<f2;ote*<<S»? 



> I CO 

<^ to 







e 

a 
o 

E 

E 

o 





u t-> u 

V b & 

-c •<: '^ 

A a a 



u u h 

c- & 1 
J3 J3 JB 

a Ci c 



u^gag 



o o o 

a a a 

s ^ :i 

OQ OQ OQ 



6 O O 

c a a 

S t t 

QQ QQ CO 



82 



Report of State Civil Service Commission 



T 

o 

CO 

m 

a 

o 

I 



s 

o 

o 



eS 



s-s 



5 •>* 



c 



|8 

•« .5 T* 

*, o b 






(8 



o 



o 

p4 



S88888S88S8888S8 

SSSw^xao8oS?i5SSSn 



4^eee94eS««ee3 

S. & S. a !L S. ^ ^ ^ 
888888888 



Qr)io^aOi-«Xfo^t«QO»ao^XXiQ 






IJ£ 


•*- 


4- 


•o 


4- 






-♦- 


« « 


lo 


lO 


»« 


la 


lO 


•o 


X 


f-t ^^ 


Vi^ 


»^ 


^< 


«i4 


»« 


^^ 


pl^ 


o o 


o 


CJ 


c» 


C» 


o 


o 


o 


»H ^^ 


*H 


f-4 


VH 


^^ 


^H 


^^ 


•i^ 


• » 




-* 


^^ 


^4 


^4 


IM 




iS 


d 


• 

Si 


** 


• 




• 


• 

e 


c 


4S 


«8 
•-> 


s 


O 


4 


s8 

•-> 




►-9 




Classified Civil List — State Departments 



83 



SS88888S8S8888S838S888S8S3 

•C «5 40 »0 O »0 •«» »0 O us •'5 i"? lO »C O '"^ lA •** »0 »0 K3 O lO O 'O •O 
♦-♦-.^^ ^•♦-^•■♦-■♦-■♦-■♦-♦-♦-■♦-♦-♦-♦-♦-♦-■♦-■♦-■♦-■♦-"♦-■♦-•♦- 



o 
o 

o 
n 

o 



o 2 
o o 



CO (O to 





•ft 


0) 0) 


v4 


s 


•ft 

o» 

v4 


•ft 

v4 


•ft 

v4 


•ft o 


v4 


•ft t* o 

«< >H v^ 

<3» O 0> 
•H 1^ »< 


CO 


00 Ift CO 

"H wH ^^ 

o a» o> 

^H ^4 ^4 


a 2 2 '^" -^^ '^* '^' -^ 




r- 




^^ 


^ 


v4 


v4 


!'I3 


• 


v4 «H *H 


» 


9^ r^ ^ 
IN 


«» CJ »■ ^ ^ .^ ^ o 


s 

•-> 


•** 

Q. G 
00 •-> 


• 

5 


* 

a 


o 

e 

3 


a 

•-> 


• 

e 

et 
•-» 


^1 


• 

a 


^ «S «i 

s55 


jO 


X «J >» 

ft o "a 


OCCiCSOOOSO 




v4 v4 


*r3 
2 


oc 




ift 


•ft 


Ift (ft 

^4 «H 


o 


•ft 1^ i-S 

•-^ o^ «< 

0> O) O) 

«H ^H w< 


o 
a* 


» »ft o 

t^ r^ w^ 

Oi Oi Oi 

*H «H «< 


C« i-* 3C ^ «-«" ^ -^ ^ 

C* — ^ 


• 


r- 


• 


- 


• 

v4 


w^ 


wi 


* * 
1 ^ 


* 


^ .-« -^ 


• 


• • • 

"N ^ ^ 


Juno 
Oct. 

Jan. 

Jan. 

Nov. 

Jan. 

Oct. 


d 


a a 


• 

<5 


• 


c 

3 


m 

a 

OS 

•-» 


d 

eg 
•-» 


C 6 


d 

•-» 


b ♦* *j jo '5 ♦* ^ 

S O O 6m < o ►? 




Ift 
a* 



c 
•1 



en 






!<« 00 ift 

»^ »< »M 

O 0> Ok 



eS a 
^« •-» •-» 



r^ 00 •ft 

•^ w< »M 
O C> Ok 



•fl e o 

l< H, H, 




? 

•J 

o 



H 



r 8 

a r 

JO ^ 00 
b4 



rt 
o 

c 

c 
& 

30 



2 



5 

•a 






s s 

.2cS J 

- 1 

•rJ jij BQ 

eS u 4 



1 

6 



>> 

O 

a 



■«j «> «* 

3 9 3 

a a a 

&&& 



M 



Report of State Civil Sekvice Cosimission 



"8 

o 



o 

0$ 



o 



a 
o 
'3 



E 

o 

O 



c 



fill 



SSS8 SS 



c w. e 

« o « 

12 » S 
t B^ 

— "^ 2 
et t: a 



6 



o 



O 



S 



S8 



CO 



8888 88 8 



« M ra C9 



?0 ^ 



§•5 "S "o "o "o •S •«• 
»• fc* k M k h bi 

^8888888 
2222222. 



t^ (O lO lO 

»^ p^ *H v4 

0> 0> Ck o> 






CI 



CI 

§ o 

»32 



•oooooo 0000 X oo»o»ow>oo-actot« 



'^ CO « •-• 



♦5 •n O •-» 



CI 



a 
4 



CI CI 



M <^ M M 00 <0 






Ills g ssi 



ao*A*otoxaoto»'» 




Classified Civil List — State Depabtments 



85 



llllllllll 8 8S88888888g8888888888S888 
mM9<l^^§§ii§§S§§§i§8S888S3^88S8SS 

o2oo2oo^oo 



222222222S5^®o***o»»a»»o»a»aaa»Ci»oc>»oooeJC»oo» 



1-H O »« O Q Q 

^ CI c^ 55 c« 



32-2 222222235®o»afco»oa»oa>o»3socjocsc»ooc»c>c»©o»o> 




Mil 

5*2 ■ 



^31 



ados' S^ 3 

^ Cs, O C 



0) 



O 

«1 



d!4^3 






U d O 

S « -3 
^ a 5 





E a a 8 g 

i A a s { 
« • «» < 




N H H 

illllllll^lll 




3»f »< K M 
5 355 



S t> .4) .«« .41 b .1* 



11111 
5 8 8 8 2 

■3 ■»» -p* ■S ■S 



a 

« « 

is 

.4* .V 




JM ^ J« ^ 

^ s § § 



3d 5 S O 
■tj ■^ ■** -tJ -ta 

OQ OQ 3Q 00 30 3Q 



9 ^ 


$ t 


II 


& 


S £ 




S 9 


s a 




.5.3 


• ■M 


s s 


S S 


§ s 


s 


c c 


*« 
«• 


9 9 S Si 


S 3 S a 3 


3 


4t O 


« 4) 


O 4> 


4< 


4> 4> 


5* 


13 


K M 


M M 


H 


M H 


M 


5555 




55 


4-1 


k* k 


h k 


k k 


k 


U 1^ 


k 


4i 4( 


3) O 


4> S. 


C 


:« ;^ 




11 


11 


11 


a 


•m IM (M 

S 3 S 


S5 


S S 


S 2 


3] 


2 i2 


2 


'•i* «< 


■«-• -tJ 


<-• 


■** «< 


w 


^ M 


J« ^ 


J4 M 


•:< 


M M 


M 


o o 


II 


O b 


V 


U O 


o 


2 2 

CG OS 


3 3 



X 


2 2 2 

CfJ 9Q 31 



"S >» >» >» 

3 a c q 

C 3 3 9 

b O O Q 

. U U O 




86 



Report ok State Civil Servick Commission 





o 

1 

8. 
B 



"^1 



a 
o o 



1 



5 I? 



g-s 



8 - 

o ^ a 

£|.2 



S 



o 



00 

2 



88S88S88S8888S8888§88888SB 



5 



rS 

o 



p. d e« w « »- o« 



ioo»oxxufdioxiou3io»oi/>ioxior«>Oi/)*oioiookox r) 



tCXMXX-«CDU3^0)0)^0 



<«• o a» CI 



ss-^ 



04 t* -» 






§a03scc3^0daeddhqfliad«sae-oa^-. 










J J .8 J .S J 

6CSI52 ^ 

aaaaaaaaa 

3MMKMMMMMHM 

Im hi b t« h 

«< a< C/ j» G> 

••■ «»• *Ka «»■ •*« 

S s s s « 

fi 2 g e 2 





M M M M M 

k t« h M t4 

^ ^ ^ *» ^ 

«». «M Wa «M *M 

S S 9 S 

2 8 2 2 

H h H hH 



Classified Civil List — State Departments 



87 



S»8S888888 
•g rt « « rt «-» 



888888 



S8S 



8 






»^ N piii ^ N M 



888 8 



CO ^ ^ 






"8 



W 



h O 

83 



88iSS 



S 



-^ 
o 

n 



^ CI « eo eo 



Jan. 12. 1010 
Jan. 15. lOlA 
£>eo. 1. 1900 
July 1. 1011 
Jan. 10. 1015 
Aug. 16. 1017 
Feb. 1. 1015 
Feb. 1. 1018 
Feb. 12. 1017 
Nov. 11. 1018 


July 1. 1017 
Aug. 16. 1018 
Jan. 16. 1017 
April 1.1015 
Aug. 16. 1017 
Sept. 11, 1017 


«oiOQ»Nier*ioooN.oo 
09akooao)a>0)aaai 


r* 00 r* o »o r* 

^« ^H »H w< »M ^H 

O 9 Oft O 0) O 

v^ ^4 v4 ^.4 ^^ v4 


Jan. 12 
Jan. 15 
Dm. 1, 
July 1. 
Jan. 10, 
Aug. 16. 
Feb. 1, 
Feb. 1. 
Feb. 12. 
Nov. 11. 


July 1. 
Aug. 16. 
Jan. 16, 
April 1, 
July 26. 
Sept. 11, 




JfflO*^ < fa - 




I 



U 5 -5 .^ « 3 *i 



^ M . S o 




a 
& 

u 

o 
S 

c 

S 



1 « 



II 



I 

X 







•-• CI 00 

f-l «H -14 

O Oft o 

^■* w^ tm 

•-< C» I-* 






Oft o 

wi CO 
CI 



00 lO 
Cft Oft 

»<5 ^ 



^4 



o >o -i o 

-^ »M ^« p 
Oft Oft Oft ^ 



Oft 



•^ r* »H o o 



A A s: a 



S Oft C) 



Oft 



00 lo o cc t* ?5 ^ 

*H ^4 r^ ^i^ o Q *^ 
Oft Oft Oft Oft 0> O Oft 



QQ GQ 




II. 



O C4 



.C a 3 B m 

1 a - a I 



88 



Report of State Civil Service Commission 



8 



0$ 
O 



o 
o 



S 

a 

E 



5 -J 



•5-3 



r? * a 



s 



|8 

° E 

a -g 
® 



S ^ 

a «»4 a 



I 



2; 

o 

H 

o 



o 
o 



O O 

^ eo 



8 SS8S3S8SS838SSSSS9SSS3S 



cr eo 



SB 

a s 

O 3 

o 






8 X. 






O O 

g8 



^^^ioeo»^«-<e*«e««»-«c>it«<^»H^^e«co«t«<Cf 



•H lA 

o o 

1-1 w-K 








July 
June 




o r* 


t*«r*^coQoQ^>or*5p^099««ii-H«^r* 

OO00OOOQ9«h-<QQ<->'^O^^^CDOQ99 
0000090990p00999990999099a(>aD 








Mar. 
Jan. 






(D 

> 

el 

o 



M & Si ^ 

S 8 S I 
000 fa 



2:u:^ 



GO 



o 

u 

d 

a 




c3 



3 C tf 
es 9 2 

rt rt !r 



j< .M a *^ •ts 



n i» w .^ »• »« M 
s « o 2 V V S 
§ -3 75 8 o 75 *•, 

^ «M tM ^ *M «M «*r 

4/ » a* 

*«4 .^ •«« 

00 s 



*Z O 4> S 4/ 

S '2 't: .^ '2 

^ ^4 ■<■« 

C w U 




3 

3 

> 






o 
a 

S 

01 



a; 

a 




3 

4) 



a <3 



s 



a 

O O 4) 

o « o n3 "^ 

a > > > 

4 ^^ ^ -^ 

5 1 1 5 



H *< 2 cS Q J 




CI.A8SIFIKO Civil. List — State Detartuents 



8» 



OOOOOOOOOtf •• « cS el «1^^ d ^Ji^^^^MJiJiiji oSOOOOO 

^^^^^^^^ ,-. ^'Ot3'0*0'J'0*o'0*^*0't3'07J*q^*T3*0^'0^'0,-t — — — Q 



828 

o to ao 






e« M M e« 



<-4'Maac9oo<-'ooooe<oco>^o>'M'N^^aooo»w 



caeoSo»oo»oc3»So»oftOftoo»ooooo»ooo»e»ooo:aaoSaiafta)099 



3 



« <»• 



vS5a5|||^ 






o o 



.< o 






ii:j^:&zAQA^:^A^^6<^^6u:^^^oz^^'^^ 



3 5 ;£> » .3 



^i- 



(Oa6o:OOk©OOOKOkOkO)0©©0»0)©0^0©Ok00990>09 



o S 



sSaft* a;? §5";?»S«5»2 a S 53*2 333«Oi3 Sjs^-s §^S^;?? §3 S 




I 



e 



62 



N %! 



I 








3 5 3 5 

d c3 a e 

3 3 9 3 

8 S § 8 

S S S S 



3 3 3 3 3 3 3 

q c a e g e ^ 

3 3 9 3d 

o o 5 o 

u o O o 

s § s s^ 




*< -P* -P^ ••• 90^ •« ••• 

u 5 o o u o o 

a S S a a a 2 

9 9 9 3 9 9 



8 "3 Z -8 

3 3 3 

9 9 9 

e 6 S 6 



s a a s a s a 



>»« CV^ 4^ 

o o o 

>«rt c*^ •«« 

ads 

9 9 9 

a a 2 



S S S S 5 

d d d d d 

9 3 9 9 9 

9 Q 9 o 5 

S S o o o 

c Q o u o 

es 8 « « « 

3 3 'a 3 3 

Q. Cb a a & 

•r* •"* "S! •?? 'It 

b c C o 6 

a d d d d 

9 9 9 9 9 

a a a a a 



oooooooooooooooo 



• i ^ 

d d d 



t: *t: » V « 9 

O O .S J J J3 

h k. ^ c. a a. 

V £ 99 « fl « 

d d t; 

g g o o 



& S3 I & 

d d a d 

3 § 3 a a g a 

M 9 3 9 M M M 




*a ai A 

M a &0 

o o o 



90 



Bepokt of State Civil Seevice Commission 



I 

••• 

8 



:^ 

o 

H 

o 

o 




I'll 

g-8 



i - 

1.9 9 

jl: -3 •§ 



I 



o 



8S8S88888S8S8SS88S88S888 

^sc ^0% 23^ tf3^ j^^ ^^^ ^'^ ^^^ ^'^^ ^^^ ^^^ ^Ak /^Pw #vk fv^ ^^P^ fe7^ ^7^ a7^ ^^m ^^^ ^^^ ^^m ^^h 



»H e« ^ ^ « «o 

»i^ ^H f-^ ^^ w< "-^ 
9 Ok Oft o> o o 



0>0>0>0>0900}0900090t 



io^4rHr^i^t«>t-««Hioafti'3«-* 



3 






lO W M « «^ 

e« ^ N •-• 






t« 00 i-i lo 00 



§3 



e 



i^ •fi •^ *0m •mm 
> C »4 h< »« 

o a a o. Cb 






fl a 









O 



s 



'T w CO '^t 

^H ^^ *^ i-« 

o o> o> o 



O 9 O ^ 
^^ O »^ "^ 

Oi ot o o 



CO M »H 

w S o 



r* oc o 

O »H »^ 
0)0^ 



00 <D 

88 



lO «H «H f-4 



f-l tp O ^4 ^4 
^>4 M •^ «-4 



1 



lllls^ 









^ ^ -< < S 



MM M MM M <-4 



a. « ^ 

« ® o 



3 3 



llll 



O 



60 



5 h> CO o r- 

« M ^ 1-1 M 

^ i-i l6 M M 



O 

> 
a 

es 

•§ 

O 
CO 



O 

a si 

2 • 

••9 

CQ 

a i-» 

8S 

eo »H 



R : : 
s : u 

^ ■< M 

•»» ^ '^ 

r* TO rH 

»H ^ <* 



00 

55 Si 

*•• r 

M 00 

3 I 

M M 

10 Q 



S _ 

§-< 
if 



to o 






a 



to 



9 
> 
< 



si 

CO 



lis 






> 

3 o 

•H M 

00 M 






<S ^ a QQ 

oau| 

1^ r^ ■^ * 




» O « G 

u3 u3 X ua 
a a o. a 

18 et « 

^&& 

000 

III 

00 QQ QQ 00 



U U ha tm %m 

O « 0> V o 

js ja M ja M 
a a a A a 

00000 

5 S «> o 
«j «« ^ ^ «> 

00 OQ QQ QQ QQ 



O O 0) 

^ M ^ 

a a A 
es «a «s 

hi C ^ 

M M U 

000 
a a a 

QQ OQ OQ 



Ul.UkiUkit«bi 

acaaaaac. 

cooooooo 
cccqcsaac 

0QaQOCaQ0QOQaQ& 




Classified Civil List — State Depabtments 



91 



88§888S8S88S88888§8SS8S8888S38888S88 

M cl cl M e« •-• 



■* n n 



est o S 
o o o 



o 



»»• r* i> 



8 



o ^ 

^ CO 



88 

CI »-4 



i->i-tMC4C«e>iMoe4e4c«e>ie«<Mcicie>iMc« 






r<«oo«HOGoaoAr« 






»H»HC|i-«^^»H^HO»H»HC»tMtMlO-^^H»H0» 



M^^^ ^ 



a q es 



•— ' ^' C ** a^' S 5 ^ 7 .^' ai^' sm' K H •^' A M B B C3 



= •^5 



a 






RP»oftoOi-4'^ocie>itoi'0>o«o^^r<««HC4oc9(<«ao»cooor^QO«Hr«ooi/do^ 



«< a f-i ao 9 f^ 1^ 






rt O <-• 5^ 



3.0 






>.^ 



^£2SS£^^ 



:5S<<z»^<S55cgoQQ»?2:^Q6s4S;^S^ 



S E 
>»5 " 



= r^ ^ i ^ O 

J « c ^ ta ? 

««^ r ^^ 

N S » n 2 M 






£ s ^ \^ 

• • » * 






I 



t- k k 



1 



5 © 







g 



Q. 

8 

s 

It 



2 2 I 2 2-^ OiMMMJ^JUMMMM 



J4 M Ja J^ M M 

k« (m h h ~ 

GooG 




02 



RspoBT OF State Civil Skhvice Comiossioh 



a 

o 

'3 



I 

s 

o 
O 






i 



Q * 






1 

••• 
8 



O 

o 



1 1 *^ 




§ 



2 

O 

H 

o 



88S8888888888888888888888 

i§§§ii§§§§§§§§§ili§§§§i§§ 



•o«o^^^«Ph-oe««^oaoaoaoacaocD__r«aoe«ioeto 
ak9caS>Ao»aoaookOk99iababa>a»ak9<-i9C3»aiaiaiai 



be 



t« *i« ^4 ^4 fn^ 



•^•^O .•OlHV^^tM 



« o « ai o g ^ ^ 5 g| ^ « 2 oi V ^ ^ ^ §j 15 -- « 2 gj « 



c «^ 2 



s 






3 



llllli 




M 2 ^ oe S 




•'^ 00 r* p X 
^ <^ fi^ *4 r« 

1^ «^ r^ »i4 wi* 



M ao 
CO c« 




li§d>uSl4«Sox^£u£^o4^ 






Classified Civil List — State Depabtments 



93 



S88888888888888888888888SS8888SS8S8 
§§§i§III^S88S§SS8883888SS88383i 



c^^ « 8 
r* t* t>. 



ooooooe»oako»a^a^a>a»a>ooioako 









< u> 






< 3 - " ^ ^ 



3 



-•t.S 



3 « 






• *i ? 



<h; w «< y 



?^^3AOoooba»9AO>aka>ooiakoak99oiaftoakO»a>e)aic»ai90ka» 



•*^o«^ioeo «o«-« 






« o r« ^> «o o 

<N M •^ M f-< 



^ tf) pj' of 



;;••••• ....:3...; 

•••••••••••••••••• ?w • • • lC • • • vx - • • • • 




c 



>> >k 



" 5 ^ J < .• 
^ •< J > r 5 



.. C| O 00 «0 CO 

Q ^ e« a 

^ v4 ^4 ^4 



fegS' 









i 



94 



Repobt of State Civil Service Couiossion 



i 

I 

o 
O 



•Bat: 
a 3 



^8 

^ S si 

Q is s: 
S-c 



8 *• 

o ». a 
«» a 



I 



^: 



2 

o 

■■4 



8SSS88S8S8S 






S S X S S w 

* -v ■* ^ '«' CO 



00 X OC QC 

*•« *H 1-4 IX 

o» o o o 

^4 ^4 v4 ^4 


1917 
,1918 


X 


X X X o 

^-1 w^ w^ O 

o» o: o o 
tH ^^ »M ^- 


Jan. IG. 
Jan. 7, 
Aug. 1, 
Mar. 11 


July 9 
Nov. 11 


c 


July 23 
July 8 
Sept. 27 
Oct. 1 


o r* i> X 

v4 ^i^ ^4 ^4 

O O O SS 

v4 ^4 ^H *H 


1917 
1918 


X 


X X X Q 
^•i f^ *m O 
O O 7) O 
rH t-« ^4 »« 


Dec. 5, 
Sept. I 
Aug. 13, 
Mar. 11 


July 9, 
Nov. 11 


c 
s 


July 23 
July 8 
Sept. 27 
Oct. 1 




a G 
C -c X 

^ -C J3 

O « CQ 



9 



I 2S8 

« CO ^ c« 



0(00 
«-• X b- •-• 

w « N eo 



I 

eS 

I 



C 
C 

5 



g 
O 



C 

o 
S 






•iff — ** 

•c .5 ^ c 

S- ^ 

|8 si 

S o fci -< 



c 

U3 



c 



•a 



u 



3Q w (2 
^ I S 



o 



I 



o o 

c S 
a 3 



o o 

s c 

S 3 

-1 •-» 



5 

o 

c 
c 

« c a> 0) c ^ 
M bC Ss tf M .£ 

jT a a 08 rt « 
;i4 a. ::, &, fr, H 



S8 




eo ^ 



o ^ 

n X 



s 



E 

Eh 






0) 

o 

B 



is 

• mm 

X 

a 
.2 



^^ 



I 2 

3 .>< 

«8 e 






C. 
< 



o 

o 



•c 

c. 

< 



o 

1-4 

o g cS 

O 
o 



3 



&4 



& 



o 



e 
o 

i 

s 

c 

o 



Classified Civil List — State Dbtaktments 



95 



888S8 



aC N M ^ O 



S8S888S8888888888S8888SSSSS3 



8 

CI 



i 



s 



CI o 



eoci«-^«cici'-'«-<«-" 



04 CO 



«0 X «D « GO 

v« M V4 ^ fP^ 

9 



lO ^4 '^ to iC 



T "^ ^^ ^^ ^^ 

"^^l fa •-» ►^ 

<0 M) O ^ iO 

•* -• Pi* ■* w* 

o 9 o a» 0) 



2 «•• .-I ,H o 



OOiOOSo^O>C»OOO^C>^0>090)00>0>0>C)09?iSsO^ 

S « S." S^ S S« aS sS 9'ac'a sis ©cuw© *^ s-©^ 
•Or-i^ioiOA<or«r^r«r^iAaoA<Hi'40C40C4aoo>-«ciooxc< 

00OO0iOOOOOO0)0)0^^0>O0>0kO0i0^0>OA9>Si9O 

esi^^r^ ,-it^Ht-i tM ^^ c<cie<^^"-»^ 





3 



> 
« 

^ 



J 

& 



^1S^ 



O 
Z 

CO 

t3 
M 



_ s w a 

913° J 






I 



5^S 

^5S 










•-» •< «<5 •-» 



S 



»i;»nO'<»n<*-»"<«->Oi->'<»*5 



» 5 ,• ^ 3 3 « 5 








a . 
< < 



** *» ^ 50 o 






c 

j3 



i5 



ff 
^ 



s 

o 



s^j2^ 



I s-g sill J 





•2 i ** ® 3 

inn 
Ijlll 






96 



Bepoht of State Civil Service Commission 



S 

« 

T 

o 

CO 
CO 

1-4 

a 

o 

o 

CO 
ft 
O 

u 



8 

I 

I 






z 

o 

H 

O 



8S888SS88888888888S88S8S 
8S88S§8888§ 



o o r> 

o 8 S 



i-H e«e4e«c4«Hi-H.-i 






Ot Ot O Ob O Ot o o o 






•o •- «o e« 
9 >k « 



«N 90 •-• CO ^4 «M 



^ 



CI 



Ok0000900k90>0t0t(00b000k00>90t00k0k 



^ « «-! t* •-• 



*-■ « lO X O *-t 



'^' 8 8 SJ • « S "''■ 2 -^ S 8 



I SHU'S "3 "^ SI'S 9 s Ml §§S§1|| 



'I 

It 
8 



•a 




Ii2 1 



c3 



a^ 









I 



"T" C; C 









m3 



o 
'> 

2 



fc 

o 
H 

c 
o 
> 



1 

B 



CO 

S 






ii 

51 



o r 

0.00 



a d 



OQ X 

•0 

S3 

8 



S^il 



«Q 



•H 00 



^ 



90 



M 
C 

o 






S 5 § 
d 2:3 



o( CI n ei t«* s 

^ wm ^ w4 to O 



o 
O 



i 



o 






« ^ K 



g^ cr. 



6 



c 



2 -I -5 






• .»j ►h *j 



: : s 
• • ► 



t4 

a 



i 

0m 






K ^ 



d 03 d 



c 2 "o r? i i- 

5 g T3 ^ CQ . 

P^ •© iJ U ^ •^ 

fa -S < I X I 

H « S £ ^ d 

&] |J < h &4 fa 



o 
d 
a 
o 

O 

b 

H 

a 

E 

o 

M 









•- 2 

4J « 



4; 

Q. 

o 



a 

o 






C 



cxaaQtO.Q>aac.ct.s d.'SX'S 

poooooooooo'5«a-3a 
Sflddcc adcac<^.«gS 



d 

01 



i 

a a G G ddcdC'S.Seyg'C'C'u'u'cf'S 



JM .M .M Jhe ^ 






Classifixd Civil List — Stats DErAsnoirra 



97 



S888888888888S8SS888888S88 888S88888 8 

l§§§§§§§§§i§§§§§§§§§§§§§§§§i§iliiP.§ 



*4iM^«0vi4f«e«»<vN^4P4»i«f-4 



^ «> ^ t: ^ w I"-" « -h' o « ^ ^ ^ « ^" ^ ^ '^ « ^' -^" ::p cj « oJ ^ tC »o « rf o ^' ^" ^* -? 

Isii^^l^iiiiliililll;s:2«33|s|i|i^lda| 

SSSSSSSooftSSS5S8o>o»a»o>oo»oo>o>oooooo)C»SSS5SS5 



*^ ^« N 1^ ^^ 



C4 



ao o (H (i^ ^ tM 



1 5 ^ 1 2 :S s 2 « 5 II 3 1 S 4 5 1 a s ^ £ o 2 s s 4 <!;■< a a 1 4 II i2 




O O C O 

a a a 

III 

" £ s a 

o o o o 
&4 (k< fa Cm 



08 



Beport of State Civil Sebvicb Comiiission 



I 
I 

6 

o 

O 




ill 
g-8 




H 

i 

H 
CO 

O 



2; 



o 



888888818 88888888888888888 
S88888^ 

C4 CI 04 (4 04 C« 






§§§§§ 



CO 



r^ioc«ioaoioaoi<«oioooaoaoeoeoeoooeoeoeoaoaoaoeoco^/) 

090kOkO>90>OkOkOiOkO>OOkCACACACAOkOkOotOOOO) 



i>«iAc«ioooioaoi<««95<-i<D«-ikno^OQioOMeaoao«ao 

0>90kOiO>C>0>0>OAOkOOkO>CACACA90>CAOk090kC«Ot 

^5 3 s ^5 ^ .^ 3 Jg s s s I <5 Jf :§ £ II 51 ^ ^ I c 




o 






ii 



r 



>» 

& 







O 

e 

a 

a 

£ 






^^•G-C 



o o 

s a 

E S 

t 

o 



'B'S 



o o 



o _ 
6« P« 






t 

o 



o 

a 

«8 



£ 



•1 



O S .4 • • • 
^ B e fc« k b« 
» * o o o 

t£ Ills 



£ 



6a 




r 



< , 



Classified Civil List — State Depabtments 



99 



S8E8888S8888888S88888888888S8888888S 






80 o o o o 
»n ic o o 10 

rH O O •-< ^- »H 



88SS 

t-i o •— o 



" ^ '^ r^ ^4 r^ t-^ w-^ '^^ v^ w^ ^m ^^ tm* f^ Cj r-t r-t r^ O ,_4r4^4«>4r4^rHr^vH^40^^'^'^^^^^ 

cteoa»o»&cao>ooo»ooakakcBoo)oa»cio»ooocio»oa»o»oAo»ooci 



C •• M *4 






•O t-> .^ 












« r« Q "— 



CNx«i<«coxw:ciiio~4^iftC4eooocDtct^aoeo>o>otoco^r«i<«^^t^oc««ooi>« 
sc:ooe>o»octo»oOo)e:ia»akoo>oo)00o»oooc)a»c»a»c»oAO»oAO 



01 N 






c >> >» 



S<z 




V o 



w « € JS J WW 

i33||5|33 
illllii 



3U (n Cn 









^ 
3 






e da 






^ •T.SJ $^1 



o 



o 






&.-ile.a8£'a|si|2i|5|3i§ 



c ^ « e -js £ 



as 



i 



X >^ »Z3 






.9 ^ 






g 



c 

g 

(c 

o 









^'S<^ 






ia 4? "^ " d e Tj 






c 

rs 

i 



c s 3 s 9 a 

3 3 C O O 3 

9 fi (• o V c 

J >» c c c •^ 



I 










a 
/-^ ^ 3 3 

^^8 8 
S S <* * 

8 g II 
I p § «! 

1155 

b k C( «t 

C CCOO 









III 5^^ 

^ Ci c. & a a 






E 



i « < « tf «t 
occcoo 



c o 

S £ 

a a 

•2 g 
c c 

a e 

CO 



mm ^ 

E 2 

« « 

E 6 

«t « 







^-e -S^ '^'•S^S 5 



1 



8 

Q 



c 

9 

Q 



as 

8S 

s § 

2 o 

M o 
o 

9 






& 



6- 



• ^^ ^ ,,— s 



♦* ♦* 

C 3 

3 3 

8 8 



0) c 



— — »- -» ^ — ^ »- -^ ^ — X ' — X 

• 4> «» «4 «« «« 

III 188888 

90oogdgec 

fi 2 fi 



M M 1^ 



•SIM 

u H u :2 



^W^ Ni«^ ^^ ^.^ ^m^ •^tf ^^ ^^ ^ta^' ^■i' ^^ Ka,^ Ni«^ ^^ S^ St^ ^i^ 



^ k« Im 



g 2 2 : _ 

a c. a o. c. 



2 



2 . 

a a 



c 
a 



0; 



O C 



53 

3 3 
2 2 



EEaaaSEEES 

«(ec9tfaS4e}c8««t 

ocuooouuoo 



EEEEEHESEE 

oooooououu 



(u €> « a« 

E a 6 s 

e « « as 

c o o u 



^3 

2 2 

a a 

e E 
CO 




100 



Rbpobt of Statb Civil Sebvice Comaanour 



I 

i 




ill 

8 8 



•a • B 

'II 



} 



I 



2 
O 






8888888888888888888888^ 
ii§§i§i§§iSigS§88888SS| 

^^^^^^^^^^^^^^^^^^^^^^^ 
o- - «• - -■ - {; -- •• -• 00 2 •»• g" g" s •• - jj «f J; - ' 

illiillliillllllijilllj 





o _ 
- O 



i«ll|i |«|||tl|| 



I 

o 

s 







§ 
8 



3 

o 
c. 

€> 

C 



in 

a s I 

£ fa o 
^ b ^ 

||| 
g 2 £ 



■3 



. s; s; ^ >» >» >» 

';;'>^ d S a e 

§§§8^888 



U 



' IB (D 

fc^ k. '•^ *^ r^ 



8 8 



g g § t S b 
• ||S| 9 S 



1 Sila^^s 

O O ti EC S tx« tx« S 

.^ V>^ Va' V^ ^^ ^^ ^M*' v.' 



8 

i 



8 8 § § § 
§ I 8 8 8 

i e§§§ 

fc *: .2 .9 4 



® © ■* 
•si s 



N.^ >„^ >„, Nsi' Nsi' ^^ ^^ l.^ «.^ Na' S 



♦» ♦» ^ « 

•5 -S -a " ' 



^ i! ^ ^ 



A rt rt rt O 



I 



B a 



b t! ^ 

55 5 

o c> u 

22222282 

V V « tt S V 

B S I S 6 
« 8 3 3 « 

O O O O O 



o q o Q 

■4* ^ *J ^ 



5 



M u 



2 






o o o o o 

U ki b k k 

a a Ci a a 



Q o o Q 

o o V V * 

c V o ij I 

2 2 2 2 1 

o. a Ch a I 




isiSEgsa 
ac9atf«i«t3tf 

ocooc3ooc 



CuLMimD Civn. List — Statb DBPAsncram 



101 



88g8888S88§88S88888SS888888S888S8888 



8|8|SSgS888g 



o 



o c o o 
lo SS yd o 



•-^ o o es o o 



S 8 8 c e r> 

»-« O !-• 



w o o r^ 



o o 



888 

i-i o •^ 






<^ N M le ^ «D 

1- ,.1 04 ^ 



«0 ^ ,M ^ v^ 

CO 



i^ 



(3 



^ 



iU^i&<A4^o6:zP.A<<z^ 



go ■? o ri ■ w o w 



!>. f-l ^4 (M fM vi4 (O 

M CO 



o •-• c» 



^ S ^ -5 a Q- 



2 o^- 5 



► 
o 

2: 



>5 O S 



llll 



•n O •-» "< 



t^iQOt^neo<^oo<DOooioooao<«*r«<«*oor«i<«cic<oc«oowi<«iQ(Dt«ao<^e 
eeeoooekOO>0)OCioookO>oooe>o»o»o»oooooa»oao«c»o 






f-i^4eo^4(Do*^o> 



*^< s eg Q «? 2 4 2 Q 5 s s 4 < -< 1 4 ^ »? 2 s :! a I <5 S Q Q ^ II O ^ < 




a 
o 

•s 

o 



St||B.f|| = | 



s c 4 _ 



3 



^'oi 







1 
lis 

o; O a 
002 



2 



^(3 



4iii 



« 



o 



^1 






^•g 



a 

1,^ 



V 

•3 

O 



;55d54i2Q 



a -3 



•2=: 

s 






n-liS 



V 

eS 

1 



I 

e J 



s 

** o © 
a S 



U H O 



2 



o 
H 



S 

c 

s 

2 



a 



I 
a 

a 

I 



iiii 



^ ^ «» 

• •^ ^* ^ ^ !w 






>» X >» 



o 



II 



■> « 



t 



•••3 

•it 

J5 >► 








lias 3s §^ 

o o O O A S "S 

Hriiliif^ 

N.1^ N^ V^ Nw^ Nw/ S-^ V^ N«^ ^^ ^-i^ 



S 
3 




>» >• >i >» 

I c a q 






1 



'S'R'^ =* 









r 



aaaaASiaSia&o.o.o.a 



o 
8 



o p o p 

_ hi Im u C 

o. a o. a c, 



S< 



oooooooooooooooooooooouooo 



55 5 5 5 S5 

w p V 9 p o o 
V V «> C) « V ^ 

oooopoco 
aaOiOiao.o.a 

BBBBBBBB 

oooooooo 



102 



Kepobt of State Civil Service Commission 






o 

CO 

s 

O 

Sz: 

o 

i 

CO 

sz: 
o 



o 
o 

s 

c 



5.2 



1 



oil 

6 8 



^ si 




2 



c 



QQ 
O 



88888S8S8S88SSSS8SSSS88 
S88S§S88Si8^SSSSJ?8888S?! 



f^ ^^ 9^ ^^ T-* r^ w^ ^» r-* r^ r^ ^^ r-t r^ w-t w-» w^ r^ f^ r^ •^ •>« ^« 



W CO ^ 



.5 s«5- »3^ wcT^ w"..®!^ =5^^ «.2 «J5 i>^ 
oosckooo>c»oooa»oa»oo>oc» 



a» o 



o 9 



o t^ 

CM 






t S S 



l|l§11| l|{-!||l|gi"HM.i 






a 

a 




>% 

it 

a 
— « ,2 

C5 . X 



,13 



g .tJ a 



3s:^3c3i 



3 8. 2 

3 •? > 









-; S K -< 



e 

•a V 

M =2 



-2 •; 

'I 




Classified Civil List — State Depabtmentb 



103 



§8S888S8S8S8S^8818S^188S 888808888888 

* P t? '•'^ ^ w5 o 
e^ C4 X o e o o 




o 



8 



8 

9 



r CO n ?« ct M ct 






C — 00 lO »^ •-• "^ 









a 



O 












> 
o 



^ ^^ >> >k 

«2l TO »-» •-» 






o n o 79 o 

*4 ^« 914 vM «ii4 «■< 

01 Ok a o a» e» 













K is ^ X 4 -' ft 



I gc a>j g| 



ft *^ 




i>*ooKr^i>«aoaoeocoao30QO 






3 553;33 3 






V 



i<*ao»«i>«r«aoQ030ooaoQOX 



as 



>k ^ >» X >> S i: 



33 



= a 9 



="^8 



5 



:5 



8 
S 

I 

00 

1 



o o 

II 

00 

23 



I 

QQ 

a 

S 

s 

3 

Q 



a 



^ S S. S e-O 



o 
2: 



a 

a 









s * 



GO 



a 






s 

a 
»• 
rt 

» 

M 



I 




it i/ 
fee 



*" ^ 



c a c c 



& M 



2 e g fi 



^^333 

3 3 3""'^' 

Ol « 



2 z 2 z 2 6 S 6 ;2 (2 c2 fi 



104 



Report of State Civil Sebvice Coioiissioii 



8 

•a 

I 

I 

O 

O 





I ^ 




O 



2 



2 

O 



88888SS8SSS8S8888888888S8S 
8^1 












s 



88 



SSI8 

an a 9 



SS88 

a a» a> Ok 



ooaoorx»ac«Qoacooxxocxae>x«GCooxccoococeocflO 

OCJOiOJO: 0»0>0»0»OtOlO»«»000©C'. »»©»»»0 



xxxxxxxxxxxxxxxxxxxxxxxxxx 
o»o»oo»ooo»a»cbaka»oooe»oaoo:o'.aeoooo 



5llllia^im^llaimiliai<l 




Uk«Ub«khibbi 



EaaaaaaasacGG 

HfifiCfisseefige " 



b Im 



d ct 



h U t-i 

&^& 
CO" 

e e 



scsceacccB 
gfiiSSgfifififiC 






Classified Cittl List — State DsPABTicEinre 



105 



88888888S8888S8888 



888888888888888 
S § S ii 8 8 8 ? $ 8 S S S 8 S 



M c« t-> t-> 



0000000000X00X00003000009000000030 
QDoeooxxxxxxxxxxxxxxx 



aaeoJsa 




II 



o&isSz 



« 5 ,- 



3 



C3 

o 





••«i::::::ci:*^:">§'^ 






lit s a 3 g^fllj t l-fi $ B j 



OCX 




III 
ess 

^ 3 3 ^ 3 J? 3 fi P 3 3 fi J^ J^ 



2 
O 

H 

i 



O 



00 



^ 


^ 


!«• 


lO fO 


!«• 


!«• 


K 


t* 


!«• 


to 


t* 


X 


t" 

-• 


X 


•i4 




^4 


at at 


oa 

1— 






• 

•>4 


at 


Ok 




o» 


at 


at 


^ 


* 




:S8" 


^4 




• 


• 


* 
^4 


• 

1^ 


s' 


CI 


• 




Oct. 

Not. 

Feb. 


June 
April 


1 




>> 




a 


1 


0> 

a 

3 


o 

a 


-9 


s 

9 




at 


8 


1014 
1016 




to 
at 

«-4 






2 


to 

Ok 

•>4 




X 

o» 

^4 


2 


X 

at 


•* 


* 


CD 


^^ 




* 


X 


CO 


•• 


* 
1-< 


9' 


CI 


1-< 




1 


s 


■ 

1 


Oct. 
April 


1 


s 




1 




1 


• 
c 

d 


§ 


•-» 


0} 

a 



I 

a 

QQ 



II 



< 



> 

^ "^ *^ 
.2 ^ w 



CO 




** a 2 



S^ S iS JS I 6 2 b I $ 





Q M 00 oQ 



I 



C3 

00 Pu B 



U ki 



a 
a 



li o o o 

^ "5 -^ -Q 



9 

tt 



p3 cq 



(3 



t-, 

t 

a 
•a, *» ••» 

« -3 -d 

oca 

§ 2 ii 5 

i^ « - 

^ .0 ja jq 

A A (A sl 



106 



Eeport of State Civil Service Commission 





O 

'S 

S 

Q 

s. 

B 

o 

U 



a 
3'% 



s § 
Q S - 



1 



e 
a 



a '8 



iS 



o 

^^ 

I 

o 

CO 
CO 

a 

o 
o 

H 

CO 

O 



111 



in 






e 

2 



2 
o 



gS8888||x 
g?SSi8§"^b'5 

- N ® 



to 


« 


X 


e 


oc 


X 


« 


^5 


OC 


*irf 


^i* 


i-< 


p-» 


yi4 


^4 


f«^ 


^i« 


i-< 


Ci 


Ci 








© 





a» 





s> 


w* 


p<-t 


Vi4 


fi^ 


r-4 


^H 


*^ 


fi^ 


^^ 


30 




ti^ 


^■4 


r^ 


r^ 


• 


• 

r- 1 


fii^ 


X 


C 


u» 


^ 


C 


>> 


«» 


• 


eS 


•^ 


mm 


3 
•-> 


S<£ 


3 
•-> 


(SdJ 







cr 


3C 


e 


X 


00 


CO 


m^ 


« 


w^ 


^M 


^4 


1— 


m^ 


^m 


<-4 


V* 


^^ 


0m. 










2 








a 





« 


• 


V4 


• 
^4 


^H 


^^ 


* 


• 


«H 


• 


c 

3 
•-3 




a 


• 

1 


»-s 


5 


1 


• 



< 



s s 
•£| 

CO 5 

O B 
-I J 

o * » 

.= •; c « -= 
L- j< "^ iS j= 

9 PQ Z o> r^ 



S 

a 

X 

o 



c 
u 

2 

:3 



.• U fc« 

^ C. ft ♦; 
* CO CC X 

^ « « ^ 
S 3^ 



X 

5t2c22 






•a 



1? 



^ .a ^ - »- 






i 



c 

e 
t 

a 



■5 ^^ 

. . . o o 

4-1 '«>>«>>«* »« 

a 3 a ^ 

** a 



e! f! tf o 

•O -^ -g -3 

B B d a 

O & V O C* * 

«« 4rf «j ^ •«• 3 

'M «< *>> q s e) rs 

i * • -g ^ 5 5 

•B J3 .*. X t3 S S 

"S -s "s e* i ^ ^ 



3 






8 888888888 



s 
5 



o 



U3 






U3 



CO 

O 

H 
O 
H 

1-^ K 

« O ^ 

as ^ 
X ^ 



Q 



O 
H 

Q 



Q 
U 



9i 



85 



2 

as 3 

eS 
C 

0: 



01 



•< 
U 

Pi 

H 
X 






M 01 

X 



B 



B 
ft) 

1 



3 
X 



CO ac is »^ 



s 

3 



f M 






4; V .C ^ .t 3 3 .a* 4 



3i©0Sh»CiO»0-^C 

cHcHlCrHlQtOCOfM^ 



jQ jQ X 
o &) a» 

^ U4 tf4 



es 



;>4 



3 3^5 
-9 "^ ^ <*? 



B 



o 



l2 

* 

6 5; 

< 5 






> 

< 


?i 


:^ 


B 

5 


x 


X 


«j 


^ 


S 


cS 


*i 


•§ 


>3 





4 


■ 




:? 


^ 




8 


§ 


^ 

fi^ 



B 
C 



•s g jj « 

•S is > '; 

t- a * C 

T 2 ?8 5* 

«0 » ^ « 



6 



3 
ci 
S 






S ^ . :? "5 a :2 . « 



U 



s 






V •"" "■ C •» 3 "" ^" 



3 

a 

•r 



it V 

OS « 

o o 

B B 

C & 



>. >i >. 






5 . 9 '. Z- r Z' 

(2C£ w £ £ £ ( 



(Jlassified CiTiL List — Statb Depabtments 



SS3SSS3S888SS8SSSSSSSSS8SS8S3SSS8S 









= =££2££. 


S££S25222Sf;222S£3SS22-22S232 


2 2ggS2- 


miiimummmmuiii 


1 mm 


2222222222S22222223222222222 
£££22£22222222222S2232222£2S 


i ssas"::- 


2 -■ U n S "-g ^- g S i- ^- --=88^^ g -■ ^■^- :=■ " ^ S :: -■ 



taB^^i4^£a4iiiS'i4ii444^4-i-i^^^iB 



,;""'", i.-"^ 



^ J s « e J 3 z ;; ," J . « s *" s s -^ ^ s » ^' j i j 



liJillllllJI 



Ji i^ ill 

m u m 



^'i^ aUiiiili&i&iiiiiiiiiiiiiiiiliiii 



108 



RspoBT OF Statb Crvn. Sshvicb Coincission* 



I 

s. 

a 



o-?1 



5 

ee 

Q 



3 
.9 

8 

a 

I 

3 



o 



i 





i 



2 

O 



8888S8888SSS88 8888888888 






^ iS .« .« 3 -© 
h «« Pbi Pk *-> 



a X) .c .d TS .d X) ^ 

S C ,«> « ft) « c* © 



o Si V ^ o a 
U* f» ^ >-i fxi ih 



^ ^ 



3 .5 ,® -« 

-a •< h ^ 






« -. - 3 ^ 3 > > « > » ft* « 



I s £ £ = 



>» !: 



,« 3 « 3 r** > 3 ^ r® r® 






o 



2^ 



QQ 



r 2 r ♦i m 



•2§ 



oc 

.A 



I 6= 






CSI ^ 



•o g 

•b '*' A^ 

t3 to ^ 

o ■* g' 

^ »H .3 



O 



>^o 



o 



^ cS ta 
o ^ •»* 
»o S ^ 



5^ : 
« 00 

is 

O f-4 

£^ 

•^ ^ » l> 



O 









t 

ft) 

H 



a 
ft) 



CQ 

B 
O 



B 
O 



-2 

•V 

c 






o 



05 ^ ^ 

•SIS 

« * - - -- -* 

eo ^ r* rt M rH 



^•2 I 



CO 

•o 



O CO 



o 



d>i 



as 






oo 

2iZ 



00 00 «r «* 

^ ^ ** ^ 

•-4 00 IB 

^ » U J 

« « ^ * 

C4 !>« O Q 

« r- 1-4 O 



a 
a 
ft) 



B 
g 






«S & 



B 



t: S ;= 



O C h. U3 • ^ 
3 |g 3 J > .. 



B 
B 



^ n 



B 
eS 



i: « 






3 o 3 J: 
o ^ o ^ 

►J »J iJ < 



a 



B 



53 






3 I? 

S 2 J 

B B "■ 

o o 

•-» "-a •-» 



S B 

:s J 

♦J .B 

•*± ^ 

« ft) 



^' 









ft> teH 

« 2 

« J3 



1 



t 



1° 

z ■< 

B IS 

US := 
4^ 



2i 

cc ao 

c b 

S O Q 

B B X 

•^ H •-» 



>t>k>v>v>i>>>t>t>>X>)X>i 



333333333333 

aap.Q,aaaOian.aini 






3 3 

a a 



3 

a 



3 

a 



3 

a 



3 3 3 

a a a 



3 

a 



3 

a 



3 

a 



a 





®i**>#vv^o^vfi)S'&ft'&' ft)ft)«)ft>ft>«)o«S 



CiABSiFizD Civil List — State DRPAJtTMENTS 



109 



88888S8SS8S8888S8 
Sill 



S88S8888888S8888 



6 Q O Q 

00 00 00 00 



00 



•oaaoicokoookok 

000>OiO)990>00> 



lO lO o o o 

ip4 ^^ fi^ f.4 rH ^4 

01 Ol o o o> o 






d M r* »« »« 



£ji ji ^ c a Xi Xi Xi ^ Q.JS c c 



•g "^ "S 

f>4 f>4 t(4 



>eaaoiea»c»o»akO!oa»iOioa»oo 
(Baatao>90>cbaft0k&o>0i00o>o> 



«• K « .M M 



•i* ^ Q t* !«• t^ !«• 

A C^ 1^ *^ ^ 



« « r* t* t* 






«* • O V 



T-£«C Z -O XtjD MC.JD G G ^ ^ 



I 






1 






CO .^ - 

_ s •^ lO ^ 
N^ I* io © ^ 






o 



is 



>^ ^. 52i d ►; 







2 9 i'^g.^ - 



II-3 
.?l^ 



>» >» 









4 



,1915 
,1919 


,1919 
,1915 


1915 
,1916 


O !>* !<« 00 lO lO 

f.4 «iri ^4 ^4 ^4 ^H 

O O Ok Ok Ci Oi 

rH rH v^ r4 t.4 v4 


O lO to 

w^ 9^ ^-4 

Ok Ck Ok 

^^ W4 ^^ 


lO 

*^ 
Ok 


Sept. 7 
Jan. 1 


Jan. 1 
Oot. 4 


A'ug- 18 
May 16 


Jan. 1 
May 16 
Aug. 16, 
Aug 16, 
Nov. 18, 
Deo. 1, 


Aug. 1, 
Nov. 16, 
Dec. 1, 


CO 

• 

o 


1P4 *i« 


a» to 




to lO ^ lO lO IC 

.4 _! ,H ^i« r^ ^4 

0> Ok 01 Ok Ok Ok 

r^ r^ ^^ r^ w* pm 


to lo m 

-* r^ w4 

Ok Ok Ok 

1*4 rH ^4 


iO 
Ok 


»* •-I 

545 


Jan. 1 
Oot. 4 


Aug. 18 
May 16 


Jan. 1 
Nov. 1, 
Nov. 6, 
Oct. 1, 
Nov. 18. 
Deo. 1, 


Aug. 1, 
Nov. 16, 
Deo. 1, 


to 

• 

z 







S 3 o o S 
M Ok Ci 00 ui 











•a 



.Atf 44 .M J« .M J« 



III S as I S £ £ D C 6 



no 



Eeport of State Civil Service Commission 



C3 

O 



s. 

a 



s 



Is 

»*« .5 'C 

o '" > 

III 
g-8 




« 
55 



o 



00 

O 

&4 



8888S88S388SS88SSS8SS888 

OOOOQOOppOCOpOOQOOOOQOOO 






"C > >f > 



a J^ ^ ^ 5? -^ 



b t« •-) 







? 5 J 3^ C • 

a » o i «5 £ 

• <i ^ K J3 ^ tf 

2 J -g •> i ^ I 



♦ t S 

;§ '5 -o 







Classified Civil List — State Departments 



111 



8888S 



8 



8 "^SSSSSSSS 88 

« *^t^ ^ '^i ^ n e* ^ c^ MM 



388 

» CO ci" 



e oo e« M s 
S S S a ^ 


X 


• • • » • 

N «3 00 oe r^ 


CI 


Deo. 

Deo. 

April 

April 

April 




1000 
1808 
1012 
1012 
h)16 


X 

a 


N « 00 00 rC 

-^ — — M 




Deo. 

Deo. 

April 

April 

April 


"a 



A 










X 

• 

X 






o ? 



oo»^»S 2 ci 

-i 0» »«• ^ O 

-i 0» t^ 5 JS 

•H ?l CC flC lO 






11^ 



a V 



-B £ 







s 



3 



lO 


a» 


•rt 


•o 


to 


a 


•o 


•o 


IC 


■o 


r^ 


^4 


iH 


w^ 


•M 


t-4 


f^ 


*^ 


VH 


t^ 


w4 


m^ 


o> 


O) 


o» 


a» 


o» 


a 


a» 


o 


o 


Ok 


O 


^< 


r^ 


'^ 


tM 


^^ 


^4 


f.4 


^4 


^i* 


•^ 


rH 


r* 


»^ 


^4 


• 


• 


»M 


• 


X 


CI 


•i^ 


^4 


• 

c 


c 


^ 


e 


• 


• 
e 


• 
e 


i 


• 


• 


^ 


as 


»-s 


^ 




c8 


98 
•-3 


« 

•n 


s 


"9 


S 


9S 


^ 


«o 


»o 


N. 


».'? 


to 


to 


lO 


lO 


t^ 


s 


V4 


*ii4 


V4 


e» 


8 


V4 


w^ 


V4 


*H 


»i4 


a» 


O 


o> 


X 


o 


o» 


9 


o 


o 


rH 


t-4 


^H 


•-4 


^^ 


^^ 


^4 


•-4 


*i^ 


^^ 


^4 


5? 


^4 


• 


• 

^4 


w4 


CO 


• 


X 


« 


• 




M 








^^ 


CI 






M 






• 

e 

«t 
•-> 


•c 


• 

a 


• 

8 


• 


e 

9 


• 

s 

•-> 


• 

e 


5? 


• 

s 





J3 



5Q 

I X 

P — 

a. 
91 

6 



a 













V 

a 

I 

•* 

09 




X 

o 



o 

•-4 



» .-I .^ 






■^^ 

5 



X X 



f-i .-I CI 



2f j« j« 
r *« li 

•Is 5 

"3 



s 



OKU 



112 



BspOBT OF SXATB CiVIL SeBTICE CoUMISSIOR 



I 
•I 

I 

ft 

i 



a 

o 

1 

I 



a 

^1 



^ 8 



8 ^ 

"Ml 

.3 • 



i 

2 



o 

CO 

2 



88S8S88S88SS8888S888888888 



•^ « 



04 






t 
O 









e« 



1^ C4 



miiHUMHUUHHu 



^ 








" 8 ft -H 






'SI 

•S'3 



•M Ji 



1 



J 



& 



M 



I 



a 

g 



^ 



0) 

CS 






^ JM J4 ^ ^ ^ 






«irt •■« »w4 «Mi« 






J4 






^ ^ & t fe % _ 

JO ja ^ j3 ^ ^ ua 



QO QQ CO 




Ci.Aa8iFiBD CiYii. List — Statb DspAsiHxifTB 



118 



S888§S88888§S8SSSSS 



§§ll§i§§i§§ 



go o o 
* * tf 
». o ab 00 



o 



8888SS 



??^8?88g8§fi§S 



o o o o o o o 
o o o o o o o 



o 

o 



00fl0B000C900C0C*9COC0O9C0COCOC0 






s 



V N 00 fH 9« v« C9 









c'Hx 



• ^ 9^ •«■ •«4 u0^ 9^4 ap^ •«« 

Aaoiaaa 



„_ aa.o»aaOi.a 



600>OOC>OkOOOCkOC>OOOOC>0 OaOOOOOOOOAdlOtOXaiO 






a 






I 



nil ^ M 







U3 

o 

0( 



M C« «-i U •» 



««-<S^2^ 



-a 






go 
!q 






M-'S 



£ d 



b:ss 









M 
Q 

S ft 



C 






. * ** -s « 

-< P S tfo 



8 a 



jjHW 



4) . ^ 



u 

A) 

a 
< 









M 



H K 



00 



a 



=- d£ 



a 



> 

a 






§1 



Eci CD GO 

-< d tf 



a 
o 

I' 



^ «» ^ S O 0)' 4>- 



'& *& '% '§ -& -| '& -& -fii 'S '& '& '& '& 



«.ees 



4>o>4>v«&a)o«)c>a>ai 



liiiiiiiiiiiiiimi 



^Ck 



p ^ <•• f" 




»»^» 



- • o 

c e d 
o o o 

X) .d J3 

& Ck & 



S ff 
o .3 



5 9 «*• S ^ -S J2 
J ii S 5 > TB 



tt oaac aQ.0Q.H H H 






aadddddddddddd 

.s .a .a .a .a .a .a .a .a .a .a .a .a .a 

oooooooooooooo 
ddaddddddddcied 



^d CSC). ^g»<3g^ggg»E<^ 



114 



Repobt of State Civil Sebvioe Commission 



§ 
•a 

i 

a 

o 



- .a 

© 

"5 d 



•5 






e) a 



d _ 






I i 
S 8 




2 

o 

H 

00 

Z 



ocooooooSsoooSooSoooSoooSc 



r* t* 


t* 


t* t* 00 


r* 


w 


M 


o 


1-4 


r* r* 


O h« 


« 1^ 


.-4 O 

t-l 1-4 


C4 Cf 


04 n qp 


!>. < 


t-t «-• 


t-t 


ft ^4 o 

o o S 

f4 tH fii^ 


s 

t-l 




^4 
t-4 


1-4 

o 


r-H «M 


is 

1-4 ^4 


«M f-t 


W4 O 

1-1 •-• 


»4 fi4 Q 

oi a» S 

^4 pH pH 


>M 1 




•M 


•-« f-i C0 


>M 


t-t 


• 

CI 






• • 


• * 
f^ 1-4 


1-4 


* • 

-^8 




^4 CI 


M < 


r3 7z! n 73 rs o 

kt i. »< ki h e) 

a A c a & § 


a 
d 


1 


>» 

rt 
S 




• 
d 
d 


April 
Oct. 


May 

Juoe 
April 
April 
April 
April 


Sept. 
Mar. 


June 
May 
July 


d 


CD r* 


o 

W4 


« on <D 

^H ^^ IM 




W4 


in 

o 


«-« 




si 


si 

•-) «-4 


t-4 ^4 


r« 00 

o S 

f4 t-4 


is 

O 00 

t-l (-I 


t-t ph p^ 


t-t 



NNC«0'^0-f>OOiOO«oet^-^«0.^«Qi-roOKrO»^0 

33i53.5MS^ft3 3 d3&?,®33i^a,g § S"§3 g 




1«« 









o 









o w 



.a s h3 ij 



« § as 




.9 

6 g ^ *** g «J 5 



q d d 4 d 

H B S 



V o V o> « p e 

||l||l|-|||-S; 

.a .9 .33 .9 .S • • 8 S • • 



9 8^ ^ _ ^ 
«8 ISI d d d d d 

- k« »• 5 is 5 




nil 




5 j ^1 I 

■iiiiililJilll' 




Ci^aaiFiED CrviL List — State Depa: 



!!?5ll!!!HIII!ISIIIIIBE5!!!ll!!?!!l 



iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii 
llliiiiiiiiiiliiiiiiiiiiisiriiiiiiii 

mmnmmiummmmmmi 




:iiilll:^sii^jl:i;iii^ ■' mm 



iiiiiiiiiiiiiiiirmiiiiiiyii 



116 



SxpoBT OF State Civil Service Commission 



I 
o 



ca 



a 






•8. 



I 



lis 



V o V 

1 1 

"IS I 



5 



o 

2 



8888S88SS8S888S8S8S888888S 
S8SS?^38S|§§SS8S8^SSS8S88g 

«" w" N ei N N ei »<« w ci « N w* ci « M «««••««« N e» 









*^ »o e> 












tt lO ^ lO lO 



s •< <g s ^5 ^ •?! a -J^ s s a III s -S-fS s 



lO -• 



88880 



o 
o 



C4 



-H o 8 

Oi Ok Oi 



ill 



IS 



i:;a 



§-• 



"c g-n^ S^ § 1 >. S'cc jiT S&3 ^j> i#g-'2 S e e a y 



V «! h >w 



I I 



a 

(8 

5s a < 






^1 . 

W g ,£3 ^ ^ ■""■ CO 

r§ s 3 :S s s ^ 



O CO 



S 

•3 

Of 



Q 
at 

a 

< 



03 

a 
en 





CO 

o 



-5 



§ 










a. 

a 

6 



I 









.2 ^ 

3 o 



: 5 ^ 



Sao . « 
C &3 fa Q 



-o fa 



a 

Oh 







b »« b 






addqaaaoaoedacdddad^ 




daadddddad 
S2S5SSB3SS 

mtmm 




Classified Civil List — State Depabtmektb 



117 



S8SSSSSSS8888888S|S8S88888S8S8888S88 



'C«e«cie«e«e«e«e«e«Me<«-4e«e«e«e<e« 



Si 









l0^4^,^Q^,Hl-4aifi^fi^^4^4<^<-*i-ll^^4i-4^4l-4»4o-t^4 



*N <-4 £J 1-4 



b »• c 

ck a. o. 









e« ^4 ^>i 1.4 



S§f 



^ W ^ V V ^ 

10 r* •* ^ »* «-• 



CI 








a -§ 'g 'I *a 'A 'm 'A 'm m -a '§) 

dsddaasap ddd 



d d 

ft 



ft) S 
d d 

d d 









• dddddddddddd 

-| «^ •mm mmi •mH »M a^ •^ •** •^m 'M 8 ••!• 



d d 
.3 .2 



d d 
S S 

9 SB 



I 



d 

9 .a 

iS 



O O O O O Q O 

• mm a^* cp* •«« 9*^ •mm aM 

d d d d d d d 

d d 3 d d d d 




Rkpobt of State Civil Service Couiassioir 



II 



^11 



Hi 



3S83SS3SSSSS88S3S8S3,S,S8S,SS 



2 *■ ^ -■ 8 - 2 2 -" "=" 2 2 "■ 2 " 2 S -" S 2 2 - S" S ?! '^ 



t" 



lifii 


ill 


: 5 ? S " jf J 


^U 




s 



i 



iilliilHIMslllliiHIilli 
llllllllllllllllllllllllll 

I i i l i i I "i i i I i i I ri 1 "1 1 '! f "1 Ti 1 1 

.E J .§ .5 .S .s .§ .a .2 .? .s s s _s s | § § .| .| s 3 ,s | s s 
|1l|§S§§Ss§l§Si5|Sli§§Si§S 



Classified Civil List — State Dbpabtkentb 



%ggSSS88S8S888S8SSS8S8S8S8SS88S3S3S3 

iliigiii§§iii|§i§§imi|ssss||ss§pj 



^ S * 2 2 S S 2 5 "' S g "■ a -■ S "■ 2 2 '•' " Z «" • g -" S" -" a S t 2" «■" «" S S 

iai!ii5Jiiiai!iJ3iiliiiiiiiii!iiiiy 



1^ 



S52 

i 



I lul 



g<=j: 



sill^ls 



yjii iiii ^lililliiiliillllsllli 






^ *o :::■:: ^ ■: i! ::: : 



=" = !! 



■flllllllllllllllillllllllfllllllllll 
IJII|||||l||l|lll|l|35assllal|lsaa23 

Irlliiiirriiiillfrliiiiflflliiliilll 

J » ! I i S S ,S 3 1 .3 S .! S ! S S ,| 8 B .3 ,B S S S ,S S S S 3 S ,3 .3 .3 3 3 



120 



Repoet of State Civil Sebvice ComossioN 



a 

o 



a 
S 

c3 



o S ^ 




o 

III 



Z 

o 

H 
to 

£ 



888S8SS8888§8888S S8888$^<? 







•(» 




^4 1-4 *H vH -w^ -w^ V v^ 

OQOOOOOOk 




W W 0* CI Pi -" 

Sa^ ^ "S. "S. < •* "i 

S 5" S xn ?2S^ 38 




o»e»oc»a>a»c»oi 


« S" « d 2 2 « 8 ^" d S ^" * -^ 2 § '^ 

iiiiiiiiiiiliilll 


June 19, 
Oct. 1 
May 31 
Sept. 28 
April 20 
May 22 
Aug. 7 
Sept. 11 



QQ 

9 

a 



^ 2 ' 






_ r j< 

V CO d 






o 






9 
P 









00 



Q 

CO 
CO 



a 






3 ^ 
o : 

3i *• 



hi 



CQ ^ 

O 



'» i! S _ 

W i» J 5 '^ O - 

hS (^ •'^ 

W t* r. 



II 



I 

a 

:2 






1 



Pk - 



3 

Urn 

an 



^ ^ -o a 

S 00 OS ^ 






£ 

3 9 
■ ^ ^(^ 

•&I 8:5 



OB - 

-2 9 

9 e 
■3 .2 

S2 



u 



(2z 



JO < 
Jf 



a 
6 



l|» 



i 









a&i = ^ « 






C 
9 

I'- 

0* 



* 

*■> 

9 



X 

6 



« '^ (^ 



a 



* 



2 C S 



* 
.a 



.5 






I ^ 



:« 
C 

(^ 









c 

a 



* 
9 

a 
c 

3 






as • s s • • 



9 o 



«• 



a 




h, k h h ki ^ h 

1 1 s s 1 1 1 

B a a a q fi q 



11111111111 

•3 -s -2 -3 -a -a -s -a I -a •* 

inlliisn 



- - - «^ ^^ «^^ «|M M^V MM 



II 



d 'S a 
s q q 



S & & 
q q 3 



II 

II 

o o 

■a'S 

3 q 



.a 

! 

•a 

q 



t % 

B B a q d g 
« « « 6 • « « 

d a a d d d d 

sasssss 
siS!!!! 

& o ^ o o o & 

d a a d d d a 
o o ^ o ^ 9 B 



Ci.Asnmi> Crrn. List — Statb DsPAimixiin 



8S8gSggg8gggg gggggSSSSSgggSSgSgggSS 



-■=5 *■ -" s s ?. 5 a 2 i s £ s ^ : s £ "" s 2 £ s R" -■ gi g g 2 3 a s a" s 
Jl'jiiss *|;^-5 s-l-Slli 3|?i-S*s Hil^llt 




lllltlfl?l?lll filtilliiriiilllliil 



|iJ3IJ|J|J| 



S|||||I|I||I|JJJS|||I 



titlllll-llllif 111111111111 iiUiilii 

J!oSS3SSSSJ|.= .gS SSBSSSSSSSSSSSSSSSSBS 
||I||J}SJ||||| 5||||j||||11l1ll||§il 



122 



Repobt or State Civil Service Commission 



3 

IS 

8 

o 



g 

< 



c 
o 



8. 



O 





o o 

o "" g 
^ * S 



P s 

a 



lis 

§•8 



I - 

« o « 



S 

H «2 a 

M « a 

5 • 



2 1 



2 



2 
O 



S8S8 S§ gS§§S88Sgg§SS8iSS§ 
Sii§ iS 888R8882 iggggSS §Ss 



oooo oo o»ooe»oooooo>oo&oc»a»ooo 



«-" © i-H on 

CI 

2 "tj £ >> 

2 p. C eS 
•n CO *s .< 






M M C5 N -- « -« 



^-b ft 



C. «8 



^k avrt •»« •«« •«« cfi^ wpi* v*? •p3 •*4 '^ 



& a a o. £. 









^ ® 



??S S:: ^J5Ǥ5^::?S5:;* 



r-^ QO ^^ to •^ «^ 



« N « 



09 









"K a a 






o -= o 






C C 



u 



> 







if 



o 
:» 

-< 



O 



e a 

2 3 aco 









2 c 



5:,2 8 









a, 



E 8 t^ ^ CO -3 



h ♦; ^ 

M ^ *^. 

-I 

00 O 
CO t- 



3 

CO 



Jo 

O) - 

is > rt 

«j < a. 

2" 2. 
O - 

o t- j2 

u5 S < 



o 

3 



or: 



2 



GQ 



§■2 = 



is 

? 

'5 
o 



r - O 









o lo JS {J >, 

"S -^ SJ ^ J: 
to CT O S 






o 



O 



O 

a 
a 



2 en 
a 00 _• 

.S-JS « 

^ ft s 

;a5^ 



s 



1^ 

9! 



h H 



« 2 
»2 H 



B 7 t< 43 
5 O ^ ^ 

X ff! S ^ 



o 
c 
s 
.a o 

|b 



:3 



3 



•J EE4 



♦ 

o ^ 



d it V w 

Q M a r 

• SB* 

"^ NH "^ 

^ "^ - 

*^ -«5 fri 






« tt C) o ® 

■4J 44 «> 44 44 



V 




W »« kt b i« 

S S 1^ s $ 

BOB 



it "I "I "I "I ■* 



ti 9 (O 




5 o o o o 

• M VM •«• VP^ •«« 



II IJJ J I 



IIJIIIIIIJ 

>g a^ ••« AM «p4 wpM cm •fS mS cam 

iiiiisiiii 

pS •0m •«• vp^ v*^ •«« •A •^4 •*■ •»« 'P^ •mm •mm •mm *& *n. *^L '^L *^L *Tf^ 'mm v^ •mm •#• 

§i§§i ii § i § § § § § la sstS^ls? 



Ci^ssiFiED Civil List — Statb DsPASTifSinfl 128 



SSS3SS8SSSSS8SSSSSS3S S38SSBSSSSSSSS 

liliisilOiiiiliSiiIsi lliilllsilliii 







imiitmi'siiiiilni 


o>oieie>i=ao>oao>eisioio> 

JlJilliljIllfi 


iiiliiiiiiliiiiiiiiii 


222222222222SS 






"S'S-^aa" 



3 1-3 ^a I ?.olst|'&^B3|^?''l 

:i^4<-<^ ^ 2 < o s dS tf! ^ 5 S (£ S 2 < 



=IUi| 



3-! Ilil 



S ii 



-*.«' il 






iiiK 






lilil iill l1iH1<2=i ss |s |s J 



J J J 1 1 1 i 1 1 1 1 ! J 1 3 3 1 S ! 1 3 • 3 1 ! 3 S ■ 5 3 3 3 3 1 1 

lililliitriiiiiiilHii iitiiniiilrl 
lllii'fsllii'iliHIIlTil TlHliriTliU 



124 



BxpoBT or State Civil Sebvice Comuission 



I 



I 

o 



ca 



a 

•J 
s 

c 
o 
a 

B 
6 



a 

5 8 & 

e 






|8 

«, 8 i 



•§ ® § 
•see 

§11 



el 



o 

H 

CO 



8SS8SSSS88SSS8S8&SS8S8SSS8S 

O0QOOOOO00O00OQO*?0Q02QQOQOe> 

ooaoooooeoooaboooooooooooboooo 2^ioiOk/)toiowdou)u^i2> 



8» 






^ 












? « 



a a3 3 3 a o a 3- 



< <>^ 



<:z< 







JS^JJSJJJ^^^ 




JJJI 

.9 .9 '9 .3 



bO M M M U 

a a a a § 

tS »w* '»* »f* .r3 

o V « 8 S 

a a q G a 

G a a a a 



'•^ii- 



Ji 

„ .s 

ss 

■-' -H •? 'C 'C — 

I -l -l 'I 'E 'I 'I I III 

« K w W f§ w w w w J »2 





oooooooo 



W «• bP 

add 



I I 8 I I 



M 

d 




9^ mm mm mm *m mm p^ 

f a a a a 3. 

^^ M 1^ M ^^ ^-» 



Classtfisd Civil List — State DEPABTHXim 



19S 



8S8S 



«9 



11 



ft 

O 



i:S2 

• S Ok 



o •^ e o 



T« « eo 00 

o rs a -^ 

o a S a» 

v« ^4 »H ^4 




4? *i -* « 

»H ^ ^ !>• 










88888 
§§3i§ 



8 



888 8 8 888 



to ^ ^ 



w4 c% C9 to e^ 

•^ W4 ^4 »H »H 

01 e» 01 9 01 

v4 1.4 1^ fii^ 1^ 

^ 1^ tH «-r lo 



ill! illSl 



^ e« M lo ct 

•^ ,M ,H <-4 l>4 

0» Ok 01 01 9 

v4 »H fH *-• i>4 

• _^ • • • 

v4 « <-< v^ lO 

oB ►^ ►^ ^ ^ 







*0 *^ S .s>*^ 
•-« i-i M do c« 




3 

o» 



CI 



r« 00 r« 

»4 i-H f>4 

o o» o» 

•-< "^ tH 

* •• * 

^4 fi^ lO 



r4 aH to 

* * • 



fa ^ O "^ 



CO 



W O O^ 
^ co" « 



o» 



CI 

o 

a 



to 
o» 



o 



•o o to 

Cb 9 O 



I 



gg 

zz 



fH^i-4 m^ © ,M.4*-I 

OAOi O GO CbOiO) 



CI 

s 



lO 

CI 

< 



I 



2 Z 



O 



o 

5Z 






o 
I 






d 
o 

(2 



^ 

^ s 






C3 



CO 



CO 

CI 






a 

GQ 






3 

J'. 



a 
o 



M 









888 



M C« M 



*o to *o 

w^ w^ ^4 

o> O) o» 

t-« tH pH 

O f-4 1F4 

t-4 



>C (O ^ 

•^ !-• »-« 

O) 0> Ok 

!-• *H 1F4 

* * » 
O <M «-4 






t 



J9 

S 



> 
< 



c . ^ 
'3 JSte 

^ .9 f 

CO ^ CO 

^ A t^ 



V 



0) 



DC « • 



:3 SZ 



JS 



■a 
i 



nil 





o 

I 

a 
a 
8 



o 



S 



o 
o 



a 

o 
o 



9 

a 

« _ 

2 -a "3 -C 
a 3C X wi 



c g § § § 

o 9 g 



3 O 



o & S « 



is 

t* S § 5 S i 
a-< « S 2 55 

A * > a » » 

b< U (. h b k 

c & C V « 8 
a a c a d (3 
o o o o o o 

• ^4 op^ a^M B^B sBia ._a 

s s 

a a 
a a 

o o 



J .a J 



a 
a 

o 



«J 4-> '«' ** 44 «* V 

3 3 3 3 3 3 a 

a & Q, o. a a g 

a; o a; <D c « ^ 

tJ tS •« 13 "TJ 73 g 

C O C/ V c o o 

en cti X X ui oix 



126 



Report of State Civil Sekvice Comhissioit 



I 



•— • 
U 
X 

» 
o 

H 
H 



c 
o 



B 
o 



Q O 

*** '5 'S 

♦* s 

s 

0) c 



|8 
g-3 



8 ^ 



2 



O 
H 

OQ 

2 



88S8SS38S8888888S8888 888 



8 

o 



8 

o 



f M CI 



tC 



S8 



'»lC^^*^•Heoc>^e»:^^coccc^^^•-^1-<^-lf-l^l-l1-l^^ 



o o cc 
•-I ci « 



lOOOtOOOiOiQMdtOt^OOOtO 


xcooooi««or^co 


t-t •-" 


oc 

35 






May 1 

July 1 






cn«o(D«t^cor*co 


CO t^ 

at S 

• • 


Si 



oo-=o'Se<yvS^»2aJ5i2^^^5i2iK® *3^ 







Classified Civil List — State Depabtmsnts 



127 



8 S S 8 8 S 8 888888 8888888 



8 

C4 



8 



8 



% 






-^ •-• ei 



CO 



eo •^ 



^4 r-« «o iQ lo •/) ^^ 



lO kO lO CO ^ CO CO 



w 



00 


to 


«0 


»o 


CO 


» 


iO 


lO 


t* 


r* 


« 


•O 


o> 


CO 


to 


1* 


O 


CO 


CO 


t* 


GC 


^^ 


—^ 


^4 


^i4 


v^ 


^^ 


«^ 


•^ 


^^ 


W4 


t^ 




^< 


w* 




^^ 


»-« 




t^ 






c^ 


a 


e» 


o 


o 


o 


o 


o 


o 


a 


o 


oa 


a> 


a» 


o 


c» 


o 


o 


a» 


G> 


c. 


9^ 


f^ 


^4 


I-« 


<-4 


»^ 


tH 


f.^ 


tH 


r-^ 


»^ 


»H 


^-4 


rl 


»^ 


l-H 


t-t 


»^ 


V.4 


•M 


1-^ 


m 


w 


• 


» 


» 


^ 


» 


^ 


.k 


* 


^ 


^ 


^ 


• 


» 


•> 


^ 


^ 








^^ 


CD 




1-4 






■M 


*^ 


t- 


o 


i>4 


tH 


^.4 


■M 


1-4 


1— t 


^^ 


«o 

t-4 


fi4 


I-4 


c 

r^ 


• 

> 


• 

1 


• 

s 


.1 


• 

> 
o 

z 


>> 


o 


• 


Feb. 
Feb. 


a 

•-> 


2 


• 

a 

OS 


es 




• 

3 

•-> 


Mar. 
Feb. 


• 

1 



















00 If) k'3 r» r^ o •-'3 a» 

«"^ ».* w^ ^^ w^ r^ w^ ^^ 



o o i» «o <o (D r» 

-^ 1— < 1^ 1-4 tH t>^ tH 

O 9 O Ct Oi Ok O 



•-• O 



1-4 t-l CO f^ 



«-4 t* © 1-4 1-4 tH 



•-4 ^4 ^^ r>4 O i^ rH 



> 





s 



O 



4 



> 
O 

55 



« ^ JD - > - 

<S £ -? = ° ^ 



&-4> 



»*« "^ ^ 



« « 3 *5 ^C' i> 3 
•-» -^ ►n *«5 fa O -^ 



5 



e 



c 

as 






a 
>» 

8 






4^ 

3Q 



J 3 



I I 



-4 



U2 

00 



o 

V4 



X 



5 

oo 



6 

'3 

S 

cS 



1« 

> 






P 31 



I i? 



8 



o 




- > 

n U (4 

:3 g}J3f2 



a < 

a ^ 



I 

a 



a 



>o 






CQ t* f 



oi 



« r 
. ♦» 

< -4 ^ * 

ra f-i to ^ 



c 



CO 

c: 



o o 01 



61 



r N 



I 



CI 



C 

3 



a. 



mm 
• mm 

4.* 
Urn 



g 



>> 
Ji 

T3 
9 

Q 
8 



s 

% 

a 



Q 

0m 






a 



1 I 



"•SI 



>. C •§ 

jQ 8 



a 

Q 



e JS 



13 









9 



•^ aS ^ 
O ►- ^ 



a^ 



3 



« 
9 

B 
O 



a 
o 

a 
a 
m 
ja 
U 






si 

a 



CO 



a 

OS 



a 

£3 
■5 



o 

b 

a 



6 

•d 
3 



a 

•c 



*|s 



d^j 



IJ a 



V 



C ^ b 

t» d v 

« ;a 14 

fa •-» &4 



> > 



I 



c 




R 

-% 

>> 



I 

s 

8 

u 




d 9 

3>» c. 
if 

9 "^ 

•o L 
^ • 

o 



c & o> a» V V e 

c d e d d d ^ 

h t« u b. i. k. u 

C Q 5 o o o ^ 

4>> 'M w «< «j ^^ ^ 

'•^ «« «« «i> '*4 '«i> hT 



o 
c 

8 

m 

o 
£-^ 

• OD 

a§ 
^ c 

= 53 

O » 

< 



t'C 



d 

X 






c I 



c 






"5 .2 



^- — 






128 EiTORT OF State Civil Service Commmsioit 



CO 

o 

a 

H 



o 

i 

& 

J 




.!« 



5|« 
g-3 



6 ^ 






9 



o 



en 

O 



33S8888888888888888888888S 
S§3838§88S§ii8S 



«0 



CO 



^^),.Hv4«i4^4 r* 1^ 1^ ^^ 1^ 9^ w4 



^ 00 ^ »m" o CO «o -^ CO r^ -^* ^* -^' Ofc -^" rf ifl 2 t-* 2 g ^ 00 g o 



^ X >> 



o 



C Xi 






9 t) 



^3^1 



«i ^ « 



3 s > s -: 



'J 

o 



<o<0(0(OQeu>^c«ooaoooxooo<Dco«990i25go^i2C«ao 
«-^«oo«^•rt^«o»'^*'^•-<'»«^^«'<5"^-"»4^•Olpod«fo^-* 



M ^ 



liliiijiiiiiiiii^aiiiJi:si 




« II . ^ > Q rti »j| 



s 2 ^ r 5 ^ 



J ^ - g * S « -c O • 



J .2 I 



3 3 « 



o 



•3 >» 



3t 

a c 






a 

■g „ 
a I 

s s 

§ i 
IS 

< < 









u 
O 



9 



2 



C 5 

c 

9 

§ g 
•■/ o 

X < 






a 
o> 

« 

C 

s 

JQ 



4» « 

c a 

o o 

■•* ■*■' 

s s . , , . . . 






|^|||5.l?l|lf|llfl||f|! 



S S I t s s s 

ffl « < < o o o 



a a a c 
c t> V $ 

X X tn X 00 



a e e a 
_ . 5 S S 5 

30 00 OQ OQ OQ aO 



a a 

II 

3 i; 

00 00 



CutJssiTisD Civn. List — Statx DsPAKTifKirTs 



129 



9388SSSS388S3S83SSS88838S883888S8SS 



8 



S8 



O 



Oftoooooacoft9)oft0)00)0*o»okoeto>o>o> 



^ tS 3 • S a i -"* -"* 2 2 -^ -^ 2 S 5" 2 - 2 g' Sf 2' S !3" 2 « '^* 2 2 2' 2 2 -*•* 2 2 

^l^^l iH-t^-^-s^l ililllltsl^s ^ ^ § sill? -^ 

285S2S::i:2252228S2§§§SSS2ftt:t:t:i:t:t:222l: 
225122222 22222§|2?2SSSIs§2222222222 

^ d g • a 8 ;: -"* '^' t: 2' a 2* ;; g S 2 ^* 2' S a 2 ^ i 2 « --" 2 2 2 § 5 g 2 -"" 



•-9 «^ 



g 




•i 2 « 2 fi o a 

^ ^ C* « 00 

«-• ^ ^ w ^ 




•o o> ^N 

t-i r^ vii* 00 



I? 












^ 



:5 




•3? S ti a S 




^ 



CQ 



I 



s 




•30 S - 
. ^ Q « 



a 




■• *• l« 

• o a» 


»• 
^ 


J 




t 

•« 




j3 






u 

.d 






»»» 


» 


o. 


» 


* 

■« 

? 


* 


a 


91 




t 




(X 


H» 


§ 


^ 


» 


1 


^ 


k 
^ 


k 
? 


& 


? 


h 
? 


d g 8 

sis 


a 


a 


a 


d 


c 


C 


fi 




a 


a 


a 


o 


ii 


» 


3, 


14 

«4 


5 


V 

«« 




5 




•DAttflOiOCC 




so 4Q OQ CO 00 00 SQ 



•3 

S 

d 
«> 

d 
o 
a 



hi 
o 



^ & 



J< ^ J* ^ J< 

U »« |4 fca »« 

« o c/ a> 01 



M M ^ ^ M 

U U fc. fci u .. 

4J & & 4, •< Q 



^ J< .M 



^ Jtf ^ ^ ^ 

U U «-i (i »- 

uCCuCCCeccCCGoQOoSu36 



180 



Bbfobt of State Civil Service Comassioif 



I 





I 

M 
n 

u 

a 

to 
o 

g 




I 



o 



8888S888888888S88S888S88888 






w w S w 



2222222552222222225552222222 

llg^l^llllllllllllll'llllljl 



l» M (^ f^ - <D 



ID ^ (H 



S^S 



10 (H p4 p4 






II^ISllllllllllllll^llllllI 









.r • ^ n A 



00 :«» **• 







1 



§ 



lil|«i 





I 



Is 



s 









»«' ed H 







naassa 



g 

4 



-'66 




OQ OD 



Classified Civil List — Stats Depabtments 



131 



8888888S8S8888888888888S88 

KwKSSwwwQDwwaDaDaOODODODwwwOOw 



e4 






-«-.-2gj02«-^g«h.5;-^«55g 



eiv-^C^^COiOttfH 



if jgl 



n *^ 



1 s it s g i 31 s -1 9 5^-11111111 



O 



.^ v4 *-i 1-4 f^ 



»« 10 »i« M Oft 



e» o» to M 

^ K ^ ,«• 



lO M to Ol 



g«>r-j5-« 



•H (O d 

eo !-• »M 






lllllllllll 



9 

•< 



&=B 



•^lllllll 






O 




I 



t* ** ^ 00 ? oo 




a 

I 



P o 



S S " 



d H O 




llels 



IIIIIIIIHIIIIIIIIIIIIIIII 




8§ 



O lO 






s s 



o 0» 



s 



CI 



8 S| 



s 



s 






o 

D 



a 
cs 



I e 



II 



00 00 00 OQ OQ X 






132 



Repobt of State Civil Service Comiossion 



a 
o 



a 
6 



SB 

si 

a 

91 



a 




8 - 




I 



z 

o 

H 
^^ 

QQ 



8S8SS8S 



« •-• ^ CO »o 



8 



at 

9 






e» o o) 

•^ "H ^H 

e» o o 









-8 



0» 



•lit 



0)0 

«-^ ^^ »H 

0)0 



p^ O «^ *-) *-t 



fl 






"43 



fl 

I 

i 



a 
3 




fl 
S 

2: 

e 
OS 

d 



I 



5 



£ « 



^ 53 ■< 



o 
o 






•3 

i 

o 



ti 



a . 




i<ad»d 



8888888888888 



S 

ec 



lO 



eor>cot^or«r«eoooeo«r«t^ 

OOOOOOOOftOOtOO^O) 



CO 



73 



^^OOQQ«-4rN^4f^f^^4^4t^ 
OODOOSDOOOO^O^OO ^^ 



PN O «-4 O 



r^ ^ ^ Cj r^ O lO 






H^i 



te c "8 c -a fl 





« 

.c 
a 

«s 

I ^ IS g fe t & 

£ ^ ^ X .fl .c ^ 
a O. a O. A O. £^ 
M f) «9 fS f) «l «S 

*C o o o o o o 
S fl fl fl fl fl fl 

S 5 5 ii ii S 5 

B «0 02 CD CD CD CD 



Classified Civil List — State Dspabtmbhts 



188 



sssss 

n « n « el 



00 N N N n 

mm w m* ^^ w* 

O O O O Ok 



V «-i •-• at <D 



« eo « h. « 

— -• -« ^ ^< 

c o o e e» 

•-«-«■« ^- 

e w s£ » <> 

M ^ e<i o ^ 




Hi .?« 



a<: j- 



I 



OQ 

00 ^ 



- 00 

F »* « 

M to S 





SS88S 



88 



M M M M 04 



CO 










Nov. 23, 1917 
Mar. 31. 1915 
Fab. 12. 1919 
April 6.1915 
May 2.1917 


Feb. 5. 1918 
Fteb. 8, 1916 


Jan. 16.1919 
June 3. 1015 


c 

E 


Ex-offioio. . . . 
Nov. 23. 1917 
Mar. 31. 1915 
Feb. 12. 1919 
April 6.1915 
May 2.1917 


Feb. 5, 1918 
Feb. 3, 1916 


Jan. 16. 1919 
June 3. 1915 




o 



a 
o 



1 


;i 




e 


Q 


E 


& 


6 



1 1 1 

ill 

jii 

e E E e 
6 6 I i g 




2 

OS 




O 

as 



0) 
M 

1 

•3 2 . .3 

c S S •> ^ 
S 5 c M • 



I 



3 fl 

s ^ 

■5' 

- O O 
08 .^ 



mi 



i 




o o 

•o "o •g 
c c o 

♦» ♦* L» 

c c S 

•n -c 5 



>k >t >k >k >> >» 

"w ^ "w "w ^ "O 

(■ fe la »« (• »« 

O O w) C4 S O 
CO fO CI CO fO CO 



<0 <D « 

»>X -^ »i^ 

o o> o> 

w^ r^ r^ 


to CO 00 00 

mm w^ 9^ W^ 

9 o o> e» 

W^ f^ ^* w* 


m m » 

i-4 to ^ 

Pi* 


to to a» fH 

•i^ i-< w 


Mar. 
July 
Mar. 


333|3 


CO e e 

fH .-• ,M 

o o> o» 

f>H ^4 f^ 


CD CO 00 30 

^< ^M ,-i ^H 

9 o> a o 

r^ _4 ^4 1-4 


l-« lO (H 

v>4 


to lO a ^ 
^ ^ « 


Mar. 
July 
Mar. 


July 
July 
July 
May 




OQ 

$ S S ^ (^ ^' 2 




« p5 o o ^ 



8 
S 



h %• 



3 3 



° ^ s 1 1^^ 

O « « « g ^ (H 

'E'Htt 2 S 5 



««! oSoo&t)t> 



184 



BspoBT OF State Civil Sbbvice ComossioM 



1 




^ 8 




S 
•a « 

ll 



I 






o 

H 

GO 

2 



8SSS8SSSSSS 



t^ ao r« 

f^ 1-4 1-4 

Oft O O) 



00 00 (^ 00 

^4 *H ^« ^4 

O* O O Oft 



00 00 00 

v^ 1-4 ^4 



« « 



8*8 



O S O S S 6 S 



«o to <o ;o 



*" *t ^ *• 



c 



^ ii ;i 



r^oor^ooact^ooacoooo 
o»a»o>ooo)ooo>oft 


• 
• 
• 
• 


Oct. 30. 
Mar. 6. 
Oct. 30. 
Mar. G. 
Mar. 6. 
Oct. 30. 
Mar. 6. 
Mar. 6. 
Mar. 6. 
Mar. 6. 


1 







GOGaasaca 

OOOOOOOQO 

J a a 1 1 a a I a 

sssssssss 



a 



E e 

S G 



66666666666 



S 



XMio^iocQonecio 



00 


1^ 


X 


» 


00 


00 


00 


X 


« 


X 


X 


r^ 


w^ 


9^ 


V4 


»ii« 


t^ 


Vii* 


^* 


v4 


*"4 


w^ 




Oft 


Oft 


Oft 


Oft 








Oft 


Oft 


Oft 


Oft 


• 

00 




to' 


v^ 


«4 


• 


»^ 


r^ 


»<5 

^4 


fc.'S 


- 


1 


• 

1 




c 






3 


i 


* 

e 
4 






•c 


1^ 


30 


00 





10 


10 


« 


X 


X 


X 


^4 


^4 


wm 


*H 


t^ 


v4 


r-i 


.-• 


«^ 


.-• 


w* 





Oft 


Oft 

p4 


Oft 




1-1 




Oft 


a 


Oft 


Oft 




•0 


1^ 


•>< 


*^ 


»ii« 
N 


r^ 




** 


*4 




«M 


a 


1 




. 

a 


Nov. 
Dec. 


• 

1 


• 

1 


s 


1 


c 

al 
•-> 



a 







I : 

ft »-'5 



>iro>f2r^!30'-''*'2 



c 
> 



8 -p 






» K -3 






e 

*i 

I. 

e 







c E 

S E g 5 a 0. 5 



Classified Civil lisi — State Depabtmbnts 



185 



8888888888 



^ CO ^ 80 n lO n CO CO CO 



9^ rm 9^ rm ^^ r^ A w^ 

Ok 9 Ob Ok Ok Ok So O 



888 



aoaoaoxi<*QOi<*oo90oo 
OOOkOkOkOOkOkOkOk 


, ao o « 

iM fH P4 

Ok Ok Ok 

• P^ «i4 fH 


April 1, 
May 1, 
Jan. 21, 
July 1 
Deo. 19 
June 20 
Dee. 19 
Feb. 13 
July 1 
July 1 


May 1 

Sept. 21 
June 16 



8888S8SS8S888S8SS 



§§§§§ 



§§ 



8 

O 



M ^ »^ M 01 M CI 




•«Mio<D9«90oaor«r«io^<Dio«MO 

OkOkOiOkOkO«OiOkOkOkOkOkOkOOIflkOk 

»N<0»^fH*JpJfH^|sr|tf©»HfHfHlO«Hi-J 

liijiliiiiiliijjl 

wQDOkOkOkOkOkOkOkCkOkOkOkOkOkOkOk 



*ot>^c«^p^^fHr«c9(o<^^*Hio<^tM 

ra < a. 



I^<« 



lllllllllllllllll 






8^' I 




* t fi S:3 §3 S| 8 






1 



« 



1 

S 



««■«««• «x «s «* .*« 




136 



Rbfobt of State Civil Sebvice Comnssioir 



g 

■a 

i 

s. 

B 

o 
U 



Us 

11 

a 



^ -^ T 



II 



g-8 



J-s g 
i £ d 

s 






o 

H 



S8888888888S8888888888888 
§§§Si§§i§liSSS8888888$i8i 



flkOkO>OkO>OBOO}0>00>0>OkO>0>CiO>0>ObOB0090kA 

TOfH ,.4rN«i^ n<-* CI 



•Q lO (O o <D O 1-4 

** iM »i^ f* 1-4 iM »i^ 

Ok O Ok Ok Ok O) 9 



akoakakak0)ak990)a)0kak0ke>o»o>0kak0kakakakaiak 




liSal|Ss| ^._ , ., 
.; 3 H 6 3 ■< < 3 J s s ' 



«••••••••«•■••• 

• *•■•■•••••■«• 

: j4 : : I I I .' .' .' : : : .' 

.h 

.JOB 

• "S 

:js ::::::::::: : 
:"§:•••::::•::: 



/# 




. I g g t t & 

Z JB jg M ja js ^ 
^' e> A 0. ql c a 



Ifll 



6 « § 6 I I t 

JB JB M M M M ^ 

- ' Cl CL U Pi 








•0 « 00 a 



I t t t t 6 

£ M £ M M M 

c. a a a P. a 

II III 

OB 00 00 00 



Clabsified Civil List ■ — State DBPABiMjatTa 137 

8S88SSS88SSSS3888888S8833SS8SSSS8SSS 



^iiiisiiiiiiiiiJiiiiii^iiiiiip^iiiJii 



iilllJIIItMlli^lillli^JliilliiliSli 



ill 



I 

iiifi I 



JiSlI 






m 






;"l ; 



all «J|35| 






t-l 



illllllllli 



■ ^l 



aa 



III 



11 



; : : ; ; i i i ; i i i ; ; : ; ; n : i ; : i : i i i i i \isi \ \ 
llllllllllllllllllilllllllllllllt?ii 



188 



Beport of State Civil Sekvice Commission 



Q O 

si 



,1' 



g'8 




2 

O 

H 

GO 



8SSS8SS8SS888S88S88S8SS88 



S O 

5 



9 



o e Q Q o 
9 c< 5 5 Q 
Ok OB r« o » 



» to « eo 



« 



§1 



M 



C« 



04 



00 ep «D « 

•-4 O v^ rH 

O) 9 O Ok 



«D r^ (O <D 

f^ O •i* fX 

O Oa Ok 9 



SoooooftOftOio»aia»OkOka58Dak 



1-^ »H « 









o 



llljlllll 



*i > 



lllllllll 



00 



o 

0» 



»r«gr^«^ao«»c«c«s^ 

QOOOwwOOSSaOOkObOOk 



o CO eo 

^« i-^ ^4 
o» a» o 



v-4M)*i4*i4i-l|»0)lO*Hp4*N«i4lOi-l*-l^i-4«^M 



*H lO »^ O -^ 

*^ ^ CO 



M 






liilllliiiliiiiiiliii 




a o 

« 
> 

a 



^11 



Ed 



J4 






^ ^ - -I 1 ^ S Ji 1 1 r^ " 5 II « 






■J u < S 



i 



§ 



«8 ■ - 



" ** ** S * a 

8 a i e e q a 

I -S I 2 2 1 3 



3 



i6 



llllllllllllllllllllllll 



Classified Civil List — State Depabtments 



189 



888S888888888888888888888888888S8888 



o 






S f-4 fH IM Oi4 fH 



eioo<^<^^iOi-4r«o*HO<Hiooioio^ 



ft- 8 



issliisiiijllsiiiitsilll^^iilliss^i 






Q 5 -^ 
S 5 o> 



t^ cj o r* o « ^ 

•X O 1-4 «^ fx A Q 
0> O Ok 9 Oft A O 



M iO ID •H *X *-l r4 



KMiillliJlliililillSliiiiiiiiiiiiii 





s 






imillllllllllllllllliill 



SS2S5SS » 

r" 





140 



BsFOBT or State Civil Sebtios Couuibsioit 




J 



51 

«-8 




I 



o 

H 

S 



888SSSSS8SSSSS8SS8SS8SS88 



S 



S S 8 3 S S 8 

0> 0> 9 O 9 9 Oft 



(O 00 

Oft r« 



8 



'10t;^QOrN.CO^^lO•0'*•OO^OC»OOtO»0«0«CQO^r*•-^ 

^AoaA9>o)aftO)ota}ooo»o)0)0)aftc»o>c)a)ood)i9 



9a)Aoooa»o»o»oo»a»Ofto»aftooo)a»o»ao3oSooS 






O C>« -^ 



04 



o ? o o -a 







«» 5 r* P Ctf . CO "^ 






s si 

11^ 




25 

C O 

II 
11 



.S»Si5.SA^iS»Sj»sJ.SiS»SAAd33 






CLABsmBD CmL List — Statb DBPABTiDBmB 



141 



88 88&88g88888888S88&&5&llJi?5&&&&&&& 

■0 oooooooooooooooo 

y? ^5 ^* ^^ ^H ^"^ p^ f^ ^i4 ^< ^^ ^^ ^"^ •^ <"H ^^ ^>4 



:2:2S:S:2!i^iQ52^2^^-^'^0'58S^ooo-^'^o»^^^»Hr^SS 
2S522S22222S222222222222S22222222S522 

^ - -^ ^ -? -J -^" ^'^ ^' 2f 2f 8 «* 2" S "•■ J: S §f •*" -^ ^ 8 ?f S -"* ''•' c5 S '"'" '^ ^ ^" '•^ 

^li^ist3i^^Ml'l^-^H'3iJ-^i'SMI^N9^i^ 



-25 

» a OB 



at 



o o 



*i4 »i« »i« fii4 



a 



m 



3§|§§ 

r-* ^ r^ 0'4 ¥•4 



2 






OOOOkSAOClA 



a ^ ^ 

1^ r^ 

A O O 

«i4 *i4 (H 

M CI 



•-• ^ «o e« 10 « 
«>4 v^ *i4 «i4 vii* a Q 
o Ok Ok Ok 00 9 



000 

C« 04 



IIIIIII2 




SI 



55 pQ 



I 

i 



n r« »S CO SI (34 S 



it a 









ai I ^' 1 S I S I i I N -^ ■i'i i J 




142 



Repobt of State Civil Sebvics Cohmissioit 



8 






I 



2: 

o 



8SS888S8S88SS8888888888S8 



o w^ m tti to ti n 

^m rm w4 t^ wm ^* ^ 
Oft 9 0» Oft 0> O O 






3 O O ^ ^ O. j« 



lO <-< 00 <o 



M 1-4 90 •H eo •-" 






• • • 

959 



o 



i^%-^-o 



> 

o 






9 

e 

9 



io«o<-4t*aot*QC*o>or«r«»o<o;&ior« 



SSSSoo»akaSSaka»ca2222S2222S222 



M fi^ CO 1-4 « ^ ci 

- - . . ^ 9 







> 



X 

i 

5 



a 

m 




> 



a d 

•s-s 

c e 

"C "C 
vi ^ ii ^ 9i ti 9t 

^ ^ ^ '^ «* 44 «J 

• « ft> « O V ft^ 

>>>>>>> 



Classified Civil List — State Depabtmxnts 



148 



888888S88S8888888888888888888888 8S 






i§ 






SS88 



90 CO 90 



ei c« e>i 



oooaoaoio«oaoooaoao<«»«aooo»«ooaoaoooaooei 






^ ^ O Ob <D »^ •-• 






i^lHlHiHlHlHlHe 



lillJllJiliilJIIIIIIiiiili 



01 ^^ ,^ ^4 iH f-4 9^ 

lllll 11 



coaoaoeo^ooooaooo<«t«»«ao»«aoao 

^^ .^^ ^^ ^^ ^^ ^^ ^^ ^^ ^rf ^^ ^^ ^iri ^rf sirf a^ aari vi4 






X e>i 00 ao oo i^ lO 

^^ ^^ ^4 ^^ ^^ w^ w^ 

OS O) Ok O O Ok Ok 



E 

i 

Q 

s 

o 

£ 

Ik 
O 

k 
o 

M 

s 




• • H ^ • >k 9 S u 



OOI0009 «H*^ 

v^ ^4 *H »M *H CI 



S oo 2 




CD 35 OQ 



-•5 g -3 

^ >< 9 vj «S ^J > S, 



fi s 



8a 
"I 

u GO 

I :; ? I - 






I 



llss 



I 



CQ ^ OQ $ R 



01 W »H 



i 



•8 

' 8 



im 



S 3 ^ 2 



IS 

1.1 



o 



1^ 

s « 

5 6 
a o 



S 



V C b 



V 0; £> ft> 0* ft^ 




i-ai-s.iitt'i'^ 




1 1 



^ 






u 

as 



u 

as 



I 

"Si 

6 

« 



ac^c^c^atxcQunncnu 



IlllllllllllllllllllllimU \ 



144 



RspoBT OF Stats Civil Seryicb Commission 






III 

Hi 



41 
Hi 




I 



o 



888888 



CO 



C4 C* 



8888888888 
888888S8S3 



•-•«e*cie«^^»Hf-i 



88888 

ci ei ^ ^ 



Ct 00 00 00 00 00 

r^ r^ ^^ r^ w^ w^ 

0> 9 0> 9 0> 0> 



0>Q0O0>0>00CbO0>30 



00 '^ O 9 <^ 

^4 w4 ^4 o ■^ 

a> 01 o o» 9 



lO IH iH v-l lO »« 



99*^0*^<^*^«OCOO 



00 <D (O 



(D (O Q (-^ 

.-4 W 



3-g 



a 



>» •«! 






t-* to 1^ ^ 00 00 
^* •^ t-* •^ pi* «^ 

9 9 9 9 9 9 
•^ »^ w^ »^ t-4 wH 



9 



9 9 



M r* CO ^ 



CO 

9 9 9 00 



«^ f-t O 






9 9 v^ O to »^ *^ 



to CO o 



s-^ 



« "* O 9 ■* 
«^ «^ ^4 o •^ 
9 9 9 9 9 



^ to (O c >-* 

.-4 CO 



"<fr. ►^Z 







^ CO 1^ lO J5 

A« w et <o 9 





8§ 

>0 M 



§2^ 31 ? 

^ ►-« »N CO •^ 



o t» r^ ,^ 
»-» lo e«» O 



IT 



. n-< A^ • . a 

llll 



I 


















66€666€6€ 




^6«3 




Classified Civil List — State Defabtmeitts 



8i?l 

sss 

22 



8 






I 



O O 



9 9 



I 
i 

M 

a 
o 

i 






•3 
CE7 




8S 



« 00 

e> ea 



OO 






OO 






00 



so 



5x 

o 

o 



O O 8> Ok 



14& 

S 



!<d to le « 

01 C4 C« 



^ •* -* ^ «o 

v« ^^ >4 «^ _« 

o a» c» a» c» 



iQ iQ lO « 

e« N w 



tf <8 <8 « 



a 



x 

3 



I 









o 
e 



o» 



s 





iiii 




1 



€ 

I 



146 



Bbpobt of State Civil Sekvice Coumissioit 



I 



J 



.1- 

n 

•s-s-l 

8 -8 



III 



I 



« a, 



o 



S88S8 

» • » » • 

iQ e« e« e« e« 



88888888S8SS888S8S8 

§i§§§§i§§ii§§§§§l 



S 

V « « « e« « 



t« t« t« 00 lO 

^rf ^4 ^4 »ii4 ^4 

Ob 8> Ok Ok O 



M CO «H M 

V.4 iH IH »M 

Oft 01 Ob Oft 



CO fc ^ 

^* o ^^ 
01 5 01 



Mtoe^ooei^aoao 

90>90ftOftOIOftOk 



«M »M lO lO (O 



Ob«H<M«HaocOf-iiO*^t« 



•H •i* ^ 04 «^ »^ 



00 <0 v-l »i4 1^ *^ 






s 



»« 1^ t« 00 iQ 

^^ »-< "M w^ t-* 
Oft 01 Oft Ok Ok 



Oft 0» 



§^C0>eOQ0^O^C«00C«^«0(^ 
oooftaftOfta»aooftoaOfta>a>OftOftCft 



IH ^ lO kO « 



k^ • • • 



S£S 



o»OQ«ood^«-ioe«»>^ 



<DOftooo<-ieo^^ 



I 

09 

a 



1 



OS 



U S », S e 







I 



I 



l-F? 1*211 
Nlli Jill 









p^SHa>;4MZ 




11- 



|S5 B 



|_ 



"I- 



s 



.^ ^ 



Hi 



'IJ 




ChABsnnxD Civil List — State DspABTMSirni 



147 



SS88 



M M ^ 






c 

< 









3 



d 

'^ •S ^ 9 



I 
I .'"'^ 

< ^ JS jB 

^ U ^ •-» 



? 



£ 



^ 



M -^ O ^ 

«iM Vrt *4 *i« 

e 9 e o» 

^M «« ^4 ^ 


1^ 1^ r> 

•-4 ^4 ^^ 

O Ok Oft 

«4 1^ v4 


• » • • 

r. 00 « ^ 

M "^ ^^ 


• * * 

c« «o e« 


o o i i 


Oot. 
July 
Oot. 


pj ^ « -* 

«iM «4 *4 ^« 

O ca O 01 

^« v4 <M v« 


»* t* t» 

^^ ^t m4 

Oi Ob Oft 

^4 m4 w^ 


* M • flk 

»«. oe « r^ 

M ^ ^ 


M 00 C« 



I 



ii-i 

AS 




13fc 



JSJJ 







H 



S8 



CO «0 



8S88 
§§§§ 

M * • * 

^ 00 ^ *H 









00 ^ 00 00 

•>4 rH ^4 v4 

Ob a» 01 01 



»M lO to vH 

4<5S3 



1^ t» 

•-4 ^4 

Oi o 



o o 

OS5 



i 



coQ 









00 1^ 00 00 

w^ w* ^* r^ 

Oi Oi 9 01 

<M v4 »i4 *H 

* » • • 
w4 IQ O ^4 



r ♦; ► oS 

*^ o g S 
S 7 eo 1^ 






d 



d d 
«l « <a 2 tf <8 

o> >> 



d 



e 

I 
s 

d 



> 



<d 
<0»iS CO 



s s 



J 




i » o '8 i 
'"S'S'S'5 





tJllll 

Cl <d <d 
. 'a d d 

6666 




SSSS 8 

III § 



e« CO CO 



t« 00 00 r> 

»ii4 »ii4 »i4 »i4 

Ob Oft Oft Oft 

^4 iH v4 *irt 

S • • V 

■e f^ 1-4 e« 



t« 00 oo r> 

'J •M »M 1^ 

9 e> Oft Oft 

v4 «M iH »i4 

- • » » • 

12 ^ »-i e« 



O 

O 



tz: 



II? 



55^ 



9 ,^ 
cq t S I 



Oft 
CO 



uu i 



Oft 
CO 



n I 






S3 



CO « 



I 







148 



Seport of State Civil Service Commibrion 



80 

9 

a 

o 

u 

» 4 

Q 

O 

o 



d 
o 
;s 

I 

s. 

a 
6 



a 

ss 

o. 






J: 55 -a 



g 

2: 



o 



88S88SS88888888888S88SSSS 
88888 



o o r> 

S88 



p e*« 



«D 



e* « ^ M 



CO 



CI 



»^ 


« 


•* 


1^ 


r* 


1^ 


r* 


1^ 


•0 


•0 


» 


1^ 


r* 


»* 


1* 


00 


« 


00 


00 


00 


00 


00 


» 


00 


m 


V4 




•>4 




»-< 


^rf 






w* 


m^ 


9^ 


»^ 


^4 


»ii4 


f-4 


•>4 


v^ 


^4 


VM 


*-4 


>.4 


•M 


w4 


W4 


m^ 






o» 

»4 


f-4 


«-4 




1-^ 


f-4 




a 

»4 


W4 


«-4 




9 

w4 


9 

v4 


9 


9 

^4 


9 


9 

*>4 


9 

*.4 


9 


9 

»4 


9 


9 


9 


• 

•0 


W4 


* 

•0 


• 


S' 


»o 


c« 


oo 


O) 


00 


00 


od 


00 


• 
00 


00 


l»^ 


•O 


9 


9 


»M 


*n 


eo 


iO 


rN 


*^ 


t^ 






^^ 


»i4 


^^ 


r-^ 








^^ 


^4 


»-4 


»ii4 




»-4 


^4 






^^ 


M 


»4 






• 

1 


• 

1 


• 


Oct. 
May 


Oct. 
Oct. 


• 

1 




s 


»-9 


• • • 

o o o 
OOO 


1 


April 
April 
April 


a 


If 


X 

< 


• 

1 


ft 
< 


i 


• 

1 


»^ 


»^ 


^ 


t» 


1^ 


t- 


1^ 


1^ 


00 


oo 


» 


1^ 


1^ 


1^ 


!>. 


00 


00 


« 


« 


« 


00 


00 


00 


00 


00 


V4 


«i4 


9* 


w^ 


vH 


^4 


vH 


vH 


«i4 


V4 


^^ 




^4 


1^ 


v^ 


•^ 


^^ 


^^4 


*-4 


^^ 


^^ 


IH 


V4 


•-4 


^^ 


V4 


o» 


o» 


^4 






•-4 




^4 


^4 


OS 


^4 


^4 


» 9 


9 


9 

*.4 


9 

^4 


9 

»-4 


9 


9 

»ii4 


9 

v4 


9 

»i4 


9 

^4 


9 


f-4 


^' 


•0 


c» 


s 




• 

c« 


^^ 


e> 


00 


• 

oo 


^4 


• 
•-4 


- 


* 

00 

v4 




o 


9 


9 


1^ 


* 


s;' 


IO 

»i4 


*4 


•< 


• 

1 


April 
Deo. 
Oct. 
May 


Oct. 
Oct. 


s? 

s 


«* 

S 


c 


• 


4i 


• 

1 


• 

1 


1 


April 
April 
April 


d 

as 






• 

e 


1 


Sept. 
Nov. 




9 
o 

<8 



> r 



55§ 



OQ 



85 



i& 



s ^ ^ 

>» J ® CD 

U ca . :!i* 

/v, ■** »o 



O 

4J 



^ ^ >; 

... 

CO OQ -^ 
J3 ^ J 

.«^ .^A 4* 



K « ^ 3 -e W 



• 3 ^^ ;s 






^1^ 



e 6 



00 



00 > 




"T3 



o 










% 



2^ 

2 b 



8»5^ 



•9 "S 



1. 

CO >• "^ 



o«&:-< 






8 

1 

o 
a 

I 



J3 



8 8 

s s 
8 8 

6 S 
e o 



8 8 

•2 1 
e c^ 
e d 

§1 

g 6 
e o 



0000 



llliillll 




8 8 8 8 7 
*i e "i 6 'I 

Q C B C O 

o o e o o 
g d g d a 

e « • o o 

§ g i s c 

o o c o 

X X .d X J3- 

^ 6 ^ 6 jr 

a a a if 

o o o S 9 



Classified Civil List — State Depabtmxhtb 



149 



^8S^S 8S8888888888888SSSSS88S88S8S8888 



8 

o 



8 






§1 



«o so 



coaoflOaoooooaoooooooooeooot»r»t»ooaoooo030oo^ooo030ooQOaoaoi^»«t<>r^to»« 






§3||sis|||||ii gsgggg|g|5| 1:2 ji««s|| 



00 00 GO 


00 


00 


00 


00 


00 


CO 


00 


00 


30 


00 


»* 


r* 


1^ 


OO 


00 


X 


00 


00 


00 


!>. 


00 


00 


00 


00 


00 


00 


00 


t- 


1^ 


1^ 


r« 


r« 


t^ 


•^ »i^ 


*>4 


i-« 


«.^ 


^* 


».^ 


»ii< 


^^ 


^4 


^^ 


^4 


^^ 


*>4 


^4 


r^ 


^^ 


^4 


^^ 


f^ 


r^ 


^^ 


V* 




^^ 


1^ 


^^ 


^4 


^^ 


vH 






^^ 


^4 


^4 


t-i 














V4 




*>4 


^4 




o» 

^4 


o» 

^4 




*>4 












o 


•>4 
















9 

^4 


9 

^4 








v4 


00 iQ 


CO 


•o 


*^ 


r^ 


id 


o 


oT 


1^ 


«d 


^ 


PI 


^ 


o 


5P 


e« 


O 


r^ 


ei 


"* 


CI 


• 


oi 


f-4 


"* 


w^ 


r^ 


^^ 


ei 


00 


^4 


to 


* 

lO 


00 


* 




^4 


*^ 






^^ 


•M 










^^ 




^i^ 


M 
























»-• 


1^ 




e« 


^^ 


1^ 




M 


July 
July 
June 


•1 


• • • • 

u « o u 

oooo 


• 

g 


17 

s 




May 
Mar. 


Nov. 
Dec. 


i 


« 

a 
4 


3 


t 


B 
at 


t3 

3S 


• 

a 


• 

1 


• 

a 

OS 
•-> 


April 
Mar. 
Nov. 
April 


• 

.a 


2 


• 

1 




Oct. 
Oct. 


May 

Deo. 



!3 



3-3 £ 



«2i 

•< CO 
«< oS 



8 



npQpQc«eoi>^^n»MSncS'< 



aj 




o 



2^ 

~ _ 

CI -d 

N CO 

fM CI 



IS 



e 8 C ^ d 

i I ^ - I S ?> 
^ >< « CI ffl « O 




a 



« : 

.sla 



s 
>» 




lilij 



s A 



3 

O 






2 

o 

3 



a 
o 

•a 



M 
o 

a 



CQ 






•c ^ < 5 






11 i^ 






•2 -^"^ S 5 



3^ 






•3 



e 



3-S 

-•5 fk, 



3 

a 

•pa ••• 

■§1 







>> a 

JS 

b 8 § 6 .3 8 "^ 
5 S ? o= S 



|i|a| 

Q ^ ff 3 -S 



f 



08 






8 8 8 8 

• P« •*« aprt *«4 

a s 
« » 



o 

3 






^ hi %• I" 



j3 JS JQ 



O O 



^§§888888 

^ B ^ .3 .^ .3 ,« .3 .3 

3 99^03333 

j||111111ifiilllilillfll 



i: i: 1 1: 




160 



Rbfobt of State Civil Sebtice CoMiaesiON 



i 





I 

o 

CO 
CO 

s 
s 

o 
u 

Q 
O 
O 



111 



o 



S8SS8SS8888S8888S88S88S8S8 



SSS8 

ec eo « ^ 



8 



ei 



aoooaoaoaoaoaOQQt«aot«»«i^r«t«t«aoao»ooaoi^ooxxao 



<8 S OS 



<8 



4Ȥ 






4 




3 

d 



a 

9 



1 

JO 



o 

9 

a 



I? 



- S 3 ;= ^ 



GO 






S^s 



o 2 



V 

la. 










75 "cJ "3 




M M tl » 

S S 5 k 
^ ^ ^ S J{ ^ JS 



M M M M 




■• ■« pa •■ 

2255 

O V o o 

3 S 3 S 

• *4 c^a cprt apa • 



«» 41* ^ 41* .*J 

0) V » ft) V 

^ ^ ^ ,i< J« 






as 

s 



0} 0} 

a s 




o 



o o o o o 

3 a a a 

.S 5 ii il ,$ 

GO GO CD CD GC 



"2 'a 



Classihsd Civil List — State Depabtments 151 



88S8888888S8S8888888SS8S88S8S8SSSSS 

§§§§§§SSIiii§§ 



ncoconcococococQco 



aoi^aoooaoaooot»aoaoi^ooaoaox(^aoaoaor«r«i^t«oot«i^i^t«aoaoooaoaoao»« 






liijiiiillllllillliiiiilliiljlllji 

aot«-aoaoooaoaoi^ao«r^ooaoao»r^xoooo»«t«t«i^aoi^iOr«i^aoaoaoiQaooo»« 



^ o 



s2 



«-• «-i »* OP ^ ^ 

M e« v-i M «H 

SS46Z& 










s 

jB 

o 
Z 



e 










5 

9 



a 

J 



i 



t«if B J 



ifl^-snl 



as 



w 3 s cS ^ a I £ s s -< I a 



I 
«» 

a 

o 

>M 
• o 

si 

» 9 






E 

I 

e 

(2 





*m hi 

22 



^ Q> 



U ** U Im 

llllllllll 

,m -s -s -3 -a '3 -a •■« 'S .M s s jg gj m dt iis at ft M <t 



t i; & g & 

JS Ji jG -^ -O 

o 



aacaaaaaa 

O O O P O P p 



152 



HsposT OF State Civil S£rvic£ Commissioit 



■ 



8S8888S88S8888S8888838388 



§§ii§i 

o o o o o o 



t« r^ r^ Ok Ok a »« 






Is 



^S 



1 



8S 



I* 

^ -^ > 

Ml 









I 
o 

CO ] 
CO 

1^ 

s 
s 

o 
oil 

i« 



J 



l;l 






I 



o 



^i^r»r»r»r»t«aoaoaoQOXQOGOt^aor^90QOXi^t^x9ao 

ooooo^ookooiokokooiaokokakaookotooio 

8 li »: ^ « g a 2 s? ^" s -^ *" 2 -"' -"' ^ -^ -^ <3 1: s -'" -^^ ?; 

22222S22*®<»<»®®*®okOkc»oio»okooio> 



a 

3 



gt» r* •H « 
f^ ^ M 



[^ >!» M M >»'£ 



« ^ « 



>k >k 



•c r^ Q ^ to '^ 



>»C 



*-=3??i|j||ii3l|i|||-ii 





a a a a 7 



. . ■ >* kb bk ^ 

, _ fe| ft 8 8 8 I 



% 



iiillliiliillH 



s 



i 

i 



CLAMiriKD Civil List — Statb Depabtmxhtb 



15» 



S 8 8 8 8 S 

§ S S § S I 

4 as as e« o ss 



M 


* 


^4 


^i* 


^^ 


•-< 


N 


ae 


« 


ae 


ae 


00 


9*^ 


w^ 


*■* 


^i4 


^* 


vH 


a 


9 

V4 




e 


o 




of 


« 


r^ 


^ 


oe 


o 


p^ 












• 

1 


s 




• 

1 


• 

c 

as 


• 

«s 


•^ 


•^ 


b 


^ 


^ 


N 


ac 


00 


OD 


OB 


00 


w* 




^^ 




^ 


•-4 


a 




o 




a 

•-4 


v-4 


• 


c« 


^r 


^4 


00 


»o 


*i« 












i 


• 

c 


c 


^ 


• 

c 


(4 


Q 


4? 


^ 


£ 


^ 


:s 





z 
1 f 



> 

a 
a 



U 
c 

2 



e 

s 

c 

OQ 

i 

< 

§ 

PQ 






o 

> 

2 



> 
< 



^ 

S 

M 



a 



CQ 
OQ 

I 

O 



e 



si:: 



7: 

OQ 

s 



a 

£ e 



1 
f 



G 
« 

•S 

il 



JM 

n 



i 4 



g 




CO „ 

O c 

H i 
o 



SS88S8888S8888SSS8 

8888888 



8S 



o 



>oc«eo»-»»^ci^^6i^c»«-ic«c»i-i 



CO c« 



a 


a 


o> 


00 


r» 


o> 


r* 


00 


•«•• 


00 


CO 


r» 


^ 


^ 


o 


o 


r* 


(O 


^< 


94 


94 


t-l 


*■* 


94 


94 


91 


94 


*■* 


94 


94 


94 


94 


^^ 


94 


94 


^i^ 


w4 


9^ 


0» 

t-l 




^4 


o 

94 


94 


94 


94 


94 


94 


0» 

9M 


a» 


1-1 


Ol 

9^ 


o> 

94 


94 


94 


•-< 


^4 


•■4 


^4 


94 


94* 


94 


94 


94 


94 


• 
94 


f-J 


r^ 


9^ 


-■ 


94 


9^ 


9^ 


• 

c 


t 

< 


c 


o < 




"3 


=2 


Sept. 
Dec. 

Sept. 


"3 


Oct. 
Oct. 


c 

eS 
•-> 




•1 




o 


c< 


»1 


00 


r» 


94 


r» 


00 


^ 


00 


CO 


r* 


^ 


"* 


o> 


1^ 


r^ 


CD 


94 


t-l 


^■4 


94 


94 


94 


94 


9M 


94 


94 


94 


94 


9^ 


94 


94 


94 


94 


94 


o 


a 


o> 


o> 


o> 


o> 


o» 


o 


o> 


0» 


o 


o> 


Ol 


a» 


o> 


OS 


a» 


o» 


9^ 


«-4 


•-< 


v4 


94 


94 


94 


94 


94 


94 


94 


»4 


94 


9^ 


1-1 


94 


94 


94 


9^ 


•C 


t-l 


"^ 


94 


9^ 


94 


94 


94 


94 


94 


94 


9^4 


9^ 


9^ 


94 


94 


94 



4 < »o < O^ 



ft & S g-^ 
< oS (% 1^ 






O C 



« ? 



I 



2 • 

<": 

e « 
.a < 

3 e 

^ O O 
tow 

OQ 94 (O 



s ? 



00 oc 



< < 

£ 8 

ae -1 



u 

OO ^ 

a; r 

V a 

1 1 



it 



is 

^ Oi 



^ 6 

- o 

9 



J •» 3 s I 

•< D ca « 



a 

•I 



94 OQ 



r OQ 

c ♦* 

« o 

ID O 

94 94 



. CQ 
^ CQ 









00 o> 
0» CI 



C o> L'a « 
S f-i ^ 



00 







c 
a 



c 
o 
o 

S5S 



ee-ib 



a 
g 

o 

< 



e .- -J 



b ^ 



5 ^ « o £ o 

« S S K * fc 

Oft; 



J ^ eu o ^ i^ 






c ft* i 

c . O 

bcS ^ ^ 

S H4 X4 e 



st 

< OQ 

(<; d 

QQ X 



t 

9 

o 

"I 






I 

a 

-iir 

a 



a' 

•c 



d 

o 

s 

•mm 



a 

d «M 'C^ H 



IS 



V o 



d 



o C *• & 



C «* . iw d © 

o^-i £ g d 

li$l s S is 





d V 
o ^ - •-» 



o 









St!'-''!; 

o- J o »- ® ►: 

♦< O l> O >< Q 

5 2 ? 2 « 2 

^ h^ Pi H4 (M ^4 



»■ U 4J o >« ^ 

o o c 45 a ^ 



154 



KspoBT OF State Civil Service Commissiosv 



CO 

o 

O 

o 



•8-S 



9 9 



I 

si 



g-8 



S 

■I 



i - 

III 



s 

2 



O 

H 



S88S888888 



• 


• • • 

M CO ^ 


• 


01 


• 


^^ 1.^ »H 


00 

o 


^ -^ « 

*ii4 ^4 »M 

o o o 

*i4 »ii4 ^^ 

• » •> 

^4 vH vi^ 


00 

• 


o 
o> 


o 
o 


1, 1918 

1. 1916 

30. 1917 


1 


Nov. 

Oct. 

May 




• 


• 

c 


Aug. 
Sept. 
Sept. 


00 


-* -* «o 

^4 »4 «M 

o o o> 

»ii4 »M 1-4 

i-< f-J i-T 


o 

* 


00 

o 


o 
o 

• 


1. 1018 

1. 1916 

30. 1917 


• 

a 


Nor. 

Oct. 

May 




i 


• 

c 

4 


Aug. 
Sept. 
Sept. 




6v^^S^£f^^ 



o 
t 



t 



I 



a 

o 



a 

o 



a G a 
o o o 



1 1 § 1 



a.2 :'K« tJ 

.? a . «> » ft» 

** Q O ■*• ** *» 

H flj j» atfh JM jn 



«> a» V 



t ^ S b 

8 8 *' 



.o o 



o o o 



«* o ^ & ^ 

^ a S B 8 B B 

ti 4 ^ «S> tS. tS: *»; 

o »3 •»< p p p p 



d JS .S "S 
it *^ <« £ 



£ £ £ 
a a a 



ill3333 



SS 



o» o 



a a 

< < 

o o» 



=2^ 

a. a 

< < 



so 



I 



OQ 



r » 

it 

a 



§1 ^ 



a 



I 



« _ 
S 






Oi 

o 

o 



888888SS8S 



88 

o» ^ 



o 

3 



o o 



ooeioox^oooor^r^i^ 



«0 M 



Sl-I 



ooMoooo<«ao»r^t^i^ 

000900)0000 






IS 



a $ 

< *«: Q 



3 .ft* 



•C ♦• 



III 



OQ 



i 

00 



00 



fi ^ 



O > O 



9 V 

S» 2 : 
* -' ^ c* 

;?: • « S • "^ 

r -S _a « a 

IllScg-oaJs 

^QQ^«5J*iO^^^ 






Ml 

Can'** 









* ^ o pa ^- o 
i-i _] S ^ Oi »j 



s 



6^1 



U 



98 

» 2 ;>, 



\i ^ t 

ja ja M 

o. Q. a 



llll 

n n en OQ 






e 

•o 

a 

Si 




CLASsmBD Civil List — Statx DBPABTUzinB 



155 



SS88 



88 



N N 00 K 

•* " p« *^ 
9 



>t X 



N N ao I* 

•• " »* rt 

o o o o 



III I 



;i 




. 




:£ 




.30 


1 




m 


:-3 ■ 


OB 

• 


;< 


£ 



C O ^ 00 
X O GQ 90 







8 



8 



Oft Ok 




lO 00 
O Oft 



X 00 00 00 

w4 '^ ^ ^ 

O 01 Oi Ok 

•i< w^ •-• ^* 

• • • • 

0> Ob Ob 01 

■<•<•<■< 

00 X 00 00 

•-4 rH rH t-* 

9 0) 

v^ f-4 ^4 ^4 

• • • • 

a» o Oft Ok 

• • • • 

■<<<■< 




zl 



s a s a 

« V v « 



PS 
o 
o 

o 

H 

s 

M o 



O o 



fi 

o 

IN 
fi 



^ OQ X 



Oft 



s 

I* 

Oft 

» 

CO 

If 

a 



9 



i 



(N CO ^ 
O Q «9 



« 

? 



^' ^ oi 



I 






J 



I 



156 



HspoBT OF Stats Civil Service Commissioit 



i 

s 

o 

o 



a 

o 7 i 

Jl 

o 



•s-s-g 

III 

g-8 



fl «Mi a 

Ml 

i( a 

(8 



I 



55 

O 

w 



s § 



o 
o 



%%SSS3SS883§8S8SSSSg 

o 

8 



OPQOPCO^gggggggOgggg 



M 

O 



•O 



•* ■* 



^ ^ IQ ^ ^ 






1^ 


r* 


eo 


^4 


*-4 


w^ 


o 


o 


O 


^4 


W4 


^4 


(O 


«D 


• 
w4 




w4 


^4 


^^ 


^^ 








L^ 


& 




4 


< 


•< 


»o 


f 


CO 


9^*4 


^^ 


^rf 


o> 


o 


o 


t-i 


^4 


*-4 


* 


*-4 






^rt 


■>4 




^ 

^ 


• 

3 



^ 


t^ 


^ 


tf 


1^ 


^ 


r^ 


00 


00 


oe 


» 


o 


»* 


00 


t^ 


00 


1^ 


55 


ei 


1 


•-* 


^im 


•4 


vH 


94 


9^ 


^^ 


94 


94 


m^ 


94 


94 


94 


94 


94 


94 


94 


«i4 










9^4 


94 


t-4 


CD 


94 


94 


94 


0) 

94 


94 


94 


94 


94 


o» 

94 


2 


0» 

«i4 


w4 


94 


9^ 


9 


94 


94 


* 


94 


94 


•• 
94 


94 


9 
94 


9 

00 


94 


S5 


94 


94 


«-4 


94 


9« 


• 

o 

o 


^ 

3 
•^ 


Fob. 
Feb. 


§ 




3 


^ 

•^ 


»-9 




-^ g ti ^ S? 

o O O O 3 


3 


3 


«; «• ^ 


r* 


^ 


•* 


•• 


lO 


•* 


^ 


00 


» 


1^ 


K 


o 


r* 


'^l 


1^ 


X 




e 


e 


-> 


n 






94 


—4 


^^ 


^^ 


r-l 


94 


94 


94 




9i« 




w^ 


94 


r^ 


r^ 


$ 


^S* 


tfi 


o 


a* 


a> 


a» 


Oft 


at 


O) 


o> 


e» 


o 


a» 


o 


o 


0) 


Ci 


«i4 


e> 


Cm 


^^ 


vH 


94 


94 


94 


"-^ 


t-4 


94 


94 


94 


94 


94 


94 


94 


94 


94 


a» 


94 


94 


94 


* 


ifS 




Ok 


m 
94 


94 


94 


_r 


94 


• 


94 


9 
94 


a? 


^ 


• 

1^ 


^ 


• 


9 
94 


• 

on 


9* 


m^ 


N 












•^ 












94 


c< 




94 




CI 




a 


e J9 J9 




>» 

d 


M 


e 


>> 


>l 


• 
4i# 


f 


• 


i 


^ 

-< 


>i 


>k 


3 


ft 


• 


^ 


3 




s 


?? 


7 


s 


3 


3 


O QoS 


3 


3 


s 



>4 03 



U 



E 

H 
N 

H 



55 5 



o 



o 



e 
a . 

aS 

£ to 

. o 

St* 



<8 <l 

JO .C 

^^ 

• • 

OD 00 

5 5.2 

00 CO ^ 

«o ^ IS 



S o 

S3 



o 



& 



CO 

5 






e 



3 s 

: o 



94 CO 



n » 

94 4« 

00 5 
00 



K 



•Q OC 

•^ 94 






.III 

g W 

* _: 
«S5 



c 

as 



CO 
CO 






o . c 
> 15 5 
S62 












85 

•3" 

J3 ^ 



d 
^ 










14 



I 



s u ^ 






«^t§a» 







^ 

«< A 



5 
e.-2 J 



IIJsl^lll 









It 



O i- 



llllf 



H M Q O 







CLAflsmxD Civil List — State Dxpabxubnts 



167 



S88S88888 8SS8 88SSSSSSS8SS8SSS8S88 8S 



!§§§§§§§§§§§§ 



§§ 



8 



eic«e«c«c«*^e««^«HC4r^coeoet«HM»ieie«ei^ei»M*.4.M«H«H^.Mr-i^'«H^^^ 



22 — S2 — 222255S®*'*"*'******»'******«**'^««««»»ooooa» 
22S5s2322222225®o»o»2*«*2«*«*5*o»o»*o»o»o5a«o>»ai 



v4 iM »ii4 04 e| «D 



^ . 

22222222222222222222222222222222222 
^' • 2 2 ?5 2 '•' -' •"* •"■ ^' ^ a 2 2 '^" 8 *"' -"' ''" 2 8 S --" 2 2 S '^* 2 -"" •"" -^^ 2 -^^ 2* 




a 



I 



S 5 

JQ 5 



CS 5 tf • 

5 J5^-<l J:S 






CO lO ^ 5^ QO 

•N r>. o ^. ?o 

CO to f-4 M CO 




5® _ 

*< r^ 5 

« S W ►J 4 K 2 (S S 3 « 







il||||-alli|-i| 

■ S '^ 3 s M S S ^'.S o oo© 
'^•?3!2!25 2*© ©'o'o'o'o 

■ fe i fe i "S te fe *S *? c c c C a 



168 



Repobt of State Civil Service Couiossion 



i 

& 



1^ 

111 

^11 



•g -9 -e 

8" 




o 

H 



%8SSSS8SSSSS8SSSS8SSS888S8S 



8 



§i§ 



§§§g§ 






oor«ao^•aoaor«l^l^r«^•a»ao^•l^(Daoaoao<#^2aeaoaox3oao 

iiiiiiiiiiijiilil iiiiiiiiii 



i-t 1-1 g ^ CO « 



|«> lO lO 



go^-^-«^^-.g-.-.2^«g2 



N ^ 



iijiijllliiiiiiiiiiiiiiiiii 




#3 . >t 

^* ffl "^ r "^ "-• r r 




:5 I & 
:a J J 1 

^ OQ do g 
fi^ ^ C4 04 



3 



* • *^ . - 

:jE I I.n S2| fr| • : : : : 



|llsE6l£38llJJgl- 



^ I JS « I * 



J 

o 



,8 U .5 

CD _ ♦* 






c 

t 

o 



I 







Classified Civil List — State Depabtmsnts 



159 



S888888 8 88SS8 8 88SSS88S8SS8SS88 88 8S88 
§iSSSiSS^iiSS88888S8iSi8SS8S8§3SSS8S 



ar*»N»«oot«r<»<# 


1918 
1918 


^ o ^ 

9^ w4 w^ 

a* a* a* 

^.4^.4^.4 


1915 
1914 


1910 
1918 


1915 
1914 


<# t* 00 00 

Vi^ wM ^ ^14 

Oft o o o 

,-4 1-4 1-4 ^4 


r* ■* 1* 

m4 9^ w^ 

Oft Oft Oft 

*i4 iH »M 


r* «# «# 

v4 *i4 Vi4 

Oft 0» 0» 

w* 9^ w4 


1917 
1914 


00 1^ ^ 

^m w^ w^ 

Oft O Oft 

v4 v4 *i4 


1* 

1-4 

2 


• • • • • 

-« -4 » « 

'4 w^ m4 


s2«a 




-^ » 2 


• • 

^ Ok 


-s 


-^s 


«^«g5 


w* w^ fO 

1-4 


(D CO «^ 


-^"o 

t.4 


a^-^ 


^ 


urn 


• 
• • • ^ 

40055 


July 
July 


Aug. 
May 

Aug. 


May 
Mar. 


Jan. 
Sept. 


May 

Oct. 

Aug. 

Deo. 

Deo. 

Dec. 


Aug. 
Deo. 
Oct. 


Feb. 
Aug. 
Nov. 


July 
Aug. 


July 
Aug. 
July 


• 

3 


»r» 00 r« <0 

e o S 3 5 


00 r« r« M 

*>4 *i4 -rf O 

Ok o» o S 

,-4 ,-4 «.« ^4 


^ o 

22 


*i4 a ^^ 
«.« 5 «M 

aa S e» 

^.4 »i^ ^4 


Oft Oft 

w4 r-4 


1910 
1918 


^ r-4 

Oft Oft 


<# r« 30 30 

.■4 Vi4 ^14 *i4 

Oft O Oft Ok 

,H fM ^4 ^4 


^ « r* 

v4 -rf v4 

Oft Oft Oft 

iH ^4 tii^ 


r* «# «# 

9^ r-^ w* 
Oft Oft Oft 

»M ^4 iM 


1* «# 

Oft Oft 


00 c« ■« 

W4 W4 v4 

Oft O Oft 

1-4 «M ,-4 


Oft 

^4 


• * » • * 


S 2 "^ gf 


rC c« 


» • * 
1^ *i4 *i4 


^4 


^'^ 


-^ 


« ^- g- gj 


SJ S 2 


• • • 

to CO "^ 

9-4 


-Jo 


g^'-^" 


s 


Nov. 
July 
Deo. 
Nov. 


Jan. 
Oct. 
Oct. 
Oei. 


Jan. 
Nov. 


July 
Aug. 
Aug. 


May 
Mar. 


Jan. 
Sept. 


Jan. 
Oct. 


Aug. 
Deo. 
Deo. 
Deo. 


May 

Oct. 
Oct. 


Feb. 
Aug. 
Nov. 


July 
Aug. 


3 5 3 

*^ *< •-» 


1 



g 



il 



S822 



il 



a 
>k 

3 

§ 
PQ 

rft4 
;S$ a 

o 8 >, 



2? >» 



8 



I 






J 









iJ 3 5 g ;t( - ^ 

9 .s •3 -a <B .»»'*o 




«0 «f 

CO *^ 




r a « 3 3 3 :§ 

OQ .d 5 r - . . 



^ S 2 S 

I* © 'r CO 
(D fh Oft ^ 



»^ 9 {^ 

25 R S 



J 3 ^ ^ ^ ^ >f 

-I 

f.4Cia'^.4N«0iaxooaftO 

§S§!$S8^$si2 




a 



^ii 



s 



IP si s 11 II nil II I illjIJIiliJS 





O 







m a a 

QQ QQ QQ 




9 V 



•§. "Sb "a "S "S "Si "S^ ^ a 6. a ft d^ 'fi. & 'a 6 "S. ft 

»if9»llllllllll|llllllll 

aQaooQaQaQaDaQaQaQaQaQaQOQCQaQaQCQmaiivi^QiTn 



160 



BspoRT OF State Civil Service Commis6ion 



a 

o 



a 

o 



f3 

2-2 
* I 



2-3 



3 

IS 

T 

o 

H 

a 
*^ 




55 

O 



CQ 

o 



SS888SS838883SS8S833S83333 

§iii§iiii§§§|SiiSSi|SSi3S3 



f-t OJ »^ pM v>« wM 



rn- ^- a ^- ^- gb ^ ^ ^ g ^- g o lo 2 » eo g -4 rJ jo ^ V ►-* ;2 2 

iiil^|3|i«lii3||iijg^sl|ii 






- -" 2 -" -■ S5 - • 8 8" ft S 2" «»" 2 S "' g -' ►-■ 2" "* • 2" 2" -" 



&» 

i" 



^.1 



4 












£< 



? 

2 



1 <B 






§ 



> 
< 



O to « 

«-t ^ « 



Ok 



■ (3 

JUS 
"'III 

•2 T Ol « lO lO 

H t-« ^ ^ eo •>* 



S 



O 

O 










iffl 






l§|f||ll««5lsll|ii| 






6 ;; ^ 6 



c fi e 8 
2; «i S £ 
« OD OD S 



"3 

a 

a 
X 
a. 

c 






6-S 



I 







a 



Jl J< Jl JH Jl 



i^maa 



Classified Civil List — State Departments 



161 



SS88 88883888S8SS888SS8S88SS83S88388 
liSl §lSSSSSSSS5SS8SS^S8g88S 

09»3» 030ooaoooooooobQOr^t^h>h>i^r«t«tO(DO«oSo 



8 



8? 

O C8 



s 

CO 



to n eo fi 

^* m^ m* 9^ 

Ck o Ok o 

»* »i< tH »< 
r4 O ^ ^ 

►» * < »n 




fMQOtD«M^H*HO<^r)»MO«-tio^cit^(Ot^'^fMi>^OOa)»cco^4eo 
•-9 •-9 "n » •-9 



-^ t* « 



t% n n to 

•H ^^ •-» ^^ 

ck a » a» 



o>ckoi9oioc9ooke»ooioiotooo>OkaeootooakA0)e>aa»0»a 



>t >• •e 




g|3 3 







c 



^ ^ 



^ ^ J4 






tJgj^JJJj »•« v^^ 6dq3-2 



Jtf 4d ^ J4 J4 J4 

U h ». h 

Si Ji Ji ^ 
t 13 "o "o 

oooocoooooS 

_ -^ ■*« -iM '^^ •-« •-« •-« -*» •*« aff^ •«« 

sccsaaacq 

3S333dS3 



9 
QQ 



> 

i 

la 



163 



Rbfobt of State Crvn. Sbbyicb Cosoobsioit 



i 

o 

g 

M 



I 




ill 

8-8 



8 « 

I "Si 

•a § J 



I 



-s 



o 

H 



S8SSSSSS88SSSSS8S|SSS88S888 
S8s6aDS8S88888SS88 &§§§§§§§&& 

^^O*scoc4eocococ4eoco 



'J* ^ •* 



r« 00 


« oo 


00 00 

O 0) 


00 00 00 A 

tii^ f>H Vi^ 6 

a» o Ok S 

^ ^ ^ ,H 


00 00 00 00 X 

*H wM ^H ^H rH 

o o o> o o> 

*H ^4 1-4 ^4 ^ 


00 10 

^H 1-4 

O Ok 

*H ^14 


Ok 


Ok 


f.4 1-4 

Ok 9 


Ok Ok 


c» ^ ^ 

1^ 1-4 Wi4 
O Ok Ok 

P* ^4 »H 


1* 

Ok 


^4 




e* w 


• • • • 


^ ci ri *6 ci 
N iM ^ 




• 

iO 

1-4 


S 


Ok ^ 


ri4 w^ 


«>4 f-« lO 

IH »-4 




Dec. 
Aug. 


£ "n 


II 


llll 


III II 


At 


• 

s 


1 




n 


4SS 


•1 


(D 00 


00 00 

^4 ^4 


00 00 

^4 1-4 


(D 00 00 a 

*H tii^ Vi^ Q 

O O Ok o 

^ ^ f.^ ^ 


00 00 00 00 00 

^^ 9^ r* w^ r^ 

O Ok Oft O 0) 

*^ *i4 »M ^4 *H 


00 <♦ 
oa 0» 

^4 ^4 


ri4 

O) 


(D 

*i4 

Ok 


1* •* 

Ok Ok 


Ok Ok 


» ^ ^ 

*>4 *i4 ^4 

Ok Ok o 

1-4^1-4 


Ok 


S2 




M 8 


» » • • 


^' 91 #4 w) a» 

el ^ »i^ 


O «D 


lO 


i 


Ok ^ 


^4 ^4 


« ^ lO 

Vi4 W4 ^H 


• 
^4 


• • 

-<< 


(^ "^ 


11 


llll 




u 


1 


i 




ss 


Iss 






•I I 111 





a 
o 

X 8.8.1'! 

>* >> ^ j> jS ^ ,i, ^ 



Classified Civil List — State Depabtments 



168 



SS8888S8888SSS88SSSS8888SS 

SS§iSSS§SS8SS§s§§§Siiiili§ 



n io n 10 C9 CO CO 



8S888888 



" M rrn ^^ w^ ^ w^ t^ ^ (^ «M w* «H w* *^ w* ^ ^ ^ '^ ^ ^ r^ **4 *^ ^ 



•"Of^^ecoio vHti^to 



fe8'"j:'^a; 



^^r^iQtOiOCO^ 



lO to lO CO ^ U) (O 



S b 

<0 






** ^ fi4 9^ ^4 v4 ^i4 v4 v^ ^4 f^ 9^ v^ ^4 Vi4 9^ ^4 v^ ^^ ^4 ^ ^^ ^4 ^^ ^^ f^ 



^•^ Si 



^ lO 







lst>9 s s 






a t! 



'£ > ^ ^ 



>» >t >> >t Q M >t^ 

3 d 3 3 J ^3 ft 



w^ w* C^ m* w* V^ 



>t >i 



^^^ K 



2»^-r»i» d M >» >i 











e 

e 

« 
s 



aeasaeoH 

•S -9 •§ -a .g .s .9 ' 






3 
- tf 



<S 00 00 C& 00 S SS 



i1 

I I a c S -3 S -3 £ 



164 



RspoKT or Statb Civil Sebvice Coioossioh 



S88S8S838SS383g8S38888888S88 

i§gg§g§§§§§§§l§§»§§§i§iSSISi 



ao(DaooDaol^^•|^^»aDa0aDaoao^»^•^•^•r«iO■8socfoao>*■B^*B 



W4 r-t ^ ^ tti 










» H a; S cQ S a: 



s a a c 

iill 

1111 

°s '§ 3 °a 

J3 M Jl M 

h h f* f* 




liii? g gfl 



• *■■■ ••••• ••■• 

lllll^lllllll : 
. . SaSBSSSSBSS ^ 



Claabipied Cnrii/ List — State Depabtmxnib 

8SSSSS S SSS.8S S 



165 



^ CQ CO C^ CO ^ O 

^' ^^ w^ r^ m* 9^ 1^ 

O O O OV C^ O Oft 

r^ m* ^^ v^ w^ w^ w^ 

r* fc" 5r f* f* o N 

M d 94 04 M •-< esi 

e d e d e 8 c 

« 3 S 3 3 ^ OS 

•^ •-» "-s •-» "n «< •-» 



^M» CO CO CO CO ^ o 

^^ ^m ^^ ^< ^^ rm pm^ 

O C) Oft o o o o 



•i t" fc ►* t" o ** 

;? •« ^* M N •-' M 



e« 



« c o 



3d c 
3 3 3 3 *J 
►» ^ "^ "^ •-» * *^ 



s 

3 



u 

o S 
o 8 

s » 

i 

n ^ 




^ lO 00 Q 9 

— ^ CI « -2 

<o ^ ^ ^ n 



S 



.e 

as « 

•3 

80S 



5 !!^ fl 



a .= 
o n 

O *. „ 

b® I 
g|| 

S ^ H>« 



d 
c 



o 



M 

O 
b 

cS 



.is 

i 

a 



llllll 

lliiii 

ssasas 



M 



^ ^ CO CO CO 



8888888888 



Oft 



-J! 






a 



h» OB 00 O lO CO 

,-^ W^ W^ •<* *^ IPi* 

Oft O Oft Oft O Oft 



^■* r^ ^-t n '^ 
*- >k • •? ♦* 

»^ ►^ O < ol 



e 

fiEi 



>QC9ae>o«?io*Qr«(oe4 

S0»*0»«^0»flft»^»^-^ 
OOOftQOOtOQOOftOftO 



^Mv^v4*Hvi4^4^«(0^«^4 



d a S a .^ 

^ OQ ^ •-» ** 



i 



e eS 



^5 



^ »o 



Oft 






WI4 <0 h» ^^ ^ 



>» >. 



li >> 



s s (5 1 « 



I 






! 

s 



« * 

a** 

CO S 



•T3 

c 






r 
I 

o 
d 



a 
S 

•a 



9:3 



« * 









o 



14 



^ - - 1 :^ 5 
j,;0 



OftOCftOft^OOOC*^ 
OOQOQCOOOCOQOOftOiOft 



^ • • • • • *• *> ^ 

daedt;Qfla.So 






S 

m 

o 



m 



3 
& 



'^ «* ■*> 

3 3 3 

ft a Qi 

•> e c 



i 



11 



5 



« (Ex Q Q(B 



:3 
1 

• d d' d d d 

3 ••4 ••* 'P* ••* ••< 
3 3 J5 5. ^ .-.-.- 
eaaaaaMQ&M 
3«o8cs««ddddd 



S 8 S 
8 8 S 



•E 

8 



«• «0 «« *« 4* 

mil 

W b ki b k 

I S I 8 

d c d 



166 



Eeport of State Civil Service Commission 



g 

-a 



e 
6 



30 
- -5 


a 



cS 



^|8 



£ 

-si 

•9 O 



8.9 c 

.11 -^ *5 



i 

2: 



2: 

o 

CO 

£ 



88SS8SS §i8S S8SS8 



(0 0> 9 00 90 

a ^14 v4 r^ 1-4 (-^ *>4 
OD Oft Oft 0> Oft 9 0> 

^4 r^ »•« v4 r^ *>4 ^H 


QO 00 30 Oft 

^4 ^4 v4 *H 

Oft Oft Oft 

r^ ^4 *>4 r^ 


00 Oft Oft 1^ 1^ 

V4 ^4 V4 v4 *>4 

Oft Oft Oft Oft 9 

(.4 r^ Vi4 *>4 v4 


^ 30 « 


CD ^ ^ 

rH *>4 




Sept. 

Aug. 

Feb. 

Jan. 

Feb. 

Dec. 

Aug. 


Dec. 
July 
Nov. 
Feb. 


July 

Mar. 

Mar. 

Jan. 

Nov. 


a a O) Oft 00 ^ 

A ^4 ^^ «^ ^4 "^ 

00 Oft O) Cft 0> 


00 esi X Oft 

t~i t-^ r^ f* 

Oft Oft Oft Oft 

*H W4 (^ *>4 


1^ o> Oft b> r« 

Oft Oft Oft Oft 



^^ »M Q ^H O CO 

C5 ft ^ 



■-H O «0 (^ 



O CO «o ^ 



- o O u 




n b i: « > 




e 

c a •© 
^5 j<' 2 2 ^ 

c ^ JJ ♦* 

^ % n Oft 



09 



^ 

s 




S8888 



n n a e* 7i 



^ 00 CC ^ X 

^* ^* »-< ^< ^^ 

Oft O) a o o 

^* ^^ »* •i.* Pii* 

CO C3 CO *>4^ *.< 

•i* ^^ "^ 

•n Sc ^ ^ ^ 

^ X ?0 « >-'5 

Wi4 ^« ^M ffri ^4 

Oft Oft Oft Oft 9 

^i« "^ ^* *i^ ^* 

CO CO* CO •-* V 

fM *« *i4 « 

i-« eb« S S »> 






I 

-a 









5 

•< 



< 



c 






S=a.s 

lljil 

'^ * ^ g » 






it 



e 



a 

•a 



I -is* 

§"2 

2 0; 




d t t t t 

i g ^ - ^ 

S S^ is S 1^ 




B o 6 a & £ S 

g« « 4 S C S 

^ mt H 0m m^ ^m 

5 e e .= .5 .s 

& ft I £ § i g 

£;>,&,£ 63 ^ ;i3 



i 

8 
I 

"o 

« 
1 

c 



cJ s c c 

w 39 eS eS 

.5 s c a 

^ 9 t t 

*■ aMW •*« •■« 



c e a a 

eS eS *8 8 

S £ B 6 

£ fc £ £ 

••* ••* •f* wp* 

U4 »&i [i« Pm 



2 

c» 

.0 



^ k W 

^ 8 S 

e o c - 

Jill 

J ^ s e "a 

1 2? t ^ ° .2 



O ^ A> C' "O 

5 -c .c »i 



Qoo 



Ci.AS8tFiEi> Civil List — State Difastmbhts • II 

883SSS 8SSS8SSSSS8SS8S8SSSSS8SSSSS8 
mitt §§§Sigi§§§§§§|§§i§§§g§§|§§§§ 



iiiiii 


223S22S222SS22SS222222222222 


mm 


miminmnimmmiii 


iiiiii 


iiiiiiiiliiiiiliiiiiiiliiiii 



iiiiii iiliUmUUiiiiiiiiiiiikii 



%"■ 



*ei2* f m^"m«*o»^w 



SZ53 £ i£ 



5§ii?53§ 



liJ 



illilsH li!^! 



I uta Q* 



a H Xa 






i3-:3iiiJI«iii 



III 



illllfi 



Ili||il3l|!!|jll||lil 11 |illi!t-:-;si 



168 



Bbfobt of Statb Civil. Skbvicx Cosoobsioh 






o 



o 

u 

o 



I 

o 

a 

a 




^ 8 



111 






2: 

o 

H 

00 

s 



S88 88888888888888888 
^%^ SSSSSg^S8888888S8 

i^ • » « « • » . 



OO 00 oo 

*^ ^^ l>4 

a» o O) 

^4 t.^ l>4 


00 00 


oo OC- 00 

f^ ,^ w^ 

O 0) o 

^^ w^ wM 




lO 00 

o» oa 


a* 


IOOOOC40000C900 

ooooecioofto 


May 16 
June 16 
Sept. 27 


Feb. 16. 
Oct. 1, 


May 1, 
May 16 
June 16 


i 


July 1. 
Jan. 1, 


• 


t^Wi-iCM«00««-" 

>» ^ > > fci >»T >» 

5 O 55 2: -«} 4 -< -^ 


00 00 00 

^1^ r^ t^ 

0> O Ok 

1-4 *H f.^ 


00 00 


00 00 00 

^t w^ w^ 

a» a» o> 
»4 *i^ «-* 




•O 00 

f<« 1-4 


M 

O 

r^ 


IOOOOMOO«C4'4* 
OOOOClAOlOtO 


May 16, 
June 16 
Sept. 27 


Fob. 16 
Oct. 1, 
May 1 
May 16 
Juue 16 


1 


July 1 
Jan. 1 


• 


r«eo«-*c«(Oaocoo 
•3 o o o 5-3 a-g 




c 
C3 '-»'-» O 



s a e c 





.9 



- « « « 

Bc« A« ft« &4 



c a |g 

s 



o 
o 



Classified Civil List — Statb DEPABTiotirrB 



169 



S8SS8SSSSSSSS 
888888SS8S8SS 



«ee<)«iOiOio»-ie4co^iOC4co 



S8SSS8838888888SS8 



o 

o 



8SS 

o 00 00 



eoeoeoeoeoeoc4e>i 






■^ao^i^ae»H«on^ 



s^ 



•^ 00 -^ 
CI 






C<-««i4t^g0*ii4(O{«} 



s«:: j; 



^^^ 



*^ « -^ 



s^imilfllll 



n 













sa 
O 



'I 



s 









£ n; ts £ n « > .^ ^ S S ci » ^ ;! 



mr«te^aoeococQeocot*>r^h»r>«i^i^i»r« 



N 



C4 



• ^ k^ ^ • ^ . ^ -^ '^ ••• '^ ■•• ••« ••• •»• 



eo ^ r* 

•- Q OJ 
Ok o 00 



•0 CJ CO 

•H »-< »^ 

0> Ok Oft 



SCO lO 

o» S S 



ni-4aDeQtMC<)c9aoo»Hr>e4r«co^(0^^ 



C4 



C« C4 r^ ^ 






tj S'i 2 i. 




w'^ JCtt 



e 
t 




H«0 




2 >» >» >» 

h* 4J ^ .4^ 

^ a a a 

g -O -O -O 

S s £ e 

X ic fc ^ 

«M tatf tM «M 

o o o o 
>? 8 8 g 8 




i%i 



k k 14 



23333 

^. ^ «• «2 «• 

S 6 S S g 

^ "^j ^ 73 "^ 
• <a (o VI <I3 

'8 C C d fl 

4<3<3aa 



s«s8S}888S8-*'-**-**-*' 

•| -rft 111 if -III li 




V « 



(3 

1 3 : 



§ 



a 
o 



e 
o 



o 



« « V 



a 
o 



a 

o 



a 
o 



15 3 *■ '5 'S '2 o 5 o o 

-J- -^ -^ -^ •^ •»* •IJ 'H •£< 'p aM ••« ••■ ••« 

SiSiSSSiSSiSfifillll 



170 



Kepokt of State Civil Service Commission 



i 

6 



3'^ 



«g.9 
X fS 



11 



|8 

III 




s 

2: 



2 

o 

H 



88888 888888888S888SS8S888 

S S S o o 

00 00 00 »5 S 



iO o o o 



s 



<p d 3 
9 9 o 



M M M C4 M 



C4 ^4 (14 «H *H 



Oi O) Ot Ok O) 



090i00>0i0ft0ft0>0>0ft0ft0ft0>0ft 



O 8> O Ot 



a a a o. a 




3 



009 oo9>d>ooooftoo)Ofto>a»a»ooftAOO>oao) 



K « •-• 



^ 



•H ^^ 1^ 



C: 2 8 8 55 -^ « 8 S S5 2 



1^1-^1 ||-&ii*£*&f&|il|lli^l^| 



«0 00 N fc 




a 
cs 

< 



6 i ': isl 



8l 




u 
> 

■ 
91 

o 



S S B I ^ I 



|S 



OS OS 



«4 ■ ■• 



:i^ 



c 
o 



"I 

Id 



pa 

"5 

o 



♦ 1 

»2 



e9 
A 

•H 

cS 

o 



e 

A 

Q 
S 



•g 



s 

s 

J 

•n "^ O 



c 



9) 9 M 



if 






& 



o 
E 

£ 
« 



2 £ 
•J 






o S a rs -^ CQ 
« «» cs c 

o S > << c: ck< 



.2 CO 



h k w u b ^ 

$ S & S S V 

e a c e e g 

•a -a -a -a -a -a 

d a c e d a 

« ft) V O & 0) 



.3 



g d d d a d 

3 3 5555 




20 o o e o 
d S e d d d 

OQ 00 QQ QQ oS oS 



M M tl M 

d " d 

c •£ -c "C 

t S i t S 
d d d e 

'5 'a 'a 'a 



s S £ i § S 

a d d d c3 c 

a 'a 'a 



o d d ~ — — 

a 'a 'a -a -a -a * 



rdddddddddodsad 



Classified Civil List — State Defabtmentb 



171 



SSSSgSSSSS8S88S888888383888888888SS8 









^ X ^ 

a CI o. 
< -< •< 









ra 



>> >-t'Cz 2?> >x^S>»>» 






« r^ »^ 






■si 

> 



c 



.3 ^ 
a 



•I 



C B H «M *^ M ^ G «a 




S 



■2 

i 








^ E 






4 i'^S-i-i >,o 










J J .5 .S J» .9 .9 

iiislis 




e 



: c e e e a 

j &) b: S S H » 





b t, l« u 

O O O O 

> 3e > > 

bS M M 6C 

sac 

c c c 

£ t ^ 

S.S.? 

» 6t - 



9p« g ?s I 

• «• •>■ **4 ViiJ ap^ 'i^ v^ k k fta ft« Im 




003000CC0 
^^•(>>>>>> 

MMMMMMbCbCtA 

cdcaeccsq 

• v« .«i« mmm •«« •f4 ••< "^ •^ •^ 

•Q -5 -a -a -a -a •§ -a -a 



o o o o o o o 



o o o o o o 



COO 



d d c d d d 



OOOQOOOpOOCO 

a a a s as^^'&^^i 



172 



Repokt of State Civil Service Commission 



«5^ 

i 

8 



i 

CO 

a 

o 

I 

o 
S 



B 
o 

O 






si 
IS 

a 



s 1 « 



- » B 



:s - 



1 



^ 



888S8888888S88 8 8 8888SS8SS8 
SSSSS33SSSS8888S88 



M Ol CM 



8 






t» CM lO 
CM 



>• S _ 

o S, a 



*rt •#■ ■-* "^ ^ ••* ••* -•* ••• •** aP* 'Ci* .i^ •** •*< ••* •#■ -f* »^ '^ 'J^ *7* M 

o a Bi a a Si a«2 aaacsiaaQiC.aaaaaaaac.3 
c90oo^cMgo^^cl^*^>o^•ol^c4cocMco^«o^»ocMaoo30^o 



eoaioOQOeM^o^^<030 

»"< CM •-« •-« CM — ■ 



CM "^ iH 1-1 fM « 



i-i CM ^ 






3 







a 
J 
« 

00 

a hi 
00 c: 2: 



a 



1 



S 8 I « W ^ .1 



5J! J J J 

III si 
> » > > > 

•*« •«« '^ •#« ««« 

8 S S S S 

g q a a ' 




en 

a 

a 



I -a 
ss 

■g'S 
8 S 



•2-3 

o 



o o 



a 



3 



0) V 0) 



o o o o o 




-a 'd M *a 'Q 'I *a 'i 'i *i *& a a -| & 
3S 5 as a3 ^ s SS5S ss 

.9 J9 .a J3 .a ii .a ^ js J| .5 .3 

3SHI!l1n 



■s -s -d "S -3 -3 

111111 



b l« 



OOQQQQOQOQOQO 

•<| aP^ •«4 •*■■ c^ «M •«« •*« •»« •#« •«« •«« •«« 

iiisiliss §ssl 



.s 



CLAfiBIFIBQ ClVU. LlST StATB DBFASTlCBim 



S883S3gS3SSa338333S3333S8888SggS8SSS 

siiipsiiiiiiiiiiiiiiiipiip.isiip.i 


iiiiiiiiiiiiiiiiiiiiiiiiiliiiiiiiiii 

vrnmrmmimuimimimm 


iiiiiiiiiiiiiiiiiliiiiiillillilliiii 



miiilliilliiiiiililiiJiiiilillilil 



m 

«»'-, 



iliiililli Itiliii 



ill 



II 



i| 



il|2|||i5a|j|l|| 




llllllllllllllllllllllllllllllllllli 

llllllllllillillilillllilliiiilliill 

lllilllllJilllllllllliHIHiJHlllii 



174 



Beport of State Civil Sebvice Commission 



5 8'^ 

n 



|8 

•^ .5 'c* 
O "* > 

II 



8 -8 



8 



I 



** •• S 



I 



2: 
o 

H 
oo 

2 



S S8SSS8S88SS888SSS8S888S3 

f 999933300000 



s 



V O 9 
lO to lO kO 



s 






O Oft O O O O Oft Oi O O Oi O O Oft Oft Oft Oft Oft Oft Oft Oft Oft Oft Si 



rs 



i 111 sillillliils §.&g §.g| &S.S. 

Q ^ <; Q fi Q ^ ^ Q ^ ^ ^ Q Q << Q << << Q << Q Q << < << 



it 



^ OO^r^i^qoooDco'^eo 

A ^^^i^vi^QOO'^O'H'^i^ 

O OftOftOftOftOft^OftOftOftOtOft 



«0q0l«>l^OOt«O«t<'«f 
i-^ooQ'^'^9'^'^'^ 

Oft^wftOftOOtOftOftflftO 



9 

-< 



Oft9^^ieoco<o^i^^eo^0ft0a»^^io^i-49«^«o 
« aSo-gag-a-g sg O'0i29'»»2 o-s^S 5-3 »9' 




« 

> 



i 






i _. 

J< ^ fe 



98 

3 



2 o 






§1 • 



I ^ I ♦• 



9 



JO . 

'3 c > 



♦ 

IS 

c O J 
2? • J "u 



00 o 






JM 

i 

- - o 

.^ a .2 

^ i s 

•-ft "-ft w 



•| 'I 'I •& •& '& "I « *S ^ ^ gf - 

llllllll 
lliiil " 

Is 



h h k W M •■ M 

Q O O Q O O O 



a 





_ d a o 
« V V V a> a> 




«» «v ••« ^m ^m 



I I I 



I 
9 .9 

!! 



Q O O O 

ill 



Cl-ASSiriBD CiTTL LiST StATE DEPABTHBim 175 



SS88883SSSS83S8S88888SS388888883SgS3 






iSssisslissssSI 



V _; -■ 2 -- V -- «- B g «■ »■ «■ - g- -- ,- «■ - jj - rf 2 B- g- 3 g 2 «- ^: 5 r.- o jj g - 



u 



:;:;:;; :| till iii^mi^^r:UiU. 

ii iiiiiii I Ji j||i 111 I «i| 



g : ■ ■ :::::•": ■■»■■■■■?•§ 

fill iljii iP^'ili!!^! 



ti 






ill 



Hi 



llllllllllllllllllflllllllllllflllll 

illllJliiiiiiiiiliiliiiiiiiiiiiilill 

lllillillJlliliiliiiiHiitiilitiHil 



176 



Eepokt of State Civil Service Commission 



e 

o 



a 

o 



a 

I 



•8-S 

a 



g-8 



I 



I 

id 
o 

CO 

9 
a 

o 

s 






2 

o 



88888888888888888888888888: 
^SSSSSSSS888888888888888i 

liiiimiiii-iiiiii jpiiiii 

S5 i 2 ^' 2 » !5 2 8 « t: !: -^ S S' * »" 5: Sf n ^ 2 i S -^ • 




■ -Is*! 

M -a" 








1 1 -a I S a '3 

8 §8 8S88 
llllllllllllllllll 

iiiillllllllllllll 



.2.! 



9 



'a a 

9 3 




Classifisd Civil List — State DEPARTMEin« 



177 



SSSS§88B8S§S888888888888888888§8S88§ 

OOOQOOOOOQOQOOOOOOOOOOOOOOOOOOOOOOOO 
RRRRRRRN«iO«o»o««»wpo«eo«coeocow««rowMMoo?oc*3?5M 









n ra 



M 



(POOoooMooc4^flOtOQpooa>oo«pooao 

0^'^0»-ipo«-i»-«OQOQOa»«-iOPP 
Oi d 0> Oi d Oi Oi Oi Ot Oi 0> Ci C> 9 00 a Oi ^ ^ 



^«i.v4v4v^v^v^>^^4P^^PPP 



p p 



o P '* e* 



^ 



^«o*icpco«ocoao*o*o^fiOcooooops»p<-4P*QcoMe^^^eo^ioe<Sf-i 

^ csi fi — .... — 



w t) M N 



W^ 9-^ ^^ t-i T^ ^^f^N^^S^ 



2 >* 



ss 
















o 
e] a 

c «> *C 



Or H . • • SJ 



- J4 

< « 



» 



2 

■flU 

•3 ft* W 2 rt 



a 



^^ 



H 



•-» O i-s 



b **• t» is *^ >^ » 






o « 



X2 






lllllll 





t 

a 




*»*»** 



II SI its 

• •••••• 

JII3ll!3iail!|||||||ll 



ill 



c» 



« ft 0) 



ft ft 



d e 

4 * 




a a a 



178 



Bbpobt of State Civil Sebvice Coumissiok 



f 
8 



O 

83 

s 

o 

o 

I 




III 

1-8 



i « 




o 



SSS8888S8SS8888SSS8SSS8SSS 



Q O O O O 
W W CO CO TO 



5§ -S 

CO CO CO e« 



00 



Me««e««9«e««e>9c«e««e««e««MMe««Me««e««cic)ciMCioicicici 



^o<M9iMa»r^e««r«^r«i«>'«i'«i*-ii«>i«>^i«.r«e««i«>r«^Q0i«> 

O Ot O) Oi Oi O) Oi Oi O Oft Ot Oft O Ot O Oft O O O O Ot Ot Oft Oft Oi o 



•^ eo 00 00 00 



s; 



M 



^^jQ JO JO a% &l^l?4»i> 2?H^ll i?*l^ 2l 



^oooe««Qor«h>t:e««o>H 

0>0}OiOiO>AO«090*0}OtOt 



O M 



so 

5«« 



t*roodo^t-ro»Qo»aoroo«Heo"eo»^eoVV^c!"ioo» 

M^ MM ^^9|^^^,^ Mf-i^M«^MM -I 



a 

I 

8 






I 

o 



1^ 




1^ 



I 

e 



OQ 



2: 



QQ 



I 



! 



^2 si 









^ 



o 



JS 



^ ^ ^ el 



2 

•s 



d 






^£ 



PQ PQ 



o 









S 2 li g 

no I I 






QQ 









•§►3 



a Q 



o 

a 

s 



s 

»SaO03faWwfioSw^W^OodWHO-<OH^-«;P 






S 




§ S S I S I 

'I -l 'I 'I 'I 



9 « 



B a 
o 0) e 







8 8 8 8 8 s 8 




iiiiiiilllllllllllllll 
IIIJJIIIIJIIJ 




Classiitied Cim. List — State Dbpabtmehtb 



8SSS8S88SSS8SSSSSS8SS8S88S88SS8SSSSS 







4Hn;i««Hn 










3232S8=aS 




mm 


-S5--2-- 

fiiiSiiJ 


-■ -a - = ■'»■'-■ 2 

lilisllll 


iiiiiiiiil=il 


nun 


iiisiiss 


liUUsti 


«■ -■ «- rf « ■-- - e «■ s ". ffl ™ 


.- J.- - ;.■.-.- 


i ■"""" = 2 i- 


.- «- ~~ » e e « h- «- 



iiiliiiiiJJiiliJliiiliiJiiiilJIiiiii 



I :8 



U 



s',1 



JIIIJlllsslllsllll 






Hill 



I III 1 1 11 1 1! 1 1 l,i I ill ill 1.1 .11 .1.1 



11 



Isrl 



llllllllllllllll 



ill 



mnmhmrmmniiiimmu 



180 



Befort of State Civil Service Couuissioit 



8 



IK 
O 

CO 

o 
u 

i 

o 
S 



3 

a 
(3 



S 8 






1 



i 



Q S 

a 



^ 8 



8 - 




§ 



o 

I: 



8§S888S8SS88S888S888S§§§S8S 



c«e<«e«e<«e4c«ic«c«e<«c«c« 



^«aroc•^«c«^oc«oe4^^«o•-(^^^9•o^coAe<«co^ ^i^eo 

^" -; cj 00 -; N 2 g 00* ^-g ^ ^ » 2 g -* gj ^ :** 55 « « s 2 '^ ;; 

o«Dooo^«ooo>(Ooo^•r«^^-«-•ooooaooo90co^^«o^ 






» 



^^illi 



2«-»^OT»-»^i^'-» 



a 



CO 



> 



q> . 

•I0 



>»•$ 



III 



^ CO O jg| 



CO 

J4 



« 

GO 

O 



l«: 



2 g 



3 



« 



2 



09 



8 
6 

OQ 

8 



o 

> 
< 



I 

4J ■*» 






X 

35 






Is 












e 



A 

d 



11 









s j| 









s ^ 



e d e 
8 • 8 




■•• ^ ««■*««»«» '•^ 



lllllllllllll|J|llll. 
Illllllljllllllllllll 



Classified Civil List — State Departments 



181 



S8888888838888S8SSSS8S888S8888S8888S 

.....•••.•.. ...^.••••.^^. .•■•••■-»-••••' 

&ssll&li-l§li^-lii-liil«-i-|8*l?l€|-s-|l 




a •' 



I :i=Si :^ji :■§■§ 









O >k»^ 




a 
C c 



1 ft -- ti • 5 J -S . 



1 



a 
o • 

4» 



lie 



'■ ** - a 
hi 






c 



a 

s 



■il 






o 






,3 « 




h t- 



I1 h »« 



acoSqscccq 
aaaGacacaa 




ni3|i3 



ijji 

mu 



s iis 5 s s 3 S s s si s 



Repobt of State Civil Service Coiunssion 






■1 



SS SS3SSSS888SSS8S8S8SSSSS 

§1 ipjj§§§§§i§§ii§l§iiiii 



-" a a" «-"-=* "' »■ £ «" s" i - 2" a' s" a" 2 -" 2" a a « -" 



II illlJIili 



3 "- s E; a -^ 2 ' • 2 ~ - 



S <^<^SS 






Hilb JiHli?^|liilsJli=|» 



ill 






mil 



IIS SSI|ljJIJIIIj!l3IJ3IIJ 
III 4llJjlllllllllllilllll 



CuLSSiFiED Civil List — State Departments 



183 



888SS8|8888888888888883388S888888383 






9%nc*e*9*9i9i9ic^r^ci9i^eoc*^9*cieiei^*^^^c*cipS 



loio^eoioco'^oooooofoooea^eoeoeoeocoaoneo-eoaacotncooiao 



88*S2 



SSSa'""'''"''"'"a'"a8'""2'^'"2 






00 « lo ^ 



•^^^©4 ^^ ^ ^ ^ ^ ^ ^ r^iH ^cl w^ 

S 2? S^ 2 



§1 § J- 3 
•^ « •-» < •-» 






. 9 

J 6 

Si » 

U Q 



sissw^a 



-s 

s 

a 

00 



^ 



< 
5 



Jgo» 



2 §« S2 





a^t^ III 





h 



a 
» 

S JO « 




u 
o 



k b 



s* « S S 



S § S 2 

S S S S S S 8 




It 



8 

a 






i s s S -5 -5 "5 'C 'C 'C 'C c "c 'c "C 'C 

^B ^K ^flk ^^ ^^A fl^V ^^9 ^^v ^^ ^9 w ^m pv p^ ^^ ^^ 

I i-S 'fi 'i 'S 'S I J II 1 • 1 1 < 




..S 

h S 

S 2 I -§ ^ 

" o a « «3 

.- 4j K V & 



^ Jtf ^ ^ J4 J4 

I. Im t« la t« M 

"" T "S o 75 

« tf C «8 « 

8 a a B g 



o o 



55 




• « - 

HI 
111 



< W «i < < 



-2 

U « 4, 

a T 



184 



RspoBT OF State Civil Sebtice Coioossioir 



S 

•I 
8 



O 
%n 

CO 

o 
o 



» 

a 




OS? 
8-8 



8 



I'S S 



•& 



I 



I 



2 

o 



u 



S88S8S88888S8S88888S8SS833 



oco^r«e«<«»9ioi^oio«o^aoaoaoGOi«>aae30aoaoao3oao 



•-^ *«• a CO »-i 



a 







I 



1- -•^•sl 



>» >> >i >. 



,. _ >v? 



o> O O) O flk o o 



t* i^ CO CO CO w 

O *^ ^^ V^ *^ F^ 

Ob 0> C) O Oft 0> 



50 CO '1* '^ *(• CO CO 

*M »4 *rt •« V4 »4 •>« 

O O O) O O 9 O 



e 9 M 



•o ^ CO 1-1 ^ e* iQ 
^ e« ^ M «-« 



« .-« »H 



C9 90 






*t 00 ^ 






! 

i 

I 




(SSI.S39 



oe »0 T3 









E 

OS 






cS5 

> tS H 0u 






-I 

i fc ^ 



8 



est 

^ ^ < H ^ 



-3Q 

c 



a 

U 



^1 






si 
si 









a 
w >» 
e « 
9 e 

> S ja 

OQ 






Q^C - - 

*^ *^ < ^ »n •^ 




I 



^Jk<.^.M.MJ4.3C.M.M^,MJk<Jrf 



SP6C05DSocoCCCocCCooCoC 



CLABSinKD Civil. List — Stats DxpABTKran 



SS3S3SS$$SSSS883SS3S3333S3SS83S83SSJ' 

S§IIISIJI3SiiSSSiiiiSiga§iii§lliliii 



«h,.,.,.r.t-K 






£2523232 


222225222222222 


222222 2252222 


iniiUi 


iiiiiiiiiiiiiJi 


iiiiiltiiilii 


iiltiiii 




B..E«.>F-«t~K«.-«n 


525222223223822 


5S=Sg=53S5|SS 


isllilJJ 


lllisi^lisalill 


Ifiilliillili 



llll 



ii 






mu 






III 



\nid 



lAKmmm 



Jl 



Jljit 



l^^l 






CGcdJccclisld 



-2 -g I -a -g -gill 



■2 ii 1! ^ -if -2 -a "S ii I -a -s -2 -a -s 1 1 1 1 1 -1 1 1 S 



186 



RspoBT OF State Civil Sebvioe Commission 



I 
o 

9 

o 

i 

o 

m 



I 



I 

i 

& 




III 




o 



8888S888888883SSSS888S88S8 

§§§ii§§§i§§§§ii§§i 






" 8 8 -" -" J: 2 S S S a «' « 2 S **" J: -"* ^' "^^ * 2 5:; 2" -^ " 



cie«oce««noe90C9«cooot«eoocigoe<9e««<«>co^^M<D 



lilllillilllililllli 



eo 



JO 








fsfg 






o 



M 








nii 



« • 



»« h 




^ JO S M i M M 



t* ^ 



a a a Qi a a 






aDcoaQaQBODtBdoaoaQSdoaQaQaQaodDDQao 



e a 
00 cc 



Olassified Civil List — State DspABTHEirrs 



187 



SS8SS8SSSS8SSSS8S8§ II 

'*"-*" -----"-■-- 8 8 



H8 

O 9 



S88S8888888 
S888888888S 



M 









-- ^ <^ CO ^ M 

rgns 



00 CO t-( ^ ^ 



5?^ S^^ 



lO « »- 



uiiiiimiiiiiiiiiii 



" s " •' a 2 s 2 * " a 






11 



o^e«eot^30(»»ot>-oo^ 



M C« v4 ^^ CO •^ C4 




i; ^ • & i; t « 

ftaaQiO.ao.3 




QQ H H H O 





S 

m 
o 



s 



I 8 
mm 

CO 



s 

o 



8 8 
O O 



t 8 



S 






•^ •^ •-» •-» 



O ^ CO 



8 



a S a S o. A 



00 



T b •• 

S^5 



J 



4> 



V 

> 



JO 
QQ 






•g 5 a H H ^ 



t: 



o g 



J 

S4 



ii tt 









n *< V 



a 



i ^ ^ ^ 

C « « o 

s tc Its IS 



^ ^ ^ ^ 






hi 

3 

O V V 

(C (B Its 

3 3 3 

eS flt c3 

^ A Ji 



V ti 



o o o o o o o o u t> o 



3 



3 a 



3 



188 



Repobt of State Civil Seevice Coicmissioit 



i 

I 
<3 



5^ 

^ a 






a 



I 



II 

g-8 



I - 

o ^ a 



8SSSS8 

g o « o o o 
g © o o o o 
c^ e4 M N c« a» 



ss 



m (O 1^ r^ r^ CO 

«W ffirf .^ .^ sa^ va^ 

Ot Ot O O O Ok 

V>> V>> f>4 f>4 «i4 V4 

«? 1^ 1^ 1-^ ^ to 

? !k ^ ** * ^ 

1: — ea *% e J 

» 3 tirt o a a 

^ •-» •< QQ "^ "^ 



I/? <o t^ t« r^ (O 

Ci d Ci O Oi 9 



cr^ 1^ «^ v-> 



iO 






>.«*«> 



f 

■§ 

e 
u 

T 

to 
O 

H 



a. 
o 

9 

is 
o 

7: 



JZ? fi r. e J? 

a t^ u a a 

^ <" Vi >-» ^ 



J3 



> 
rt 

0) 



•0 



1 



t/3 

d 
e 



"1 ^ ••■ 



P 



r^ 10 f\ rt ^ X 



5* 



55 .5 rt 



n e tt 



'^'rt 
•ts Gb 





o 




IN 


a 








•-« 


v^ 




«-4 


v4 


v4 


1-4 


v4 


* 


• 


• 


o 


oa 




ea 


oa 


V4 


»H 


f^ 


t"^ 


^H 


v4 


•-4 


•-4 


« 


o 


0) 


0) 


o 


V 


o 


o 


d 


d 


3 


d 


d 


d 


d 


d 


a 


a 


a 


a 


a 


a 


a 


•^ 


•-» 


*-» 


"^ 


•-> 


^ 


^ 


•-• 


t^ 


t^ 


r* 


r^ 


r>. 


r* 


1^ 


^• 


v4 


•i^ 


o4 


V4 


•i^ 


V4 


oH 


v4 


o 


e» 


C» 


o 


o 


o 


oa 


oa 


V4 


v4 


«i4 


v4 


»■< 


v4 


v4 


v4 


• 


* 


* 


3 




ea 


ea 


ea 


t"^ 


t"^ 


ai^ 


.-^ 


<p4 


X4 


»^ 


« 


o 


o 


o 


tt 


O 


« 


V 


d 


e 


d 


d 


d 


d 


e 


d 


a 


4 


a 


a 

•-> 


a 


a 


a 


a 




to o> 




•o o 



e 
•^ 

u 

O 

rt w 




CO 

O 

m 



'O! O U oa 



00 -o •? I> . • ^ > 

^ 8 &.* J a u e 
5 r,i .- -a «• 

c 

a 



^ 



£ * \: « « i! E 

3 HI ill 



f 



a 
« 

a 



a 
a 



a 

£ 

a 



a 
o 
k3 

a 



a 



jd .d .^ j3 ^ ja .c 




o> 



i§i§§ 



a 3 



CiJissiFisD Civn, List — Statb Dbpabthsnts 



189 



S8S 8§S 888388888§8SSi8S8SSSSSS 



to t* to 



le CO « 



00 



§ 



8§ S 8 



Hi 



a f^ f^ f^ 



« e (O 
ct at at 



o M eo 
eo -< w 






^ <p to 

^^4 O '^ 

o o» c» 



Q lO CO 



o 

0) 8 
xn r 

i ^ 
3 " 

8 s 

ii 

a ^ 

CO 

O 






^ o 

1:1 

3(2{: 



ill 

III 

«< u fr 




>o oo ^ 

v4 o4 v4 

a» a» ea 



*^ "^ "^ 



22222222222282222222222 



C^t*r^fO^*f^*^f^w^w^^*w^^ 



M O 00 O O i-T 



«-) 9 (O «-« 







QOaQCDCDCDQl>>^>^v% 



190 



Bbfobt or Statb Civil Sebvigb Commission 



s 8 



a 

Si 



n 



8 8 



O 

1-4 

a 

s 

o 

S 

O 




i 

Z 



o 

•■4 

H 



S888S888S8S8888 
88888iSS^|8S|S8 



88888||||^ 

X X ^ X X ta b h> b ta 

^88888 






to »^ *H »i< 






e>l C4 M 



« 



« ^i 






^ 






• • » 



^ w ^ 









^^ t-« *-t o « 












(3 

I 



^ s a H Eb.So 



c 



13 




5^0 



ji ji ji .M .M 4< .M ^ 



^ ^ ,M .M JiC Jit 

h la U fca h k 

tt' tt) ft> W V 4) 

"o "3 "3 "S "S "S 

h b b l4 »« »« 

O O Q Q C O 



Ji Ji Ji .M Jl ^ H" -S .a .§ .s .§ .5 .s "p g 




Classified Civil List — State Defabtments 



191 



S 



8S8 



8S888 



S 



00 00 00 00 



88888888 

5 O O M 



«<OiO(D<OkO'<<C« 



SSSSS8 



at 

w4 


1001 
1918 
1018 


• 


» • » 

22S 


1 

< 


Aug. 
April 
Jan. 



iO 
0> 



a 



t 






»^ 00 00 

o *^ *^ 

9 e» » 

*H ^« *i4 

• » * 

10 <o CO 
^ 1^ eo 







.«■ SE *■ K 

w O o _ff ••* 
e e c OD CD 

6 o Sa:S 




o 

s 

o 



IO IO K e» »o 

f>4 ^4 ^4 V-* V-* 

Ok 0> O O Ot 



iOiOiO»o<DiOKOO 
OOtOtOtOkOOkO 



^ *-i e6 CO ^ 

i§|| § 

•-»•-» fci » ►^ 



^ CO to a» lO 

^rt ,M VX ^rt ^4 

Oi O) Ot Ok Ot 

^4 «i4 1.4 vX |>4 



<D^ ,m! f£ ri ei w! w* 



^ IO K to 

•X ^rt ^i4 *X 

Oi o> 0> O) 



K 00 

o» a» 






S(§4'^ ^^ 



• • • ^» • • » • 
P^0>^^<0*-4»X^4v4 

• • • • . . . _ _• 




3 



» t « & aS 
a a S d g 
o o o o o 

I 

E 

a s § a a 
36666 



3 -ti* 




^ ^ 0> 
•« ^ ^ 






1 
8 



.9 



l| 




lO ^ to ^ lO lO 

•H ^M »H ^^ »X »H 

01 Ok Ok 0> 9 Ot 

^ ^4 ^4 fX ^14 ^14 

O 00 00 00 ^ o 



O 

z 



"^ tn "^ » •-» 



to ^ 

0> Ok 



lO iO 

Ok Ok 



0k Ot 

1>X liX ^^ »H »X tX 

e« 00 00 00 1^ « 



11 



en »> 











6 Q O 
O U V 



9 9 9 9 9 3 

a a o. a a a 



192 



Retort oi Siatb Civil Sebvicx Commission 






si 

111 

Hi 



III 



«5 




i 



o 



8888 888S888SSSSS3S88S8888 



o 



8 



o 

8 



J^eOf-ii-i «D»«^ne«eQe4C4CeM^MCIMMMC4M^^,-i 



»0 to •* lO 

«■ »4 f>4 ^4 

o o a» a» 

^ M M ,^ 

» • « » 


2 2 '*' 2 ^ eo 00 ««owoo-*if5ioxotici^iaot>. 


July 8 
July 15 
Dec. 1 
Mar. 4 


iiiiliiiiili§iii5|iii 


le le ^ lo 

«■ ^rt v4 r^ 

e» o o Ok 

Pi4 r4 f>4 Pi4 


Qac>o>0)oco)eiooo)0)0io>oftaataioa»09 


July 8 
July 16 
Dec. 1 
Mar. 4 


illilliiiiliiJiiiiili 




o 



E 



a &* 

o 



""•SI 



►- — c c ^ 
S g 2 .S I 



•E a*^ 



c 



*T ^* ^^ ft«^ »^ 



X ^ 




c 
c 

E 



a* K e ^- S 

.« J j2 i; 2 



:: c: ^ ^ < I » 



c a 
■r V 



a 
o 



Is 



0) o 

a a 

o o 

i 9 

B 5 

5* »■ a s 

S c o o 

O o u o 



B S 

a 



=» 3 ^ 

^ ft a C 

P u ci S 

© o tJ TJ 3 

C' o «« «* t{ 



T3 

B 
3 

V 

c 



B 9 

9 s 

S "i 
S « 

^ z 

si 

•f o 
O B 



T3 

B 
3 

*" tJ 

0; B 

O 3 

B •- 

i i 



8 

I 

•a 



■3 
B 
B el 
O 



S B .S 




■" 3 

2 2 

^ — 

-z ■ 
•si 



f 



II 



B a 



3 a tS t: «*« 




SI 

C; a S -3 

« 5 3l 



s Silt 



, "^ (« M e 

s ^ .s ^ -^ 

c 3 2 ii Ss .5 

-= .S * a bc ~ 

«— Uw •^ •« W- W- 

3 C O O 3 O 

a S B B E B 

.2 .2 .2 .2 .£ .2 

.2 .3 .3 .a .£ .2 

> > > > > > 

•3 "3 -3 "o -c -5 

* » • * • » 

«•« «•« «fti« «w« «•« ^« 

^ ^ ^ O ^ V 

• ^ '0m «Mi •«« »mm tmrn 

J3 Jt J3 JG JS JS 



a 

a 

a 
E 



3 
C8 

3 



S S E S S £ -6 -o 



>k >k >, >k >t >, 

0^000033 

"a ft'c.'H.'o.'E g * 

§g22EE§| 
«>»a<««>«»^3 

<» «M «• •«• ^« »< •" 

3 0^-^- 
3 3 3 3 3 3 

_ -H 

3 3 3 3 3 3 
.O j: ^ £ ^ U3 



3 



g § ? ^ 



3 



B B = S s B 

C/ O 3^ C O O 

-3 -g -o TJ ra T3 

c B B s a a 

ti V V i/ 9i it 

«.• .w «j M ^ ^ 

s B B B a a 

•M V** •••« •«« ••>« ^i^ 

*>•<*• ^ fti* 4. fc« 



& 



3 3 3 3 3 

00 X CC % QC 




CtA89iFnEi> Civil. List — Statb DErxBmgmm 



1»3 



8888S8S888SSS3S8S888 8888888 88S888S8 



ooagfl 



g^ 



o»S5 



3 



b. t« r* S5 o 



c« c>c py c* w 



S »o 



8 



8 

9 



e*ywwwo<t-^'N5i'W'*^^»^«^»^-^ 









»i«> «9 '^ ^ .^ ca 

»^ F* »M ^ F* 



wi f-i t^ ^ r^ ^ :^ td 






;3' :0 o «o cc f^ 

"* ^N C^ •-» f^ 

ax 8 2 > > >» 



t^ w^ t^ pm wm rm lO 



ss 



• t^ < c ti -ii J^ 



n. q 






9O90iaiaia»ai*i40»0B0Ba9a)0ie39a9eBa> 

• ^ • • » _g • » » • * 



aiOBaB90AOQOaoaBaDoiai9>ot 



el e» 1-* 



of (^ i-T «o^ i>r o' 



■» •▼ -^ •-> O ^ Q "-9 Q S 2 0« -? »n S 4 < O O "^ -< O "< "^ •< Q 






«»:>:« 












cr 



5 
S 



J3- 










. .o 

• • 

>:• 1^ > H 

* !• «^ IZ » S. ,« 

,» cf <-» o »o. 

•!» 09 Of ?( ^ 09 



^1 
1 






f^ ? 






5^ 



s: 









•s S j -' 

Of r2 t^ O 

ct 09 09 r« 



id 

•-* CO 



> > 

:i << 
^ « © 






S © a t-i 
^ •*^ a . - 



-= *S -i OD 



s 
o 
o 



^ £< ^ 

S H a! 
^>> 
^^ »<• «• 
•M e^ r*5 
« pd rt 
w e« M 



5 rs ac 

T3 



00 



a 







C F 

- i «- 



to « 




.1 ^ 






5l 

■' or 



fl >• 









9 






^a'S'^'^'s^ 



;< s cj s ^0, 








3 



.S c 



= o 
-i > w 

5w eg a P © «t 







SS 



C C S C fi Q 

2 ® A 9 O C 

I e a 6 g s 

>> >» >t 9s >k >» 

3 ^ C O O O 

S- "a "2. "c. "S. "3. 

i § S 3 § § 
• 9 e » 3 i 

S 3 3 S a 3 
lit ft t 

— J3 ^ JXS A 

» m ^ m> w » 

^ «« «« «««««• 

s s a ;S flC e 
« c« © s* ^ « 
■3 •» •« T» TJ *;» 

5 c c c 5' c 

s s a a 

1 1 '^ S ^ f 

9 « « » » • 

s a a S ^ 

illJIJ 




a 
o 

el 
M 

8 

> 
a 



1.1 



■^ 5 ** .S 



a 

c a c c c 

0) Oi C 11 C/ 

w -ES- • ^ M M tC M 

"I a ^ --3 " 'S "S 'S 



0) 

S 
"3 



wi to 






1; 


O 


hfl 


b 


et 


o 




.a 
a 


91 


» 



194 



Beport of Stats Civil Service Commission 




S88SS888888SSS88SS8S88SS8S 

gggOGOPOOP 



to 



^ 8 S CI 

<4< ?4 to O 



Q O O 

-* 5 5 



W CO CO CO CO CO CO 



Oe£*-i-ifi^fO'^wS^riwmOr^9^ 9-4tOOrif4wmf^'^f^»^^ 

►-»i^^*^0^»-»WW'^'nWW»^«-»<^^<0«-»*^«-t»-»CH 
OP0QNh^*«J0QV^«0i-Jh^Q«oVP3>0Oi0«0^^'*O000r 

^^8i§jdlH«g| 8 8^8 ^^S 8 8 2 « 8 8 8 i 



O 

-I ^ 



o • 






3g83§a8;g§i 




S CO 










s 



o 



-I 
It 

C>4 as 



OS 



• 
C p, & 

» ^ "^ . 

< o S S o 



u 



ll-il 



§;ig§§S§ggi§g§Si|i 

« o c* o « o 



<M *M *M 

g .1 1 nil 



3 



• •* BK^ •«« ••• t^m •^ •mm •*■ ^ 



S S 
e e 

3 3 



o 



^M ^B* ^B" ^B* «^ ^mm ^M ^"W ^"^ ^"^ ^r "^^ "^ 

OOOOOOOOOOOOO 

aaaaaaasaaca 

*mm vp^ •^ •** ••i4 •«* ••4 mm •w^ •^m •^ 




q a a G 
3 53 3 



llllJIl 



CuLssiFiED Civil List — State Depabtments 



195 



88 8S8888888888SS88S8388S8S88888S8S8S 

8SS888S88S88888888i8^iS^^SiS§S?i§SS§S 



O»^OI^(^»«X00G0«Q00CX0CXXXK00Q000XQCa0«Q0Q000Xa0XI^3C?C0000 

or*e^r*iwt^^t*-^«t*o^^t*-*t-^xxxx'rx^t*xxxxi^xt-.xx 

^^S,^,^ .14 1-1 ^ r~, ^ w^ 9^ ^ ^ ^ ^ ^e^^H^H w^ 



8 



> 



a 



2 



— ^ 00 



•3 

a 
e 



Z o 



o gc .-4 
3 « ^ 
B M C« 



O 

z 

> 

a 
o 

• mm 

a 

o 
o 






a 

C 5 f-i .2 jL. 

> a ^^ 

»o ^ ^ ^ 5 
'^ Z CO H << 






ki u k 

O a; 3; 



V k ^ ». b k b 

ocesaasedqsacacccaaecaascseccccccsaa 

««■ •«■ ,ZI «_^ a*« V** "^ "M •«« 'M^ •■« ••« a** 'M B^* •#« 'ff* '^ •■« •■« v^ •#« apv •■■ • «^ . «■ •■« • M • p^ • «« • p^ ,^. ••■« atrt •«■ ap^ 



0; l< & 



19» 



Ebpobt of Statb Civil Service Commibsion 



a 
o 

I 



o — 



5 g ^ 
AS 

a 



S 









I - 

© o « 

^ S s 



I 



o 

H 

OQ 

2 



88SSSSSS3S8SSSSSS3388888888 



CO 



o 

CO 



M 



8S 

€4 O 



S§S|8 

c« o o o» » 



CO»H»^*^"^»^»^«^^*»H »«H»-»»H 



QOI^00^<OQ0C4^^i^C4C0X00iOt^t^Xa0XQ000Xt«t^a09 

-HW t-^C^»H ^1.^,.^ ^4f^i-4 x-tM "-"N 

oOt«^<^i07«e<9-«'^r-4C4e>ot«QO«*'t<>t^ooXQCcoaOQOt»i^r^2 



e« «H 



e«c4to«<o«-ic<9QcoaoQO^«oeO'HO^-4<-i*Hrii^^ 

ri<CS»H»^»H C^F*»H -H 1-41-4 iHPI *HCS| t^ 




. iH 



SO ja 
^1 



* ^ 

53 



00 8 >* r* 1 
CO <^ ^ f-4 r^ •p 

c* o K cQ n Ot 









aft 
•3 




^ «t 4^ «« ^ 

• «« "^ ••* •*• 'mm 

S 9 S S S 

2 c c a 

•«« ••« ••• ••« 

u o o . 

CQ CC (B CQ QQ 



S S S & -J 

«« 4a -^ .*« Ja 



13 3 



3 C Cj 

»i« M »i* •« 

• •* •-* •«• 'P^ 

& u c u 



4*«i«4jOOOOO 



8 8 £ S 

> > > > 

q c d 3 

• »« •«« ksi* •■« 




^ & 



« « S V 
5. fi, a a e 

00 CO OQ 39 N.< 



o q o o 

■*.< «^ '4.4 ■*« 



as 2 

5 J! 

o o 

ft* ft* 

o a 



in 01 



" S g 6 S 

C •■■« '"^ •>« '3 



4? o 



o o o d 



8 

> 



8 £ 8 8 
> > > > 

q 3 q 



.§.S|.S 

-•rf '«' '•i* '«i* 



8 8 
q 



« 5 

,^ •«* tM tM tM M 

o o o o o 7 

i; is 5* ft* ft* "3 

C O O O Q 9 
■^ -^ *i ■*a ^ 'Ti 

mill 

8 8 8 8 8 «i 
a Q a a a Q 



Classified Civil List — Statb Departments 



197 



S88S8S§S§8S8SSSSSSSSS§§S§SS8S8§88SS3 



Si 



oScqSqqQQooooccqQq 



O 
c J 



»o o o o 









o 

8 

o 



«l 

.M ... 



2i 



> 

< 



o 



I 






&2i 

_ * - 

"2 ;ti o> 

-*• 00 lO 
M ^ ^ 



O S 



:» us 



r CO _ 

c 



O 

> 



O 



1 



5; .5 

- 00 00 

•* r>* t* 

»ft 1-I CO 



o 



3 3 . 

So © 

^- 2 > 

. - c 

^ «> o 

00 OT .2 

*» ti "S 

W la: "^^ 

^ -^ oe 

^ 1^ s 

IQ (-ri *H 



o 



• • 

- cc 

•a s 

I: -^ 

". s 

H Ed 

N « 

1-1 « 



c • 



O 



< 



m 



u 

TO 

o 



•c 



< ^ 



O 



O 



♦i r 

oo o 

2 g 

** •a 

eo lo 

M e« 



c 

* JD '^* 

^ *» j3 

J ® ?? 

00 O K 

M t« lO 

O CO M 

e9 1-4 M 



s 

I 



00 

oo® 

S M 



o 






OQ 

d 



o 



_o 

"3 
to 

a 



O 



■*» ^ «* 

rr» *-< CQ 

e 

C 



OO 

o 



o 



t4 

o 
8 

o 



J4 
d 

i 



5 



as r 



CO 



* H 5 C C. 






3 






00 



i2 

o :2 



CO 40 







5| 
I J 



|l|tlll| 
^-gj Is s s I 



>» >> 




. s s s s s 

5 O O O O 

«3 «J 4J v> «> 

C « C C O 
d 2 «8 «S «8 

«M W* %M •*• %M 

o o o o o 

«>« ttf Im ttf (m U 

gS5SSl 

I mil 

& a s s g a 

^j ati* -^ ••« •^ ■«« 

C "4 ^^ **** *^ **^ 

J 8 g g 2 g . 




Si 



II 



o o « o .- 

je «s « d '7 

•M ••• IM •»• >j 

1 1 1 1 J 




198 



Report ok State Civil Service Commission 






o 

CO 

a 
s 

o 

u 

:^ 

3 

O 



I 

i 



a 
o 

I 

K 

8 

o 
O 



a 
£5 2 = 

a 



2 o 

«- e .2 

o •-• > 

S g 8 



8 



"! 

I 



a 

o 

a 

S 

o 
a 






e 
s 



?: 



O 

04 



S8888§S§S8SS§8S8S888988838 



8 






« 



s 



00 



«Ot0^^OC«C«'-<»OO>9t»XOi0i/3NC«Sr^O3OO 
09>GOO)0090C}00090QOOOaOOCOOOOOO>0)Oi 



ifi G ^ ^ 






O O. 



*; ^ 

« 3 



^' > 



o •< o 4 o &« z 



«or*t.oorwrM«oN*^br3RMOiooiNO»^t«o 

000^0(3^0>00)0000>Oa09000000>00>000> 






fii<v4^4lOlQo4|>4v4p-4.M,Hf-4l-in*-4'^<^'^4*<4-^*^OOOv^O 






•a 



o o 
O Cu Z 




TO O 



SS2S22BBBaaS2SBSSSSSSSS. 

decccSac3S2eeccaceoeas 





> >» 



I. 



>» >» 



b 



. r* .^ i^ r< r* .!• i» r* r*» ,5 r* ^ ,J» P* ,? r* r* r* r* r* J" r" ft. 



Jl 



Classified Civii. List — State Departuekts Iflfl 

SSS8SSSSgS388SSSSSSSSS8SSSS8SS8SSSSS 

M§i§§§§§§§iil§§§§i§§§§§§§§§§§ii§§§§ 







n -no" 


■* - n 


nr. n 


nn «n« n 






ssliss 




3S2 


2§2 


2 22222 






""'" = ■" 




"""" 


a-" 




ss-g-" 


---"-"s-s 


Jiiiis 


mu 


III 


^11 


illill 


lll.^^l 


miiu 






* - n 




n n n n » n 






nilii 


222I2 


£22 


2iS2 


22222S 




2232223 



lllHiiiillliliiillllllJIlljllillilJ 






■g :| 



llHllll EJll =l!Si Jill h Jill 



liiUiH 



iiiii li iliiiiiiiii iiii iiiiiill 



liiililfftlfllllllfflllltlllltlili}! 



200 



BsFOfiT OF State Civil Service Comiqssion 



i: 

•g 

8 

I 

o 
Si 

CO 



3 



I 



111 






<9 

8 



|8 



S A @ 

lis 



1 



« a 



3 

2 



2 

O 



88388888S88888S88SS888888SB 



§ 




^ c s S :z: se; *^ se; 












(0 CD t^ «-4 
04 «-i M 



^•-i(cg^t-ig^ooec«-<i-"^««c**©«^g 



•-4 ^ M 







I 



SsS§ 











e 



^ • s S -1 fc «j ® 






«. a 



ffl 2 - 
- go g 

Si g^ 



Si 

^1 



llllllllilllillllllillll 



1 1 §- 1 1 1 

S e S 2 a e 




Classified Civil List — State Depabtmeitts 



201 



S8S8SSS38S3SS§8§S8S8338888S8S8888888 



8388 

M « « fi^ 



S S S S 5 

P P Q p O 

5i oi s^ fi CI 




<DOiO^|^i-4«i4^«OC«tD 



r-t w^ ^ ci ^ c* ft e* v~i ^ v~i 



<2«<S-<2:Q2:»?S»?»?oooSoooo»^zSo 



-^•H^-^^lw©^c^oseoeo^HOOoo 

»^ * * 



O O 



slll^l^ll 






(^(D>C .|C^»H»iH" 






^Xt-i .,-i-^^r* 



-• N M i-i 






Xo : 

•«• . > 

00 J < 

js 3d «• 

** ^ w 

Q 10 ^ 



5z: 



o 
z 



6 



i-9 

« CO 

M 0? ^ 



5 









> 



"5 I 

10 CO 
eg ©» 



a 



a 

o 

G 



IQ O 

2S 






5 









. a 

00 ^ 



o 



d 
3 



00 



t 

a 



8 

I 



o 
2 






5 05 






o 



C3 

:2 



» 4 



I 



C 

CO . 

as ^>U 2 PQ m 



a a 



a 
o 

g 

> 



d 
13 



d 



o 

m 

no 



I 



PQ S 



CI QQ 95 




lllllllliiiiiniiiiiiiiiioiiiiii 

3Siaf|aala|3afa3ai39ii333saa 

•^ ••• ••• ••• — « '^ •»» ••< — • •"< .3 .M .M ..« .p4 ..« .S .3 .S .S .3 .3 .3 .3 .3 .3 .3 .3 

SSS2222222299959O5OOOO0OC0O& 




202 



Repobt of State Civil Service Commission 



1 

St 






o 

s 

o 



Jit 



|ii 



I - 

1' § 



s 

c 
2 



O 
H 

O 



o 
o 



8S88888838S88s8S88SSS8S 



8 



8 



oQr«h>r«h>r^QOi^QOoOGOGOuoxMcoeoc?xeoeoc«t« 



00 (D to O 



#*5 •-»•-» O 






2Sgg 



-H fM t^ 1^ w 



o 









M t0 <0 CO 



1^ •-»•-» O 






■»» JO 

O b 



I § 



o 

B 



f 
I 



> 



3 



c 

1 

c 



00 



O 



O 

jzi 

GO 



^^ J 



to 



GO 

a 



s 



o 

CO 

1 

o 



O «; 

•c s; 






> 

c 
o 



i 

PQ 



O 



a 30 






30 

I 2 . 



6 
5 > 



:1 



. c 
> 



c 



• a 



>.-• -^ 



X 



ii ^ ^~ 

: > > C 

-« **• "5 « 

^ ^ ^ *^ 



do 



O 



ro«o5rtMi-i»?Soo 



, 00 CO c > 

^ 5 S * S 
§ ? 3 a 2 

^ w r^ h» 






1 



a :5 
jb n: 






»u2 



w 

I J 

JSsJiu 



a , <u 

5 2 8 
^ o o 



-Ss 






a 

?: 



X 



S 



-§:s 

•-» X 



V 

E 

o 
e 






s 



§ -2 

mm •#« 

. I** 

w g 

> ^ 



22222225525532^2S.5S.!1K|I| 

^i||i|raiiiiiij.?l.slll 



CLASSiriED Civil List — State Defabtmbnts 



S8SS8SS88S88S888S88SS8SSSSS88SS8SSS8 








«>^wrte««rtrt««»ar-tr«r.w 










2222222 


mmmmimn 


-'-■-•---■ ess a - 

mmnm 


mm 


iisiisSssilissiiss 


iiSSil^isli 


2S22222 


- 2 5 •■ • 5 5 s =" a : - - a - ; s - 
jllilJIIIlllJillll 


--■-■-■•-sa-a- 

mumm 


-SS-2""- 

ilJIIIi 






(5 



I* ^1 "s>:=>:lg>-= -Sill 

s !iiilliii|s'l 



5s:s2Sl|{|Slls!,SS5S°ai|glS|aSS5iiaS 













'illl g|8 8 



204 Repobt of State Civil Service Commission 



I 
o 

o 



1-5 

si 



•8-S-c 
S IS 







2 

O 



I 



3888888888S838S88S88888888 



88 



OOOQOOpO 



S S c« 
o o o 



s 



CO 



x»ox««Dt»aoxao«XQO-"t*r^©i^t*«oc«QO^^^ 



•-« ^ •r« -»< O OS 

P* 1-^ W M r-i 



?1 X I!? «0 «-• •-< t« f-l 

»-<•-« ^^ ^N pii* M 



-HOMo<-ic>e<)«D^ao 






xxiox-^or«xxxxxx<rr«^Mr«r<.xxxx»« 

0>®0©OiO»OiOCiC5CJ©C53S©OJC50>OOOe'-OiO 



00 

s 



•-4 ^ ^ ifi Q( gj 
M t-i W CI 



^rixiocc.-ii-it»eDooe^o«-I^«ow«dot-< 







^ J 



e 

O 

o 

pa 






o 

c 

08 



c 

o 



O 



CO 






> 

« c 
:3 -C £ 

^ © 2 

I- O lO 

^ »H .^ 






»:: .2 

a "c 

>^ ten -^ 

^^-•^ 

m; o "S 

^ rs -^ 
.-^ U5 O 









^3 1- a "3 



-• c2; 



•3 



S OQ tj »^ 

^ ^ Q © 
M to <o n 



r c. fc. 



a 
o 

c 5 "S 

£ ^ *^ 

. < o 

4« ' as •fl 
PL< 00 O 



i e 



2 ^e t* L-" 









i 

o 
X 



sq "S 






2W 



C 3 C 



i^^a 







Classified Civil List — Stats Dspabtments 



205 



88888SS88888S88S8S888S88S3SSSSe8S8S8 

8888888888|g|§| 



i 



8 



8?R 



S 
5 



M M M 






O ^ 00 

»* « « 



X (-^ <D O CC O <0 






O) 4-1 



-^ a S«- •a&'S S a St (iiaq- SaJJJi aai-itiiJJSJiioii 
oooka»oka&ooaboaioa»aooo>oaiooooaa&oociaooic>oa»o>ok 



uiumiuumfmirmmmmu 




O 

n. 



d 



1111 If ^1" 






a , 



4« J0 J< ^ 
k k i« i« 

^ B «» Jb 

"c 73 "o "3 



?3 



H 
C 



4*4IJM 



«3 «e (C « 



^ 

«« 

^ 

3 










206 



Report of State Civil Service Commission 



o 

T 

O 

o 



•a 

I 

i. 

J 



'I 



s « 



1 
ail 



lis 

g-8 



a .^ c 
J- ^ *5 



2 

O 

t 

00 

2 



/ 



88S3888888SSS8SSS8S88888S8 



S esi S 

9 9 9 



8 



8 S S M S S S 

ifl « CO w ec CO « 



8 






2 15 



s's'a »'a'5 2'3» 3o 3 g-as-go u g-w^B S-g a© 

'-••OU3"5»Oc0«O'<'«OC0t*»^CIt*^»"3f^»^»C»C'*<^^^»flr* 



r* ^ ift ^ 



•0C0l0C0Ud<-i>0^<0«0t«O 



-< -^ N 



oa lO lo lo 00 
- .-I .-I 55 



CO a» 



8^'' 



M 



"§ g^ c^ 



a e Y s 

2 S V 4 



>. « s 



0.3-353 S S^3J3 S^J-^fl i|||| l-aj I 



4 « a. ■ ^ 





•8 -82 



a 



DP P D D 





•8'S 






PPDPP 



c 

a 
P 



■§ 

9 



•c 



s 



I -g I 



p p p 



« a> 0) 



-g -a -a 



c 

p p 



a 
P 



's 

u 

•a 

c 

P 



Classified Civil List — State DerAKTUErrrs 207 

8SSSSS3SSS8SSSS8S83£SSSS8S8S88SS3SSS 



sasaSsSSSaSoSa 






aoaA«&S«B3 oDsiaa 



iiiiiisiiiiJiliiisii^iiliiiJiliilill 



» : : ^ z J! . . J < ■ . - " * * -.-■ . z ^ £< 



S : ; f S J < < * 



.--III 






sis 



a|i 



111 









yuu'ou'iju 



208 



BxFOBT OF State Civil Sebvicb Cojuussion 



i 

I 
.3 






I 



2 
o 

H 



I 



88S8888SSS8SS3SSSS88SSS888 



8 



8 

a* 



8 



2m^SS«io88c3 



|^I^GOGOiO«OQC^XaOQOXt^OOOO3OX<O<O<O«0OCD^r«t^ 



09 »«« N N 



^0<0«-iO<0«Df-i,.4iO 



CO »o '^ •-« "^ "^ 



3 









CO o» 



o ^ od 



SS5« 



- <* ^- « 2 S 



U) iM f^ r-l 9 »^ 
« 1-1 



^ >^ O 










Sb b k ki b k. 
€) V V V t* O 
o «c9 •£ "A •a -fi •e 
e o. fii ci a Oi Oi 

•» f? J? i? 5? f! 

s a a a a G a 






M • « 



M M M M 



a 







j< .u .M 

>4 



Jitf .M 






« _^ ^ o! & S 

C5uS 



M M M 









C • M 

a 



ki k 

.A ^ 
a O. 

« tf 

o 
o a 
« 5 



M M M M M M 

? fi a q q c3 

mill 

XXXXUiW 



i 



9 






CLUfiinsD CiTu, L16T — State Depabtmbhtb 209 

88S8S3S3SS88SSSS3S38SSS38SS33SSS388S 







ssss5l=5iS===2 


miimliUiiisiilm 


«- -- «■ «- ■ a 2 ■-" a " " 2 2 - 

itiilssslfllJt 


iiiiiiiiiiiiiiiiiiiiii 


iiiiiiiiiiiiii 



2-S-' 

lifiiitisiliiijiilli^jiiiisillilsil 












5 fi'^ii 



il l^l!5' 



nmiii li *=l '^^^-^ 9 II III i 



!1 W itipirii 

6li ills iifSiiiSxii Si is Siiis 



mU 



UiiiU ■ n n N H N : n N n N n ! M M n 

lihill 

is I till 4 i-siil-ii-s-s-s-ai-tiit-sifg-si-s-ai^ti 

lllllll lllllllllliJIIIIIIIIIIIllltl 



210 



RxpoBT or Statb Civil Sebtice Commission 



Si 



If- 



1 1 1 



i 

2 



o 



88S8S8SSS88SS8SSSS8SSSS§S8 



ii 



& O 



i 



S S o 

O Ok Ok 






<5l 



e 

9 






c 

9 



»^ a ■** 



llctcS^dfeZ 






5; 

e 

9 



&i 



<;>«'? 



9 0; 



>» ^ ^ 



8 ^ « S 



d ^ 



flbOi900k90*OBOftOOft9C}0>09000)0>00)0000 



2: .^£.1(50 



£2:q 



(2i 



c2cS^2 






^ -^ 



08 ? ^ 









I 



OQ 00 



OQ 



1^ t* ^ J» 
0» CO O '-t 
^ N .— M 



, ► OQ 

CD ^ iQ 
•n « 



2 



G 



® ^. 5 «' 



2 :>^ 



CO V 



a 



> 
< 

C QQ 



9 

6 



N 



ss«s 



"SSI 



^ CO 



00 



O • O c 3 ^ >4 
>* • ' ^ .&: - > a • 

30 ^ OQ t :m ^ ^ 

cp5/5c?o§aoS5S^r^S 
tC>4UM^co«><-)iocoUe4 



1 
s 

OQ 

o 




si^a 



•§ 2 ^ • • •€ 

o -5 ' : : 9 

^12 till . 

u « « S 5 ;f 
9 5 -a ;a JJ y 

-< rt H Z S O 






a 






c 

B g 

sc 



c 
.S! 



j< - 



1 g I tl 



9 

9 

c8 

fa 



B 
ft 



«a 



• 5 B 

J B "^ 

i -B >, 



ft V 



kl lu k 



■^■g,-^ 



e 



J 



ft ft V V 



g; V V 



0^ 



4, 4) 



u 
ft 



ft ft 



a a a a o. a s. a o. a a^ o. a a^ a a a a a 



llllllll 

OOOOOQCOOQCQCOOO 



a a - 

^ - ^ - fi 

_ _ _ .ooooe^offoo, 
ddaddaaaaaadsadad 

gQCQoQGCQOcocQcs'ncoaQaQxaQQOooaQaQ 



a^ aaaaaaaaaaaaaaaaaaaaaaa 

lllllllllllllllllllllllil 



Classified Civil List — State Depabtments 



211 



3S88S8888888S8888888S888888 88888888 



SSSS 



c e 



o» o 0» 



o 

s 



9 
S 



9 ® 






s 



88 



5S 









OQQ^9000tO^^ 
M ra ^ 1^ .— ^ 




sis ssg^i 







00 

CI 






^^ * ^ • • • • 

Q CO 00 O <0 ^^ '^ 








ijtfe ^ 

aaac,c.Ci;^p.p.ao.Oba2,aa a^^ a Q. ft 






»• k h 

« « c 
jQ ja X 



accecacaqigdacccaaagss 

dDSaQXXaQQQaQQOdOQQaQQQaQOCSCXCnCDaQQQQQ 



^ « « V S; & £; 



idt- ^- =• 3* ^ 

Hill 

iiiiiii 



Bepobt of State Civil Service Couuibsios 



is 



n 



1 
1=1 



88SSSSSS8SS3g8SSSSS$SSSSS£: 



^z^zo-c-e^zo-? 



2 = S;:8S5- 



ZOS^lEi?ZO<-<-52;C'?-<Z>?ft.2 






-lit 



1^1 . 












ii 



m 



If 



fill 



I 



^ttbfettte 



|M|||§i||||ll||||ll|i|l| 



Classified Civil List — State Departments 



213 



.iS8S8S8SS8S888888S8SS8SSS888888S8S8S 


















a •e 1-4 o <0 00 



90tDO<Daoe<IC«eQO<H(0^r3<-iC«f-4<DM)0«^>CiOaO«DOCD'<f<r3<OCD 



% 



: & 



••3 

00 ^^ 

o o . ^ 



j3 "eS '«3 *S « «8 Sd 



04 OQ PQ PQ (Q fq 






O 

n 

> 

15 § 

a C 

o 4» 

W > 



z 

00 



S a 



a 

1 

pq 






CO 



'S' J< -H 



< 









>^*& 



£ 



CO «^ 



2S 



ss 



00 






S 4) 

p> r ^ 

no >-i X O 

^ W N Q 
§ « C4 © 

^S5S 



^ tH iM 



SS 3 -q 
r s "^ 

^ ja r® 
«• ^ h 



e 

8 

w 

n 












S S 9 

> O o 

^ -c :3 • . 
J3 ^ a ♦* • 

® a ??; 3 -3 

^ k — -Q '"3 

15 2:23^^328 



P «> r 
^ > ♦* 

n ^ 00 
s • ^ •«» 

C QQ :S CO 

-^ o W W 




1° § i=s 






^ J ►? a 2 a 6 3 o cS s K 



pa O -5 O •< 








t e 



•& -a -a -a -a -a -a -a -a -a 






t t 



lllll-ll 

88?fft888S 



■III 



1^1 

_ _ _ o o o 
^ a a e a g a 

3 i( iS 3 S 5 3 



III 



t£te««e<<*888 

llllllllllll 



l-l 

8 8 



«•» ^^ .^^ 

•nil 



3 
>» 

a a a a 

8 8 8 8 



U b u »• 
V 0/ V «J 
^ «* *> ^ 

»*« •ff^ •*« aa* 

.ii|||iiiBillll 



•c 



c c 



1 1 



a a 
5 JS 



214 



Ebpobt of State Civil Service Commissiow 



I 

8 

a 

& 

E 

<5 



sis 

h 



o .S 



s 



g-8 



I - 

•a « B 
file 
J: '"2 '5 



I 



o 



CO 

O 



88S8SS888888S8SS8888888SSS 



S S S i ^ S S g ^ S §^ S § 9 

•» - - 



SS8 



c< 



N 



?4 S C4 



X 


X 


» 


« 


X 


X 


X 


X 


X 


X 




X 




^ 


Iti 


^ 


«o 


^ 


t* 


•o 


»* 


X 


X 


X 


^ 


^ 


^N 


^^ 


^N 


i-« 


w^ 


r^ 


•^ 


*H 


VM 


*.« 


X 


(•rt 


3^ 


v4 


^rt 


^i« 


rH 


fi>* 


^4 


vM 


•^ 


1^4 


^4 


v^ 


^i< 


*.« 


9 


o» 


o 


o 




a 


o 


o 


0» 


a» 


»M 


O) 


A 


O 


o 


o 


0» 


o» 


o 


0» 


a» 


9 


a» 


OS 


o 


c» 


^^ 


^4 


v4 


^N 


^•^ 


v4 


»M 


^4 


<^ 




9 


•^ 


^4 


^4 


v4 


"* 


^4 


1^4 


^4 


»-» 


ft 


w^ 


pH 


^^ 


^^ 


"* 


9-* 


v4 


a» 


o 






?1 


v4 


CO 


»o 


X* 


a» 


^ 


• 


•^ 


• 


s 


CO 




^4 




n 


M 

^14 




;o 


9 
?4 


< < 


• 

1 


Dec. 
Mar. 


6 




c 


<5 


• 


JO 


1 


1 


■ 

1 


* 

6 


1 


1 


Dec. 
Oct. 


• 

1 


•1 




8 


3 


^ 

•* 

"^ 




00 


30 


00 


X 


X 


X 


X 


X 


X 


X 


X 


X 


^ 


^ 


•O 


* 


CO 


^ 


t* 


•o 


t^ 




X 


X 


"T 


»» 


wm 


Vi^ 


v4 


^H 


r-^ 


«ii4 


«.4 


VM 


VH 


»H 


1^4 


r4 


jj 


vN 


ix 


v4 


r^ 


r^ 


r^ 


vN 


^•^ 


X 


»H 


^* 


w« 


V4 


o 


o» 


o 


o» 


Ci 


a 


9 


o 


9 


0> 


o 


o 


9 


0» 


o 


0» 


e» 


a» 


a» 


o 


0» 


Vi4 


OS 


o 


9 


s» 


•H 


ri^ 


v4 


v4 


r4 


»M 


^N 


l-« 


vN 


vN 




v« 


^4 


v4 


ri^ 


"^ 


»-» 


vN 


v^ 


^h 


*H 


0) 


V4 


•^ 


■* 


" 




0» 


• 


a 


^ 


CO 


CS 






•o 


• 

X 

v4 


o> 


• 

p4 








s 


CD 

9^ 


lO 


!P« 


s 


w 


e«4 


1^ 


CO 


CO 


-< < 


• 


as 


1 


< 




■ 

t 
o 


• 

<5 


JO 


1 


1 


• 

1 


1 


1 


1 


1 




• 

1 




9 

§ 


5 


Si 


"3 


S 



3 ^ -S 



in 



CO -^ > 12 ♦* 
^2 » < TB » 

!;; J « ^ 2 







«; ® < . 

•2 I .o ^ ^' I 'S 

^ "^ « « ^ - !r 

CO '^ " !5 ^ ^ 55 

S ^ •<«• CO S M <25 



. >% 

z=s 



- > 




S55-5S45 






55SJ9S592SS5S 
'>» *>> ■>» ■>» '^ ■>» '5» '^ ■>, ■>» ■>» *>> . 

888888888888 : 

1 1 1 1 1 § 1 1 1 -g 1 1 1 



■" ^ 









a 



saacaaaaacc 



< »i 



Classified Civil List — State Departments 



215 



88S8838S888888888888888888SS8883S8S8 



o 






8 

CD 



fill! 



N N 


« 


CD 


t* 


^ 


^ 


CD t^ 


r- 


00 


00 


00 


» 


X 


t* 


t* »«• 


1* 


»«• 


r* 


00 


»« 


r- 


» 


» 


X 


X 


X 


X 


X 


X 


« 


X 


X 


X 


M V4 


•M 


^N 


^i* 


1-4 


w* 


*H W^ 


ph 


*.H 


t-< 


tH 


r^ 


1">4 




r^ m^ 


9.4 


^•^ 


v4 


^i* 


<.4 


^^ 


1">4 


9.4 


1-4 


«H 


^^ 


f>4 


vN 


^^ 


^i4 


»i^ 


w* 


^^ 




9 




o 


v4 




V4 I>i4 


o 

vN 








0) 




0» 

9-* 




0» 

I>i4 


0» 

v4 




OB 

1^ 




v4 


0» 

^4 


0» 

1-4 


1-4 


0» 

r4 








a 




o 


v4 




'^•^• 


CO 


0» 


V4 


• 


• 


ss 


V4 


CD 

v4 


Vi^ 


•o 


* 


CD* 

v4 


• 


ss 


CD 

^4 


CO 

f-4 




VM 








^4 


^H 


^ 


CD 

1.4 


ri^ 


^4 


v^ 


»o 


1^ 


- 


^4 


1^ 


s 


Oct. 
Nov. 
April 
May 


Oct. 
Oct. 


•1 


• 


C 


• 

Ik 

08 


April 
April 




Oct. 
Sept. 


9 


• 

61 

s 


1 


c 

9 


1 


• 

2 


• 

1 


• 

o 


Sept. 
Sept. 
Oct. 


3 


5 ?■ o o "S 
Z66ZZZ.O 


N N 


00 


CD 


r^ 


CO 


^ 


to t« 


to 


I" 


30 


to 


t* 


t* 


to 


r* i^ 


CD 


to 


t* 


eo 


i^ 


o 


X 


r* 


1^ 


X 


X 


t* 


X 


t^ 


X 


X 


X 


X 


»" w< 




w^ 




9-* 


»^ 


v4 1-4 


^N 


^^ 


^N 


^N 


^N 


«ii4 


VM 


^^ 1">4 


r^ 


V4 


v4 


^^ 


^^ 


^•^ 


v4 


«i^ 


^N 


r^^ 


V4 


w^ 


vi^ 


1-4 


^^ 


r^ 


^N 


»^ 


• • 


v4 


0» 




• 


* 


0» 0) 


• 


o 


* 


o 

f^ 


o» 


• 






• 






o» 


o 

I>i4 


I>i4 




o 

»i^ 


o 


0» 




v4 




V4 


• 


1-4 


o 

I>i4 


* 



Nh.COa»»00»«-'^0»WCDCD«QOeOCSfcO»J«S|«800»t05ltOQ-*X»00»»^»-'5r^^*.'3 

ti m^ «-4ei'-4CiMe4Mf-4e<iso«-4 cle<i^cMC^N«-4i-i$si,-ig^e<« « ^^?^ i-t 



z< 



^ > > > ^ 

<J C 3 O tS 

C Z Z Z O 




't'tJ'^'^'^'^'v'C'S'S'cS'o'B'o o'o'S'o o'c'tJ'S C; C> C O t( C} 

l«bbUUUi«k.bkbl.Mkbkhtt4Uhifi>t-l-l.L.i« 

oococcoooooooooooooooooooooo 
z .5 .2 .s .s .M .a .s .a .s .s .s .s ^s .s .s .»« •— ■»• •— -^ ^^ -s ••" -^ "2 "c "a 

3 3 3 




3 9 3 3 



3 3 3 



333333399333939393 



3 3 3 9 



216 



Report of State Civil Seevicb Commxssiost 



d 

o 

i 

a 
6 



58 



•3-9 
S 1 

(Si 



a 



1 

••• 
a 

I 



Is 

S*3 



8 *. 




2 
o 

H 

1-4 

OQ 



888888S8SS8S8 



« 


QO 


00 


» 


« 


•Q 


•Q 


00 


00 


t* 


00 


00 


30 


w^ 


*4 


t^ 


«.4 


t-< 


*H 


vi^ 




1-4 


l>4 


«H 


^N 


1-4 







3» 




iX 


v4 








9 









v4 


9 


9 
^4 


» 


«d 


^H 





ae' 


0' 


«o 


© 





0" 




s 


* 


«H 


v4 




»^ 


»H 




*H 


w^ 


r^ 


1-4 








c 
s 


Nov. 
Nov. 
May 


• 

3 


• 

a 





c 

It 


1 


ft 


• 

ft 


> 
2: 


t- 


CO 


00 


00 


X 


•0 


iC 


X 


« 


t* 


» 


00 


» 


^i^ 


f-4 


vi^ 


«H 


»-• 


•H 


*^ 


»^ 


^i* 


^N 


•^ 


t^ 


^•^ 







•^ 


a 

r^ 








0» 




IX 




r4 


0» 
v4 


a» 








r^ 


V 


^ 


oT 


«o 


0» 




<o 


0? 


0" 


• 

to 


» 



ri^ 




w 




»H 


I>i4 




v4 


f>4 


1-4 


v4 




« 






^i^ 




, 












. 


t-4 


a 


^ 


3 ft OvO 

-< ^^ 55 fe -< 


• 


4-« 




• 

a 

•-9 


ft 


ft 


ft 


Z 



3 H 



£ : >;" 

SO 



32 



do 

I « 

CO 



w .e W 









o 






C g B ■ 

•o « ,-S 
•^ •* « 



• mm mm ^ ^ 

sill 



O 



S 

o 
»- a c 

it 2 

1 222 

2 « ^ 



i 

3 






5 5 



.5 



I 

o 






s 
5 






;3£d 









^ o 



M M M M M 



COGOOWH 



CO 
CD 




I 



•3 

m 



Classifikd Civil List — Statb Depastiuebts 



217 



8 88SS8SSSS 88 S S888 8S8 8 8S8 S 88 88 



I 



^ o p c 
•o « ei c 



^ CO ee ^ OT 



i-« ^ N Ol 



o Q n 

So GO 



00 S 

t* r- r- 



s 



10 

o 

01 



£ 

en 



! 



d 
9 



-a 

to 



I 

e 



■ 



•o 

O 



O 



« 






oc 


•-« 


t^ 


•o 


»o 


« 


r- 


r- 


8C 


eo 


<D 


t* 


<o 


«o 


CO 


OC 


00 


« 


CO 


«H 


^^ 


^^ 


»^ 


»H 


F^ 






t-< 


^4 


tH 


tH 


•-4 


!-« 


^^ 


-^ 


t-< 


v4 


1-4 








OS 


o 

1-4 


^4 




v4 


v4 








o 


01 


o> 


o> 






o 

^•^ 



o*>4v4a)*>4>Mv4r4<D 



r> 


S 


O 


h« 


ct 


•o 


ro 


«0 


h- 


o 


p^ 


f-4 


v^ 


v« 


w-^ 


■irf 


^4 




o 
•i4 


v4 


o» 


0» 
v4 




v4 


© 

r4 


© 


s 


1^ 


• 


0? 


t^ 


*4 


* 


1-4 


• 

<o 


- 








• 




_^ 


^ 




•c 

a 
< 


o 
a 
9 


•-9 


3 

3 


Q. 

(2 


Oot. 

Apri 


01 


M 

3 



o 
to 

3 



00 

•a 

a 



u 



5 



%£% 
««« 

5 = 1 

1-4 "^ ra 

3;:s 



il 

.2 « ^ 

CO ^PQ 



GQ 



® 2 2 3 3 

n o »^ <C CQ 



e o 



a 
o 



* 



**5 r -3 3 o 



e » c 
*^ rr! J= 

3*0 s 

« •-» « 





_g o 

^ W ^ 80 H^ I-* 



a .5 .3 

•egg 



3 

•3 

o 



o 



1-t M 



rs 



»2 O- 3 

5?; -< •? 









iH eo c« N ^ 



> > 



5<s;7.QsS;|^||||^ 



00 


1-4 


r^ 


w^ 


»0 


to 


r> 


r« 


00 


CO 


CO 


t* 


to 


o 


X 


cc 


00 


X 


X 


v4 


1-4 


v^ 


^4 


••4 


^4 




^4 


^4 


•-4 


«H 


1-4 


Fi4 


i-i 


r^ 


Fi4 


Fi4 


1-4 


v4 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


© 


^4 


^^ 


F^ 


1-4 


w^ 


^4 




W4 




V4 


v4 


r4 


V4 


F^ 


l-« 


v4 


»4 


1-4 


^4 


• 

w4 


r4 


» 


W^ 


• 
v4 


• 
v4 


* 


s* 


^4 


00 

^4 


00 


fH 




• 


1-4 


a 






Fi4 


Nov. 
April 


3 


"3 


• 

> 

o 
55 


July 

April 

Nov. 




Dec. 
May 


• 

e 


it 
s 


^ -< Z J2: 


• 





(3 

«| 

^ 03 

fl-O 

5 e« 

3 *** 



e8 





o 

-a 
? 

-a'^.2 
to jr -^ 

3 Pi 



0) 

> 

< 
£ 

o 



3 ^ C "3 *3 

W -Tl fl5 3 



QQ 



<N fO © 
ro •-■ to 
N 1^ W 



,2 O g 

3 3 

U » QQ 
X lO r- 

CO C4 © 



JO ^ 

o Is <s 
3 3 =5 
IS fl CQ 

3 . . 

f^ ^ ii 
QQ 3r? 



o 

i 

n 



OQ 

3 

SB 

■J 



g 

3 
OQ 






N 06 « 

M CO iO (x 

CO w «-< «-• 



O O o 

•3-33 

AAA 

• « • 

^ -^ -^ 

B OQ CO 

jQ .A .C d 

A R A .S 
CO CO CO 2 

^^ 1-4 1-4 X 
•H ^4 Fi4 t-J 



H 

3«2 

W O 
^ CO 



o 
o "3 

«; CO 



I 



& c8 









3 
h 3 

■8 




fete 

I" 

J! * 



Is a* 

« "tj «8 O 



1 



•- §^ 

^ -a ^ 



^5l 







d d c d c 

n « 00 B T 

• M vM a^ a^^ m0m 

ISlil 
1 1 1 1 1 "3 1 

• «4 •** '"^ ••• •** •^ •*< 

d d d d e d d 
M j: M M Xi Xi jc 
I g S S 8 £| 

HHHHHHh 



e 

s 



*^^»;»;^V; '?»'?:.'?:. 



218 



Rbpobt of State Civil Service Commission 



o 
u 



CO 






o 

g 

H 

CO 

O 

5 



s 

1 

I 



3 8 & 

-Si 

d 




« «. 




2: 



z 

o 

H 

03 



SS8SS 




00 X » lo o 

«M *M V4 ^4 V4 

Oi 9 O 9 9 

•M »* «-^ t^ fi^ 

r« b- 1-4 M f-i 

X 'i % >* 

-g a a S « 



« X X lO o 

VM ^4 «M VM ^4 

9 Oi O 9 9 

*H «M ^i4 t^ «H 

t*" i>r .M « f-T 

ism 




I 

c » : : 00 



M 



z 



.3 



5 



d 

« 

"a 

- « 8 

B s s t^ i 
^ ^ ^ .^ ^ 




s 



888S838S8S 
|||8||| 



1^ 

X C4 



O <0 O C4 



0» 






10 






op 


U) 


X 


•A 


r>. 


X 





r>. 





X 


c5 


*a4 


^m 


«M 


«-^ 


«M 






(■4 


v^ 


* 


0» 





a 


2 




9 






^4 


f^ 


* 


»« 
N 


• 
v4 


- 


* 






CO 


-' 




• 

9 
•< 


• 

e 




>» 

a 

S 


Dec. 
Nov. 
Oct. 


2 


> 
Z 


S3 


*o 


X 





r>. 


X 





r>. 


a 


X 





f^ 


w^ 


ff^ 


«-^ 


«-^ 


ffiM 


*a4 


^1^ 


w^ 


Vi^ 


9 




(■4 




0» 

v4 








9 

»4 





• 


1^ 




«-7 


tH 


• 


* 


W4 


«o 


- 


1 


5 

•< 


C 

as 








Nov. 

Oct. 

Mar. 

Nov. 



CO 



d 



O 



>. 

c 






-<r 



"3 

i 



QO 

8 



2 



« 
> 

o 05 






> 
< 

c 

z 



i?z 



z 

JS 



CI 



•3 -^C >- 






J4 GQ 

»- ^w ts 



z 



S3 



^ 5 t* 



zSlJSS 



D 



i 

JS 



II 



II 



• 

2 



b-3 






«5ClJ5? 



•^3 



u: 



S ?5 E 



c 
■*< ^ "-s 



(£ ic 

O 3 

z z 



I 



i, o. i 5 "S 

5 fi g a I 

g § i I £ 

1 - - I c 

2 « « 2 '"^ 



«8 



zzzS 



1 

9 

00 



.2 M 



.2 .S .2 "3 .3 .3 

«j 4^ ^^ «^ «j «« 

a e s a c d X 

O &) :« 0; C< c 2 

•O "O "w "O "O "^ *" 

(d (d ■£ ce ce %B ji£ 

c c d d c c = 

o o o o o 

o o o o o o a 



Ci-ASsiFiicD Civil List — State Depaktmbktb 



S383883388838838S88388S888S88SS33S8 

iiil§ilSSil§gS§§§IS§ligSlill§iii§lii 






iiiiiiiiliiillliliiiiiiiii 


iiliiilii 




- a 2 -■-■-■ 8- =■ 


i|||iii||S|iii||||||3|||ii 


iiiiiiili 


-.- _• «- -■ g ^ «• - -- -- _• » ^ of «■ «■ 2 -■ • r-: - «■ w -■ -■ 2 

ilJiilliiiiiitiiillliJfiii 


-■as'^s'ssas 






'"1 



sjII 



II 









5- : -"53 •ill la =^11 






sail 






III 

^fi nil 



; 8 S ■ 

I1 



llllll 



■.s 

jltl 

111 

■< oGu 



ifll: 



;|ii 



III 



III al'^lltttt 



220 



Refojrt of State Civil Service Commission 



•2 -rt 



Is 



|8 

*s .5 "^ 



5 I 



c8 •« 



8 ^ 



« 

2 



2 

o 

2 



S8S8888888888S88888S88888g 



88.8888 

C« C« C« PI M C4 



88 



go o o o 



g o rs 

C4 S M 09 



o 



oecoOAOoo<-«^'-i*^^^oc^(oeo«o^^cQe>iacx«9 

00)OIOObOOiOftO>OObOOOtO)OOiatOO>C&O^CDflb90 

.J >. M >*-• Is "c w *;>> o «• i rt* > rl -; rt -i §*;•?•: c ^ 



o 


CO 


« 


o» oo 


o» 


o 


^M 


«-^ 


00 




8 


•o 


QC 


o 


8 


« 


r* 


C4 


eo 


eo 


C4 


ot 


»o 


00 


»*. 


r^ 


V^M 


•^ 


i7> O 


flj 


l-< 


1— 


^i^ 


o 


^5 


o 


1— 


0» 


^^ 


a» 


«-• 


— ^ 


^M 


^M 


•^ 


^4 


»i^ 




0» 




00 00 


*i4 


o 

r-» 


o 




00 


r-t 




v4 


1— 


00 




00 


0» 














CO 


lO 


eo 


o> »^ 


CO 




* 


ec 


* 


to 


»*r 


^ 


<N 


* 


fH 


to 


^^ 


SR ^ 


cS 


^^ 


00 


CO 


»o 






IH 


IH 


*-l f-4 


N 


«-^ 




M 


M 


«-i 






M 


w 




*i4 




cl 


Ol 






»H 




^4 




• 

t 

O 


2;. 

"a 


• 


Dec. 
Oct. 


• 

s 


•I" • • T* 

P. & c> O. 


Sept. 
Feb. 


1 


Mar. 
Mar. 
Mar. 




i 


a 


s 


i 


o C. » » 9 

O "< fa Q < 









Classified Civil List — State Departments 



S21 



'S8S888888S88SSS8883838883S8383888iS 



§§ 



8S 

•e CO 



8 



8388833^338333 



?i 5 X « 



o 
r>. o "n< t* 


















■^ 

*» 



3 ' 



s9 



0) 



9=2 

3 a 



•N 



3 ^ kP4 A 3 



6C »< 

3 * 





sssssl 




8> o w 3 



tU h U h 
V a> » 4# 
ja jd ^ xi 
_ a a a a, 



.a .a .2 
3 8 



a 
o 




«a 



2 


>i 


1 




§• 


2 


a 


g 





H 


"i 




V 




^ 





222 



Rbpoht of State Civil Service Commission 



1 

8 






(» 

5 



d 

i 

J 



5 ^ 






•a 

1 



II 



9 8 




o 

H 

2 



8S8S8888S88SS8S888888888S8§ 



S 



§8S88S8SSSSSoosSS§SSS88qoc 

C)Vfri»o»oeofOwweo«cofOfO«co«e«ciwwe«wciwcs 






iO*O<-«iO00iO«M*4^4«>^*^^4v4*^i0*i4O'^*^ 



Ot Pi ^^ ^^ p^ 



cc90»a>xao2o5S»5xo»oS»oa9990»»o>o»flio»a» 



S" 2 "" •' -■ 5 "" ■"" "' '-" " a d "■ 8 -■ 2 a 2" S ■"" S "" R S 2' 2" 



^'^^ 3r^ 3:4 35 J 3*^3 3i 



^' >> M d C 




uuHU3M^u;H;ti:a 



Classified Civil List — State Depastmbnts 



223 



88888S8SS888SSSSS8SS88 



§§§§ 









S88888888 



eic«e«e«e«e«e«me«e«e«e«e«c«e>ie4esic«MMc«f^ 



sss 



M M e« 









O O lO 



a m Q 

►n 2 1^ 



09ioococo^eoeoeoeoeooe4eoio>Oi030Xqp 



Cf 



*4|P4*i4»i40e9«Hfi4^^ 



||i9-l|i9 



??9 

< •« •< 



""8'" 

*-» »^ *n 00 



O «-• 00 »-i 



to <o 



II 









lO lO lO 

»M »^ »M 

9 9 O 



^ JO ^ 

^ fa h 



lO lO lO 

*i4 *i4 ^4 

9 9 O 



^ ^ -O 
COO 

fa Db Cm 



o <o 

o o 

. o 



O (O 

O 9 



° 2 




o 

e 

9 

K 



<5Z5 
^r - 

> 00 



111 

r? (^ O 2 

§a|8S 

U h O 




h (• b 

I S I 

c. a A 

& c. & 



« 

a 
•3 

O 



a 
o 



.S J 



E 



c 
c 



hi 
» 
a 
o 

'i 

6 
i 



224 



Sbpokt of State Civil Service GJommission 



a 
o 



s. 

a 

o 
O 



d 




I 

o 

CD 

s 
s 

o 
u 



V o « 

:g « a 

P d fl 



1 



o 



8 88SSSSS88888S8S88888SSS 



8 



r* 
^i* 
o 



I 






I 



d 

08 
U3 



< 

a 
o 

% 

c 

I 



H 



o 
OQ 



1 



a 

a 



I 
I 



icMcocoe>9coeococQcoe«Me«e«e« 



oo«or-.»»»»»»»»»»oo 




30 !»• »» 


r» r* 00 


oc ae ae 


oo>a>c»990»9a» 


O) 0» O 0» 01 


9 O C» 
•^ t-» ^< 


a» o» e» 

^^ w^ w^ 


Ok o» 0» 


^4 w4 CI 


O «^ CD (-^ CO 

i»^ «-^ f-^ 


• • » 
^ ^i' CO 


» » » 

CD e c? 

^^ t^ ^* 


30 ei «-• 




Nov. 
July 
Dec. 
Dee. 
Nov. 


July 
Dee. 
Dee. 


Nov. 
Dee. 
Nov. 


Jan. 
Jan. 
Got. 


oa>o»aiOba»o»o»9 


0» S S O Ok 


as •». !»• 

•^ ti^ -i* 

e» o» 01 

t^ w^ —^ 


»» r» X 

^« f-^ «^ 
O Ok o 


« 30 ae 

^m ^m ^m 

» a Ok 

r^ «.« «-« 




CO »4 e r^ CD 

*H f.4 t.4 


^ ^ cd 


O'O CD* 

•^ »H •-» 


00 9 •-• 


lllSsslll 


Nov. 

July 

Dee. 

Deo. 

Nov. 


July 
Dee. 
Dee. 


Nov. 
Dee. 
Nov. 


Jan. 
Jan. 
Get. 



8 



^ s a § 

>^ J:§£ 
OQ 4 -< -< 



5: i 



• «i o o 

>> s ? ? 



S^ 







n 3 -M 



Z Gfi OD 



•« ^ ^ i5 K •« 





S2 



.1 

d 

'S 



6« 6« 60 
d ;3 

a -3 



d d .^ 

.2 'a I 

O «M 

o 



M M M 

S S S a 
"d "d "d '3 

- - - -a -a a 



00 ao . 
>, >, >i 



>% ^ ^ >> >% >% 

JS JS .d JS JS JS 

a o. A a a a 



o o o o o o 





d d d e d d ^ 
«« .5 «« <5 '3 '*3 ,^ 



••* ••* *^m - - 

JJ3» 






31 




^a% 



Clabbified Civil List — Stats DEPAsncBirxB 



S8SS3S8888SSS3S888SS8 



8Q O O 
O CI CVJ 

o 9 r>> r>> 



§ 



o Q S S 
i> S S r>- 



225 

8 



X K 


OO h- 


» 


o o 


o »* 


r* 


t^ 


X 


00 


00 


X 


»- 


r>. 


X 


r>- 


X 


30 


"^ p4 


*M pM 


^14 


»H piH 


r^ *H 


•<H 


f-4 


1-4 


^^ 


«i4 


»^ 


«M 


mm 


»-• 


»«4 


^4 


i>^ 


O 9 

• • 


3 9 








CS 

* 










1-4 


01 

• 


at 






3> 


a 

• 



^ ^t «^ O 9 



a p Q eo c^ CO 
"M 55 « 1-4 d i-t 



f-4 o o o 

CO ?0 •-< 









. 4) «i 

S § '^ 



■y. 



a s 



CS >c fH o 

^4 *>< Ol t-^ 

eS 4 P cS S 

*» ^ ^ •-» ^ <« 



aoKa9«ao9cooi^i>»r>>r^xxxi>-OkOeoxao 

i^P<0*i4li^»^»^»^^4^4»i4l-4^^«-4-4^4l^l-4«M»H»^ 

a990i0toi0i0taiO>0iaoi0i'y>9aoi0iCi0t 
"•iiiwp©c>pcJaoorco»^oo«»H«cipJ«V 

illllllllllllllllllil 







S S 






"g^=5W 



1 5 £ •§ J . S 



5 ?- . ^ C 





:^fti 



0,Q>ACQ.CS.D.AQ, 

M tc ti tfl 

_ o o o o 
aaaacsssa 



Qi a a Ci Oi 

« « « «: as 

^^ »& ^ 

o o o o o 



2 

o 
s 




OC'<'CQCO»33X'JQ73XaoOOO 



O 
CO 



O 

o 






a a a a o 

r- • ^i* ^-i 1-4 .-• 

a a a a a 



s: Xi ^ Si M 

,0 Ji Jif CJ o 



o a Ok a a 
^4 ^4 »M »— »^ 

a o a a a 



^ ^ ^ ^ .Q 
V o o a> v 

(S« Pt4 b pE4 bL4 



X 

wm 

a 






X 

a 






5 



c o =^ 

fl9 C 

C -^ Jitf -c 

" o o c 



•2 g ^ ^ i 

O a 0; a> » 

>* c ?: ?: ?; 



< 
O 

l-H 

CO 

o 



& 



C3 






j3 
u 

a - 

H 
K 

H 



a 

as « ^ - 



3 S= 

3 «* -t * 
.^ 2 •"* "^ •** 



«4 






h i. »4 ki b 

a< c; c» ii o 

f- 1^ ^4 «^ •« 

-- »rt ^ a^ »4 

.2 .S .2 .2 .2 

3 .1 J .1 J 

^« .M ^ ^ pi^ 

c c a c c 



c 2 = 



a a 



8 



C Q O 3 O 

o o o o o 



5 

I 



226 



Bbpobt of State Civil Sbbviob Ooioossioir 



I I 

8 



i 



^11 

11 
8-s 




o 



8 



8 



€0 00 CO 


lO 


» o 0» 

W^ 1>^ f^ 


01 


» « • 

1*- b- b- 

*i^ ti4 w4 


• 


May 

Dec. 
May 


^ 1 



CO OO CO 

>^ ^ »-« 

o» o) a 

•^ ^M »H 

* » * 

b- r* Is. 

t^ t^ ti4 

III 




««|5? 




s ^ s § 

scad 




CO 






SS8S 



CO CO CO 50 



00 

• 


00 A 00 00 
Vi^ Vi^ «H V4 

c» o» a 9 

vM 1^ *i4 v4 

- .— .• . 

b- 04 CO (O 


• 

1 


Dec. 
Jan. 
Dec. 
Dec. 



00 

^^ 
o» 

of 



00 ot 00 00 

rm w^ w^ t-^ 
9 9 



b- 04 O O 



O 



o 

g 

Q 

o 

o 

23 



o 

H 



& & 



^00 



OS x 

" B 



•4 
X 



i 



OS 
c» 



.M 



I 

I 



z 



6> 

s 



►3 •§ -S 1^ J 






H 
K 






& 



!S S' P 

« •*• * 3 

• ^» ■ - - 

■ r ■ O >■< 

M t^ >< . 

St «< ? 



1 



6666 



fe 55 H * 



CI.ASSIFI2D Civil List — State DBPASTaoEim 



227 



00 X 00 

r4 P4 VM 

o a a» 



00 90 90 O O 

^4 *H v4 ^4 iM 
9 A Ok Ot 9 



CO 



o o 



88825*^ a 



• > 9 

O 6 S 
^ 1^ •-> 



i 



■» "^ •^ w •-» 



> 

o 

2: 



00 00 00 
*N V4 rH 

o o o 



00 80 90 O <0 

ti4 1-4 1-4 r^ *4 

0> 9 Ot 0> Ot 



C «D 



S 



o e 3 
b b -» 



00 <0 « 00 b- 
C« C« M «H 

»n »^ Q *^ 



CO 

o» 

1-4 
► 

o 

2 







o 



H 



88S8S83888888S8 



p Q O 
^ Q gj 

<o o 00 r« 



SS8 



8^ 



f2 



u 



CO M M M •-• C< 



00 

a» 

1-4 


0» 
0» 


l» 00 ^ 

IP^ 1-4 1-4 

o» oa Ok 

(^ ^ »-« 




9 

«-4 


s 

^4 


X 

9 

^4 


«-4 

oa 


X 

»^ 
oa 

i>4 


oa 

oa 


CO 


1886 
1915 


— 

to 

1^ 




»H O »H 
r4 


1-4 


— 

i»4 


00- 


1H 


rH 


^4 


v4 


i>4 


s-" 




• 




• 

a 

A 


• 

JS 


a 




OS 


1 


qSo 


OO 


f-4 
1H 


t* t* 9 

1-1 1^ Q 
0» 9 S 

^ ^ «H 


00 

i»4 


9 

i>4 

oa 


00 

<-4 


f-4 

o 

«-4 


9 

«-4 


X 

a 

f-4 


oa 
oa 

i»4 


CO 
0» 


«p to 
00 *^ 
00 oa 


to 

IH 


^4 


1-4 »H »^ 


o 

1H 




— 
00 


l>4 


1-4 


1H 


^N 


i>4 


S^ 


c 

9 


4 


* * * ■ 


• 

1 


• 

> 

o 


• 


II 


• 

1 


8 m 



fi-ett^-e-B-e-e 



«l 






zzzz^z 






|5 



illii 



S 



.24 



«i^4 JS .£ ■ W OB 



^=^ 



a 
o 










- -S .2 .2 




'* CO X "3 Is. 

f^ l-^ v4 v4 ^4 

9 Ci o o oa 



CO r* r^ N 1-1 

•-* W (M 






5 « 'C jQ 



<f^ 



^ CO X >o r« 

1-4 1-4 v4 fi4 1H 

O oa oa oa oa 

•>4 fi4 VH ^4 fi4 

CO rC iC cs i-T 

^ N « 

(X, < Q < ^ 






O 
S3 

CO 

o 
o 

s 

S^ i S S g fi 

W °o I 1 1 - • 



g 



H K b3 Ix} 




3 



H ^ § 

< ^ ^ *-t -^i 






h h b |4 »4 

& tt' C» V 0) 

o a c d a 

o o o o o 

I J 1 1 J 

e £ e S 

S £ g a . 



228 



Repobt of State Civil Sektios CoioaasiON 



o 

% 

o 
o 

i 

en 



i 

O 
H 



i 

I 



55 



•s-a 



IS 



1 



11 



8 




8 

d *M 



ill 



A "** 



5' 



o 

H 

GO 



■s 

ft* 



;ii 



00 



0» 






eS 

s 



e iw 01 « ^ 

v4 ,i^ .4 V4 *4 

a 01 01 o 01 

«M *H v4 vrt fi4 

— ^ • • _ • 

o ». oa ^ ^ 

rH *i« ^4 v>« *^ 

01 01 01 a 

v4 1^ *>l t>4 ^4 

_• • • ■ • 

0» O 19 SO >» 



88 8888888 






5^ 

< < 



O 01 



d 

o 

•o 

d 

S 

I 

as 

8 
o 

P4 



iiii 



CV ^4 ti4 1-4 ^^ IM »^ 



e« 00 ifO CO ^ 00 o 

•^ O 50 •H ^^ .-I .-I 

Ob O 00 Ok o o o 

•^ V4 ^4 V4 f^ ^4 t^ 

«D O 40 CO «-« ^ O 

C« 1>4 <.4 tH 

ftl-l o "8 g o 



«-• 50 « e* CO •© ^ 

«-■ Q 00 vH <-i ,-■ «-! 
C» a 00 o» o» o o 



«-• V ^ «^ r« ^ Q 

»H *^ t^ ^-i w* ei 





a a I 

- - 8 8 8 

a '^ 'js 'js ',s isi 

QQ Ik* Oi Oi phi fri PL4 



CI.AMIFIKD OlTIL LiBT StATS DsPARTmOm 



329 



88S8SS8888S 
S888SSi888S 



« 


K 


« 


^M 


e 


» 


00 


« 


00 





00 


^4 


»< 


s 


W^ 


— ^ 


^14 


w^ 


»H 


w^ 


t^ 


^4 


O 





a> 


o» 








O) 


a> 


0» 


e» 


^* 


Fi* 


^4 


^i4 


1^ 


•* 


*M 


^4 


rm 


^4 


»-• 


•c 


M 


* 


CD 


10 


t^ 


^i^ 


•^ 


f^ 




* 

10 


^4 




«H 


PM 














^4 




> 



2: 


1 


s 


• 

e 


> > > ^ 

o c ? 

2 2Z < 


s 


0, 

< 


ac 


c 


fP 


»M 


<o 


00 


00 


00 


X 


t 


00 


914 




^S 


^i^ 


1^ 


»i^ 


^M 


r^ 


w* 





^14 


ct 


r<4 


V4 


pM 


Ob 

1^ 

















w 




* 


* 


• 
10 


»H 


«-1 


^^ 


• 






• 

c 
d 


Feb. 
May 

April 


• 


Nov. 
Nov. 
Nov. 


3 
•< 




< 




i> S O *■ 



c 



a 
o 

& 
i 



1 



^H-n 



If 



8 



1^ 



c 
o 

a 



o 



t 

03 



a 

a 
••* • •_ 



a 



e c 

6 



o 

8 



2 
«• ^ ^ ^ /* ^ 



^ JB JS JS 

3 <j V 



muuu !! 



b-h.<0(0«000»«0 

o»oo»9aksdiois 

*^ >i^ ,i4 *i^ «M ^« »^ 

««2 aaaSLcaa 

S S <^ -< <-< -«j << 



»»r>>cD(0«D«DGeae3v 

f^ '^ ^^ 9^ m^ v^ r^ 



60 

2 2 •o 

M OQ 55 








a. SB BsaBji 



a a 



S S S 8 8 J 



« ^ 



^ OS 






«»• OS 
00 o 



»o 







8 JS 



.s 

s 

M 



280 



Repobt of State Civil Sebvicb CoMUSSioir 



CO 

O 

CO 

s 

O 
O 

CO 

s 

a 

o 
o 



B 

O 

-a 

i 

I 

o 






s-s 



II 



III 



S 6 



1 - 

■e « a 

& « S 



.5 « B 

lis 



s 



2 



7: 

o 



CO 

O 

04 



s 

a 

m 

C 

8 

d 

P 



888888S 

o e o o o o o 



§o 1^ r>> o t« 30 

••4 o •-« •^ »« "^ 

Ok 9 0> Ok 9 9 

|ii^ ^^ »M |ii^ »^ »H i»^ 

•g 7 i e( 5 « « 



8 



1^ o 



r>. (O t^ X 



O »H O ^^ "^ ^^ "^ 

5 01 9 a» A e» o) 

fi4 «H fM •-« *^ 1-4 f-4 

Ok ip f-i' M 9 C^ O 

e« M M -^ N 



1^ 



2?^ 






O S *? S << S S 



• 
• 

m 

00 

•B 



11 



o 

sigl 

n fiQ 9 O ou 



I 




a 

« 

1 



C C tt & « v c 

d d c a e c 

o o o o o o s 

I J I .S J J J 

s § s a E E c 

a a g & I E c 



8888 



CO M M f^ 



8 



t 
o 

to 



*M v4 o 
9 Ok 9 

•ii^ f-^ v4 *i« 

• • • • 

u* o <o 

r« 9 CO 00 

So 00 S 9 
•ii^ f-^ v4 ^4 

• • • • 

^ n ^ 9 

nil 



H 
M 

H 



« 

u 

H 

a 
o 




(X4 o u 2 



JS 



5 



s 

c 

•a s. 
^ s 

V « A, ^ 



o 

c 

■ 

6C 



888 



04 



O 
9 



J3 



9 

*^ 

9 






9 o r^ 

9 9 9 

^« ^i* >i4 

•C N »0* 

»M «-^ ^< 

^ § t 

9 (D «r 

w^ m4 -m 

9 9 9 

VM viH Vi« 

» * w 

ON — 

5«» ^ ^ 



H 
ft 



8 



H « c 






ft 
CO 5 

2 



" < 

C _ 



s 



! 

H 

u 



00 

Is 

II 



Si 



X 









tab ^ ^ 



si 

1 « 



2 -5 

d 



3 



9 



&6 



Classified Civil List — State Departments 



231 



8 



n 



S88S888 

-^ «-• ^ « CO CO 



388 S 88 8 88 S8S8 8 8 SS88 mil 

'^''i|§i§Siiii5§§iii§ lliU 

88888 



coco»^de9«-*«^^«^>^ 



o 



a 



N N X X r« 00 !»• 

P4 .ri 1-4 1-4 ^4 PM Vi^ 

5> O O Oi Ot O Ok 



•0 ^ -^ 
^ M M 

fc •? O "n 



•n *n A ^ 



o 

o 



2 



t« O 00 00 («■ 00 h« 

>M Q ^M (a^ ^4 V4 V^ 

O $ 9 9 Qk O O 



iQ X 1^ *^ *^ '^ <0 

&« I-, O *-» >n ^ <4 



9 
JO 

< < 
2S 



o 

O 



3 



2 

S 



jIIi 




« 2 S-S b 



hi 



a G 






a a 



MS 



o a 



00 



Jtf ^ 



ii S » s 

-< •< a :» ^ 

_ „ 4* fc. 'C 

4> o -C Ji 5 

•s o I o g 

o a -^ c •« 

lliif 
1 1 •: -s ! 

ill ^ 



OS 

c -c 

c a 
••* ••« 

o o 




xr«r«r»<oi»r«'^^er«-«^oooo*ooaaoi»r«i»r>>b- 

O>OOIOIOiOiOk9OtOIOkOIOt9OtO>90kO)O>Ot9OI9 

'-»»-»'-»«^0»-»»nOO»^»-»0«nQ»-»'-»^a)'<(<i-»'-»»-»CD 
^QQooi-4r^<OAO^cih.eo^oo^iAOOoob-i>.|s.i>.|s. 

30Q0w«0k0a0)O0k0t0i0i9O0^0kO0fe90>0>990i9 





. « ^ . « tr iri . * 






His 



S g ^- S'5 s5 ^ 



9 
g 



ii 
S 



a 
as 

a 



S 



il 



s 

s 

.2 ja j3 g 

•m ^« •»« .2 
o o o -S 

. i !s S I 

6656 




s. 

I 

t t ^ t 

JG M M M 
Oi O. 0. P> 

O O O Q ^ 

a a a ir 
^ ^ 5 In 

OQ OQ OQ 00 O 




232 



BxFosT OF Statb Civil Servick Couxission 



5.3 
-it 

si 




CO 

o 

CO 



H 
H 

g 

o 
o 



i - 

1.1 .H 



I 



« a 



2: 
o 



88 



88 



8" 



o di di 



--gg 




CI 



11 ii 






r» 1^ 

** »^ »^ 

01 « <» 

* » * 



e n 



G 

3 



11 

i§ 

sa 




c 




c 
C en 

•il 

JS -S 



3 S88 



P9 N »^ 











J3 

c 







« 






-* C9 



• 



!? 

S 



9 



a 















K 00 O 

^ OS -^ 

9 £ o 

»* »^ »^ 

520 



C9 OC O 

-- © i 
9 ac o 



•^ C9 



.a 






I: 




> 

-< 

> 

eo 
Si 



e c 

11 

E B 

6 E 



o 



(3 



Classified Civil List — State Dspabtmekts 



383 



8888888SS8S88888S 
l§S§§§Si§iSi88| 



*4*4Mp4«HdMrHrHrH^^^^^^rHrHrH ^H 



S S8SS 
§ §S|8 

m5 o o k o» 






> 
O 



rH*NX^HffN*4w4 ^ 



-• o o o o 

»rf «— I O "^ "^ 

o> Ot o o o 

f^ t^ f^ •-* ^^ 

n K> fi ^ vS 

^ CI M 



n 00 



ll^|||||gs||||||| iml 



•QXt«ro*«ocr^K>ccQaoxAMe4iwx 






o <o 



CO o ^^ «# fo 



B * & - 






^c 



2 



» 



^•^ S 

'^ «( c ^ 
•0 35 S 00 

oSCh 
310 ». 









►2 - 



i 



o 

CO 

«* 



3 



» 



'5 

o 






— - — lO ** ^ '- -^ *- 



"--■^IsaiJSl 



•O (D 




a 







mil 

00000 




CQ 

Ok 



g2 


^ 


Nov. 
Jan. 







1913 
1918 


Ok 


C4 ^ 




Nov. 
Jan. 


• 





04 t^ e t« 

^i4 1-4 VN 1-4 

9 9 9 



le CD 1-4 1-4 

M esi 

O c "3 * 



d r^ tte ic 

•H 1-^ O •H 

9999 
»^ 1-^ ^H ^^ 

a. » » » 

80 '^ 00 
M »M M 

2:qoj« 









ua 



H 



5 

5 
o 









i 




284 



Kbpobt of State Civil Service Commission 



H 



25 
o 

CO 



a 

o 

-•3 
el 

a 

v 

a 

g 

o 

O 



fi S a 

a 




I - 

•gil 



B 



o 



O 



8888SS88S8 



CO « M 



K 


t* 


52 


«•• 


00 


00 


S3 "* 


» 


O 


VH 


f-4 


C5 


^H 


»4 


^H 


8S 


^^4 


^^4 


o 


e» 


s 


9 


Ci 


o 


c» 


Cs 




*M 


9<4 


^4 


^^4 


^^ 


*ii4 f-4 


^4 


^H 


* 
^4 


IQ 


• 

f-4 


• 


^4 




• • 




rH 


»? o * 

ozS 


a 
-< 


n3 

hi 

< 


a 
< 


July 
Atig. 
Mar. 
Feb. 


M 


,^ 


N 


«<) 


t^ 


X 


t* ^ 


« 


c 


8 


^^ 


8 


r^ 


vrf 


^^4 


s s 


1-4 


vrf 


C» 


a» 


Ci 


o» 


o> 


a» 


^M 


^^ 


VH 


Vii4 


^4 


*^ 


•■4 f-4 


»N 


p4 


• 


• 






1^ 


^ 


f-4 f-4 


w4 


1-4 


• 

O 




May 

April 


3 


1 


May 
Mar. 










o 



55 



•*• w> "^ 



73 



CO 



s 

U 

H 



o 



Q 
08 



S •H 00 

J5 »^ "^ 

TJ TJ ^ |C 






■ * 


• : 


• " 


6 : 


: d 


• 


.>* 


• 


■ z 


• 
• 




•* 


■ • 


CO • 


boo x . 



o 



^8 



•5 iS 2 - -i I 

2 ?: w 



94 »0 





888888 

9 o S S 9 S 



CO e<4 30 X 

1.H «-«•-• 1-4 

Oi o> 9 o> 



^ « ^ ^ •-• S 

ID S W C "^ »n 



to e« (30 X n go 

*N •-4 1^ •-• o o 

9 Q O O O Q 

*N ^H -4 ^H tM »M 

'^" S2 S -^^ -^ 8 

0, a c. ^ g 2 

ID 2 05 C »-» »-» 



nil 

^ "S "3 -S 
J3 Ji j: a 

t 

O O O as 

00 < 



ii 
22 



88S88 

»o eo CI ^ i-< 



»-^ « >» 




o: 


Ci 


cs 


Ci 


c» 


»H 


1-4 


vrf 


^4 


^^ 


© 


Oi 


Ci 


o 


o 


»H 


*M 


•^ 


*M 


^^ 


e 




e 


*-4 


— 


a 


^ 


• 


Si 


jS 


a 


OS 


e: 


^ 


,«' 


•-» 


•-» 


•-s 


&C4 


c 


c» 


Ci 


^ 


Ci 


*■< 


^4 


r^ 


^^ 


^H 


Ci 


Ci 


o 


Ci 


o 


^^4 


1-4 


»rf 


*M 


*N 


a 


^^4 


o 


•-4 


^ 




c 


^ 


• 


.d 




e: 

•-9 




fc 


'X. 



a 

< ^ . 6 
. c >» > 






or: 



h28 






5s ^ 






C e: •= 

c c "2 s -= 

c o c ae ^ 

T^ T V :5 83 

*2 *-• "-i ^ ca 

•<n *5 ,< jg *^ 

S E < -i ^ 

H cu 6 M s: 



XI 



X 



Z -3 . 

"C *- w 1- 

S rt *« 6 

ti u r a 



•6 ^ 



c c. t o o 

S s r - e 

« ZI >r — *4 

-5 * « 9 

a >k c .*4 T) 

^ r! «5 ■-■ y 



2 «a ■• 
5. — "^ • w 

% C (I4 OO 



Clabsifibd Civil List — State Depabtubrts 



S8S8SSSSgSS8S8gSS8SSS8S3SSSSS8SSS8S8 







C52 = 


SllSill 


isSsisssSaslSlssI 


sli^iS 




h 


IJII 


tmm 


immtmimh 


uml 


11 


iiii 


iiiiiii 




■o o »e ^ o: 


zSzzsszsszzsszssz 


Ssl222 







llhiVi liiiiiiiiiJilniiiiiiiiNiUs 

ilimi illJlllJiJliliiiiiiiiaiHiii 



236 



Bepobt of Statx Civil Sxuvice Commission 






o 

i 

o 



I 



1^ 

all 






8 

l-s 



1 

} 



•& 



o 



888888888888888S888S8S88S8S 



§8§$S8SSSSS8S88S8S§§S 



Ok S 



OaD9aob9a»9keiei9koooa>a>akoa> -^i-- - 



S3 



O Oft 



O 9» 



t« f-4 PH PH 



»^t*»»HfMfMCOi-<«* 



fM 1-4 1^ C4 11*^ d 



"» < » "^ "^ 



si ^' i> si fl ^ is >> ei ei fl 9 9 > M ^ si > >» !S !2 >' 

_«akaa»akakaakak9a»akaa»afto»a>eSS9boaft5o)3> 



t*,Mi-<i^Oi-<r«i^^p4C0,M^ 



IQ MS «-• ^ 









C5i 



j3 ^ jj 



< &. '^ 



3 3 




i s i s §3 i ;; 5 s $ :: ^ 8 



I- 

Gei 03 CO 



a 






e 







IB « 






e 



III! 



S 



ajo 






o5 




» 



fifelS^'S^. 



pa 



3 



2 « 



00 0^>^<HO<a^tf.4^:i3 




>}>i ^ ^ >i >» >^ >» 




.C X 

a s 

IS 



Classdixd Civil List — State Dspastioehts 



237 



8 8 8 8 8 S 8 S Si 8 8 S 8 

22222** ****** 
^^^ja^jo-S-ija ^jiji JO 




(SoSSflk 




8 



CI 



8 






9 



C 
08 



O 

a 



G 
OS 



5 



•i 
1 






c 

08 



O 

o 



•-9 




o 






I 



9 









I ! 



00 



e 






s 

o 

d 

o 



I 



a 
«> 

s 



8 
S 












! 



I 



238 



Repoiw of State Civil Service Commission 






o 

1-4 
1-4 

a 
a 

o 

o 
o 

CO 

o 

H4 

i 





I - 

•SOB 

III 



8S888 888888S88888 



2 
o 

H 

00 

2 



N 



kO lO lO U) K3 



«o»'t<*ccweoeoi^*ii^«-«i-« 



888 



88 



h> O CO 



*0 00 O CD QO 

VH fa4 ^4 Vii4 ^4 

Oi Ot O Ot O 

^N ,.< 1-H ^^ »^ 

a» ^ CO CD ^ 



OtOQOt^XOOcOOXOXOO 
0>0>0)0k000ft0t00t00> 

8 



KHf-HQOvHvHofvHtOairOO'^ 
• H »w ^. n3 O -H 



9 c! ^ ^ e 5i * ^ S C ^ ^ "S S 'Si ? > 



»« 00 

s s 



*•• « lO 



IC 


00 


r^ to 


00 


1.^ 


^H 


Q «^ 


Vii4 


e 


C» 


S c» 


o» 


rH 


1M 


t-t 1.N 


w^ 


a» 


1-* 


CI CD 


• 


• 

1 


m 

a 


July 
Mar. 


• 

a 




" 'S S9 8 5 

IM 9 *?* ''^ '"^ 

15 fill 



o oo 



c> 5 



1-1 10 

OS ^ 
•-9 -» 



<A 



U U tm ^ U 

c c) 3> 9 a» 

9 a a g 

^o o ,o ,o o 

J .1 J .S J 

I s e a £ 

s s s g a 




6 

flS 



o 



l|l||li||il§ 



I § I I s; 

a a s a a 
o .9 Q o o 




Classified Civil List — State Depabtmekts 



239 



888 



n M K 



N t» r^ 



•? 3 3 



Z r 

* - i 

io o 

52 S S 



88 



>o ^ 



88888S8 



e« I* r* I* t* »• I* 



S Ok 

^ i-i 

*H lO 

II 






Ok S 



d S.O ^^ si 



888 



<0 O 00 



May 24. 1017 
June 16. 1917 
July 1, 1917 


Nov. 1, 1916 
May 5.1911 


Jan. 1. 1912 
Deo. 1. 1916 
Feb. 19. 1903 
May 3.1906 
Oct. 21. 1914 
Oct. 1. 1911 
Deo. 1.1916 


Oct. 1, 1911 
Mar. 19. 1917 
June 8.1916 





t^ o 

t-t .H 

Ok Ok 



82« 





s 

e 



•^ 1 1 1 1 1 



a 

o 



c ^ '8 '8 'i '8 'S 




%%88888888888 8 



! 



N 

A. 



888S 

r^ K *•• o 



kOCO'«iCOCOiOiOiOeOC9C4C9<-« 1^ 



r^iOQeqKo<-)t^cQ9>OQO>o 

OkOkOkOkOkOkCkOkOkObOkOkOk 



X 

Ok 



fii^ «-< O "H ^^ 1.H 



i.H^^e^f^'^oo '^ 



3 






« « 






:il:i 






Ok Ok 



r- « o » t^ 00 »o 

SI.4 ..4 5 o O •-< 
Ok Ok O wk O Ok 



O «^ O r^ (^ 

^ C9 W4 



o 

a 

3 



«* >> 



00 o »H ^ 



« > 



lll:llai 



N i-i •-« 00 

fa O •< 2 



Ok 



3 

1^ 



I 



o 

O 



•§1 

Ok Ok 



woSg 
a • « 

't i-« o 



«2i 









00 



a S 
•o 



^ "2 15 

U5 •» O 



8 

PQ 

OQ 

U3 



lO 



: g 

R>* < 

In 

PQ dS 
7 Ji 



> 

< 



•as 




eS 

s 

eS 

CQ 

Ok 



O 

H 



S :3 



il4 

i "^ 1 a -i « s 2 -^ a 






240 



Repobt of State Citil Service CoMMissio?r 






H 

CO 

a 

o 

1-4 

a 
s 

o 

o 

O 

g 



S 



s 

•3 

a 

o 
O 



St§ 






'-I 



I 



II 



Is 

•R •!* 'C 

I s * 



s « a 



! 



-g. 



2 

o 

H 

CO 



8S38SSSSS8888SSS§8S8SSSSSS 



Si 



«5 o O O O O 



9 0» 



*xeielo«oooco«*•^^e»•c^•c>lo55o?9co 



2* c^ c « 



COCONC4C4MMMC9 



9990k99oo>cioiaiaio>a>oa>o)a>a>oiO>a)a>a>ofeai 









>> ! -M 



0:g 



t53 « 



« »^ 






0k9A9A09O&0>010>09O0>O01O0l$ai0S9S0>0i90> 



^ t£ tS ^ ti f£ 
>• ^ - -^ >» 



Ol 






ill^lliililllllll^li 



a 9 o "3 • 




mil 




35 ^ 3 ' 









3 ^ 5 f 5l S 3 




8 

•5 

5 







^^ Ml if 11 11 11 1 




^^«<^^^<^^^<;^j;^^ 



Classified Civil List — State Departmettts 



241 



S8"8 88SgS88§SS8gggS88888SSg888888§8S8 






^ ^ GO 30 X 

m^ 1^ w-i m^ ^^ 

o> o o s c» 






^^ ^^ *^ *^ ^"^ ^^^ ^■V ^■" ^^ ^M 1^^ ^i4 ^^ ^^ ^rt ^m^ ^i4 ^i4 ^4 ^i4 ^"^ ^^4 H^ VB^ ^i4 ^^ ^^ri ^^ ^^tf ^^^ ^^v 



^ <^ 00 ae « 

•ii« •^ l-H v4 «4 

Oi o c: oi a 






0; C 



0) V rs 4^ 



t; >» -^ ^ 






>^^5 



" *»* ;S ** J J 

GQ ra CB j2 «» 






a 

o • 

o : > 

QC ft A 





cocceacs 

sssssSsS 
§•§§§§§§§ 

iiiiiiii 

QOOOOOOO 

•^ •^' •^' •** *^ ••^ ••♦■ ••« 

*» ** ►^ «^ ►^ »^ ►^ 



a a c 

5« « 

§§§ 
§§1 

«r cK tf 

(•Ml* 

o o o 
•3 -3*5 

•n "n *^ 



a a 

ss 

§1 



•^ "^ 



«» -J ^ .S. .2 



5| 

5^ o 



it§ § f sla 

« « « & 3 8 -as 8 8 8 18 8 1 
.||.||S||||||||3l 




242 



Report of State Civil Service CoM\assiON 



8 

I 

H 
O 

g 



H 



o 

a 
a 

o 
o 

I 

CO 

o 
3 

i 



•8-9 



^ 

tf 

Q 



If 



all 



•§ ° S 



I' 

^ «• s 



i 



o 



o 



888S88S888S88888888SS88S88 
§§§!§§§§§ 



o 

S3 



8 



oioo»eia>c»5A90ka»obako»oa>Ac»a»9oaka»e»c»9 



* - * ^ '^ s *" a 8 a s 8 s 



•-< a» »H «<i i-< 00 »* 



SSS-^'-^S^S"^ 



M e«neS(e>«ci»H 1-1'*' c^c9i-t 1-1 e« 




S" " fl d •3 li J 

So. 

.• 5 •? s-ff & & S 



? 1 < -g S 2 s a I ^ H -S i § 8 3 cu 1^) I 

IIJIIIiilil|g3glllJl 



« s « ^ » § § 

u3 jQ ^ .a ua js u3 



Piap>ap.Pbaafii&::.Qia 



Pllllllllll 

OAiAAf^GQCQaOOOCQODGCeCCJQQCGQOOOQOOOOaOoCQQaOCC 




&OOOOO0OO 






Classified Civil List — State Depabtmeitts 



243 



8883888888 8888888888888888883888888 



o 



8? 



op 00 QO 

o o o 



o o o» 



o a 






0)0>0t0t0k0090t0k 






w 1-1 el e« 1-4 






•^5 ^ 







^ 









ro^t^tDQOx^o^(0(Ot«^<Dot^t^iot^30QOXxaotte 

OiOiQ090:OOOOCiO)C>OOOk90A3)0>90)OtOk 



w wM ^4 c^ cv v^ 



M 









*M^4 C^G^vi^ C4C40 C4i-4MrHCli-4 l-4f>^*-4•■« i-h 






a 

o 

o la 
a - 
C 

||gili||gs|lifi| 




I 

CS. 



»« h ki h 



•s, -a -a -t •§ •§. "t -a -t -s -s •§ •§, -t 1 -i •§. -& •§. -a -i I 



o o 

00 CO 



lllllll|lllllll!II§§| 



244 



Report of State Civil Service CoicMissioir 



a 

o 



a 

o 
O 



a 
o o 

2 ** 






11 



^ 8 

o - > 

S S I 



H 
O 

I 

g 

o 

1-4 
1-4 

s 

o 
o 



8 • 

Ml 



I 



o 



00 

o 

P4 



88888888888888888888888 88 



S 8 8 8 8 8 S 

9 



8 

o 



OOoOOOOOOOOOOOOOOOOOOOO 



t^ 30 

o o 



^1 «^ 



OC*30i-4COp<p«^^^tO<r-lt^h>CO*OtOi-li>H^«-i 



ft^ >k •*• 



? © 









oooooooooooooooooooooo o o o 



Q'^•o«oo»HCDpco^*^^co«-4^.^«roco(01>^«-|^«-l 



o ^ ^ 



So 



a tt a es 









es cl 



O 

0; 



> 
O 



:; S5 12 c ^ S s: ^: « 4 fc! S :? :S ^ iq z < ^il < S 5 



•c-n S 

a a 9 



9 






? 






««« J 

00 BO 33 "^ 

1-N CO i-< C^ 

«o el ^ (C 



>^ 



B g ^ .00 
* « 2 !^ *o 



: : 1 r r 
'*' «-* . ** «« 

W) M ,^ «3 CO 

-^ -^^ J^ -ja a 
•»-• -o ro -o 2 

1^ (^ N «-t in 



2^ 



9 ^* S ■**■*'•*'*•** ^^ 



••-• W •«•• W K 

d <r-l «-4 C<( 4.4 



«o 40 ri 

••H TH •^ Dl ^^ 







.4 



.6^ 



- - § ,15 



-^1 



9 00 -t^O 



S8 

O 00 




E 



a 

a a 
= l5' 










lllllllll, 

nmn 




^ X ^ 

a a a 




9 V S» V 

^ J3 ^ 43 

a a a 



illllllllll§ 

OQOQQQQOOQCOCOQQXfiQQQDOOOQGQaQaQdDaOQQOQCOaoOQB 



I 

I 



Classified Civil List — State Depabthexvts 



245 



S8888S88SS3S88888SS8SS88SSS8S888S388 



SS 

O 9 



s 



3Si|8i3SSS383838 



Qer^r^i^r«H*t^h>oo»Qeoetot^t^»«t^t>«r^t^QOaot^t*oeQ09ox'30QOooQ03090«>30 

ooa>ciokoiaio999ookoa>99a>a»ooooa»o)a>o>o>3)Ooa>o»oa>ak 

oak09akaaak99oaoakaiooo)09a)ooo»ooo:oa>e)0oa>o>ai0k 



-^ o c< 



■^ c* ^^ »^ »i^ ^^ •^ 






»^ X t^ Q 0> »^ 

^ »- 55 fi N 



f-i iP^ «-4 o at *^ 



iilijiliillsiiliiliiilliiiiiiliii 



& s- ? 






lllllllllllll 



w »• 



a fit a a a a a a a a a a a a a 

S ^ S 

_ _ a M a _ 

oooooo__ 







246 



Repobt of State Civil Sebvice Commission 



s 





111 

& 



i 



'S 



i 



o 



CO 

O 



8888888S888S888888888S38S8 

333 




^SSSS 



•M ^ '«• CO CO 90 CO 



•V ^ t» 



M 04 



0000Q0W3030XX»»XQ000«O'«iC0a0C»Xa0««)00XX30 



X»-<CO»-<c^Xt*XCOi-i»XX 



► > 
o o 



e^xt^xcoi^fOXxa»^*H«^(0<-i>^>-4^ooxx 

<'2. ^y. -% ^ ^'^, < S, o ^ ^ < A o 6% ^ 'If-. < < 

XXXXXXXXXXXXt»O'^t^C0>070C0i-<C«''0XXX 

od^co«-^NX»j'Xco«-^coodoxoo»i^»^«txooxiox*x 




a 

a 






<0 



^ S "; -3 :5 :., x g 

MM hX ^ ^- ^^ — ^ ^ ^ 






• M Jd J^ M 

M • u t^ u u 

T; . j; ^ «, u 

JS J o "o "o "o 






aas.c::;2.c.s. 



Qu)&M,-Mb£6l6!l&)9 



o 

c 



O" o c 
sees 

^ s ^ ^ 

re -Xi x 'j: 



X 



c 
c 



()0 

2 

■—> 
X 



je ^ M *i 
2 



c c 
i^ is 

X X 



o 



2 

o 



t t t t 

Seas 
V O 8) 



1-3 



X X 



1^5 « » S 5 8 
X O -< tf O O O 



-Si "S 

II 

« la 

t: -a 






C C 



.a .s 



3 3 

'mm ■«« 

a 3 



II 

■3-3 

3 S 

a » 
ki hi 

o o 

•H-3 

3 -J 



Classified Civil List — State Depabtmentb 



247 



88SS8888888888888S8S8S888S8888S8S8S8 

8S$S888S888§|Si|i 






88 



MICMSOC0C0C9C0 



ooiOKt*r^»ooooooooooo«oo30oo««Kooco»io«02«^«22222225222 



N 1^ N 



ooo»e»o>oo>o»o>o»oc»o>c»oo>o©o>o»o»o>o»2222222222222 

-"" 5 S 2 15 *** "^' '"* 2 **■ * 8 " S S 2 2 :: 2 J: S ^" 2" 2* 2" S 2" 2 8 2" g 8 fe" 2 S * 




•i* 'i' -^ -^ "H 

^ b !• H t9 



^ b 



S£ £ ± ^ 



£ JiC JM JM J^' 




/ 



248 



Hepobt of State Civil Service Cohiussiok 





XI 




s 




IS 




9 




«> 




a 




a 




IS 
«1^ 




III 
II 




a 




Is 


1 


5«l 

* ■* ■ 




5|| 


E 


s^ 


w 




1 




s 








^ 


« 


ft 


•.- a 


in 


^ o s 




III 




I'i 


Iki 




O 

1-4 






QQ 




OQ 




1-4 




a 




x 




o 


1 




se 


ta 




x^ 




iS 




9S 




m 




xn 




o 








>-) 




g 




^ 






K 




o 




^4 











8SS8SSSSSSS§iSSSSSS§S8S§S8 



»— I «— « ♦H «— « ^N »H »H ^N «i4 ^* ■^^ ••-<»-«»-l»-««-4«-<»-«^N^^'»-« »-^ ^N ^-4 «i4 ■^^ 

*^«-*«-i_J'»-<ro«i«^«-4«-<*-*0 CO »H'»-«coo»Ht-4*do«ocot>r^|C 



-* 


CO 


<0 


« 


^ 


r* 


fr- 


t^ 


CO 


*o 


CO 


r- 


r- 


o 


r- 


r«- 


r- 


r«- 


t^ 


t>. 


r«- 


CO 


£C 


X 


oo 


CO 


»H 




••H 




VH 


'^4 


^N 


«i4 


«i4 


••H 


fH 


•1^ 


•-4 


^4 


iH 


^N 


«-4 


«^ 


•-4 


^N 


<r^ 


^■t 


*^ 


»-4 


^■t 


<^ 


O J0» 












o 


0> 

*-* 


v>4 


•-4 


at 


94 






o 






f-4 




o 


c» 




o 


O) 


«>4 






O .T! 



^ O 









o 






:o 



1 K J T 
3 ^ CD -M 



^ 



-4 00 



i-J 



3 

n 

& 

ft. 
6 



a 

gco 



T CO 

a -" 
o -^ 

*0 '^ 

O O) 



A ;$; 






SO O) C4 O 
«-4 ••H »^ «-4 



^ £0 

.is 

C4 O 



CO ^ 

a d 
•2 -a 

«-4 O 



■^u 



n J 

9 CO 

a « 
u a 

> ct 

< Q 
CI -^ 

«-4 00 



T S 

'<3 



a ■ 

2 : 

So 



o 






i 



CO c^ 

ro -^ 

^-1 CI 



= 3 



a: 



a ■ . 
^ :o 

5-3 O 
O M 



a 



>» ^- O M • ' 

b « -S ^ li 



e ■ 
g >» • 

■ 2 • 



: o 



o 



2: 



2: « 






S-2 

O 1; "3 
^ »^ ♦*» 

■M -- Q 

•^ M Q 
"^ CI O 



2 S 5 

o cc o 

ro ■•-• ••-4 

-* CO iiS 



- X 



if X 3 

CO o 1^ 

O f>. o 

»-4 d ^ 



.3 r£ 
CO to 



• >» 

• A 
>^ r s 

. «» >> 

. ^ o 

• «< o 

CO -^ *j 
^» 13 X 

*>. Q CI 

C« S 00 
» £0 ^ 



>> d t« S 

3 a js 8 

o 6 a CS 



»- -a 3 o 
3 $ 






1^ 



^ as 

ft* 



£3 



a) 






a 

a 



»5 






.s 



5 <v • 



O 'Cf >» o 
M 4^ —• JR 

J fa ^ 



d ir 



1 



a 



tc 

J2 



3 



> c 



» a « 2 § 

«_i=! -d 2 a 

O ^4^ ^ Z0 



•§1 £ 
£ 5:2 



• -a .- ^ 

•M "S '^ •** 

g 2 g -S 

^ r: a » 



?> ^ :a 

a 3 £ 
2 3j5 



•M«M«MJidJM000000030000000000000 

£S«SSadaaaaadeaa;;:aa2aa23da 



CLAflBinEi} CivTi, List — Statb T^EPisnaam 24* 

88888S3SS38SS3S38SSSSSSSSa8SSgSSSSSS 



E.Sa 



1^ 



i !ii ti 11 *=i^ I iii ^I ilk 



Hits 4| 



Illi 



lllliillllllliillimillllllllllllli- 



250 



Report of State Civil Service Cohmissiok 



rim 



! 



s 

•8-9 

<5?^ 



1 



d 



I 




1 1 



I 



•& 



•I 

2: 



55 

o 

H 

9} 

o 

PL4 



88S8883888888388S888888388S 



8 

04 



t* t* t* 



c« e « 



■O t^ X X 4D O CO 

rH i>4 i-l rH »4 i>4 vi^ 

Ok o) 9 o> Ok Oi Ok 



XXXXXX30^Q0b.XXXXXt^XXQ 

oooc>OkOi^o>aa>9ao)OkO)0ioo9 

111 I «^ liii ^ « ^iJi I II ^5 ill ^li 

XXXXXXX-^Xb.XXXXXt^XXQQOiOKXXOOO 

oota»a»oo&o9Oo&a»a»OkOka»90iO9OioiOiOke>999 



111! »iiiiij9ii^^i ill 3 3 iiiii 9 



a 



s 



8^. 



A 


n 


> 


^ 


• 


< 


QQ 


5^ 


-0 


e^ 






.1 


X 




M 


i>. 


s 





o 

h- . . . 

e^ CO M M 




e 



C 

«e 



c 
c 



rs >» 



c 
c 



1 



X 






13 o fc c 



•£ JB &< '5 < 
a r^ a J3 



c 
c 









s 5;^ . -I ^ "3 



:4 s 

08 S 



f z 1 5 = -J -3 






%<'^t- 



^ 3 « 
2 2-^ 



X 






lift CO 



c 



o 



l.^i||lljliisllill|i|i irlli 



CS <8 •*• 



ii 



fflO 



je ^ ^ Jt« ^ Jtf ^ 

Im Im ki h ll Im h 

« 0; Of C C & C> 

TJ -S -S 



o o 



u 

c 



& o o o 

ki u »• u 

o c c c 



c 

9 



c 

9 



C 
9 



B 
9 



CSCt«MMUi6CUKeCti&C&0 
S93eSeSd:3«Se3e:e3c3e)eS^ 




Classified Civil List — State Departments 



261 



8SS8S88888888SS883SS83388888888888S8 
s9SSSSsSoo55QQSoS88oSS^'dQQSSSSS 






CD 



8 

CD 



o»a»o»a»a»a»oia»a»a»e»S 



3Oc0<<rc0KXC0QCXOO^K^iOiO^O>O^«O4D«D 






g»a)«-«a)^Mm*-tc«9^i-4M)(o*-tcocDCDcD 






^32 





CO 

A ^ 00 

O « ^ O 

v4 ^4 1-4 ei 



CO 




a * 
^ 9 ♦ 



* 



^ 4 2 » B o a 



C3 



i 



G » ^ C gj 



BO -< 



C 

as 



a 

e 



U^ 



U b 



IIIH 



o o « 



a a a 

POO 



e 
o 



o o 




G 



•« b Ih »a h ki »« 

§ I s 2 £ t £ 
o c c e a c s 



• m mmm •«« spa .im •^ ,^m •»« 

aaaaeace 



vvvv&vcoo 



s $ 

a a 



U ki 



III 



i 



lllllllllllf 



S ^ t 

2 2* 
1 1 



« .H 



c 

11 

« -35 



•f« tfi* "f '^^ •«« •••« •-« ■«■ 

U^bbi■hhlM 

S9 V c^ e> V v 9 






^ 5 

t .2 



2<SeS^cS:Js;4 

"" 2 .a .5 .2 .2 .2 .2 

m 7. a r. 6 T. 

< ^ «< < < < 



k< ki (• M Ik 14 k 

S 8 S S 2 £ I 

si-riiilil|il 

8 8 1 8 11 "2 1 1 1 1 "? 
n c -c c c I '5 1 1 c -c 5 

*3 "3 » "SJ "5 "iS "S 



p o o c^ 9 

iS JJ J2 ® .£ 
® "S "oJ *« "oJ 



o o o o 

• «^ s^ cv^ '^ cv^ 

a a a a G 
d 3 3 d 9 
•n "n •n "n *n 



^ >-i b i; b 1^ V 

o o o o o o o 

• •ii* •*- "^ '^ -^ «^ •mm 

*-»'-»»-* ^ «-k *-k *^ 



252 



RiPOBT OF State Civil Service CoMiassioif 



a 

o 

I 

K 

B 

o 

O 



B 

If! 



a ^ 
a 



«8 2 * 
8 •« 



V o tt 

f.§| 



eS 



s 



o 



li 



SS888S8S8888888S8S88S88SS? 















■a W «4 a^ 










o 



H 

H 




11 



- - * - « 

a e e c 

-& -&'!'&'& 

c a a a CI 

"i "21111 

.£ .S JS .s .s .§ 
"B "S "i* *« *« "cJ 

s ^ ^ ^ g s 

•M ■«■ VMi >«« CM ■^a 

decode 
9 9 9 d s 9 




a> S « S 

1111 
X X X X 

V « V S 
TJ U *«) "S 




c a 5 a a a 



g 



ss 



sea 

sea _ „ _ 



11111 

e e e c o 



11 

si 



|11||| 
llllll 



s ^ ^ t ^ ts ^ 



o 

9 



§ 



a -a I -a I -g 

e e S e 9 



8 « S 

XXX 

"S "S "S 
e 9 s 



€> c/'S'S o'S^'S'iSXXXX'Z'S'S 



S 8 8 8 e 

X X X X X 

•«rf W «* <9 ^ 

w £ u o v* 
V X "« "S "S 

1 1 1 ^ s- 

9 9 9 9* 



Classipied Civil List — State Departments 



258 



8SSS8SSS8S8S8SSS88888888S8S888SS85SS 
SSS88888SSSmr)to»rt88S88S?iSS$S^SSS8$^?i§iS 






<« CO O O MO 









0099090000000)000)09000^00 O O O O O 9 



0» 9 O O O 



<« ee o o MO 






=5^ 

a ck 



ioie«ie«)«-<feicierkO«e<-i>eieoioMico«Me<i^»ccu3«^^r«e«i« 

Vi4 tMC* r^ ^ ^ w-i vHviHCi i-«»HWCS CO »-• »«• 

Illll^llslllllll 



3 






lllllll<Slls|S| 







llsllsii 



H 6 



I S g s 3*3 S'g'S 



2$ 

e 



»« »« w w 

t t % t 
a c a a 



mill 



t Si $ 2; 





h hi »« 

Si s s 

ace 

S g g 



B D s 9 9 



^6^1 



ttt 

^ g ^ 
111 



(4 h) w hi ki 

S S £ t Sj 

a a B c 

^i ° 

« 8 • _ 
"<B "8 "S "S "S 

g ^ ^ ^ & 

•§•3 -a -a -a 

9 9 3 3 3 
•^ t^ t^ ^ 1^ 




ccaccccsc 

" ~ 1 e g 8 1 1 1 

i :s 3 3 3 ? 3 

C O c; O O V V 

O 9» Ci ti t* V V 

*S TJ TJ TC "ol "aJ "S 

h k h U h I, b 

o c o _o c o e 

g .2 *2 c *S *2 "S 

3 3 3 3 3 3 3 

•n ■» ^ ^ •n •-» ^ 




254 Hbpobt of Stats Civil See vice Commission 



H 
CO 



o 



s 

o 
o 

H 
U 

u 



I 



a 
:S 

a 
<3 







^11 



I 



•I 



I 

•I 



o 



88S88S888SS888888S8888S88S 

^' ^' ^ C4 c« M c« e« M M M M e« c« M e« e« M e« 04 c« c« m" e« w* « 



oooo«i-ico«e«eoeoeo^eoeo»OK«o«eocoe«g«c55;52e5 



»c 



l-4^<iH«0i^«^«^«^<DO>^ 



2'"'"'-S 



tH tH tH to ^ «M 



W •-» »^ ^^ 






• -^ • • • . • 



i ill II 



<< O {£ Q 






GOococ>->>oQ!9«P^99coeoceo^S3t^3rSS9S!S^S 



^ I 



OZ>* 
Z< J 

J I? 



^SS^|883 




1-4 ^ ^ 



& 9 



cOfc ■ 
« 

a 
tn B 



E • a s i - 

?i— •!* flffi «»*■• llA. 








HI 



8 8 1.5 .a 





4 



sill 

IJUIllJ 



Classified Civil List — State Depabtmxnts 



255 



8S8S88888888888888888 88888888888888 



QQQOQK)«OK)iOiOOOOOOOOO 






e«c«cic«c«cie«c«c«e4MMC«cie4c<esic«e«e>ic< 



M W 



otak9akOio»ako»akoaka>a»ooBa>oe)OiakOi 



udt^ooooooxooaoaoaoaooooooo 



^ lO »4 pM fH «x 

-sit 93 € 



^4^4ri4^4^4^4vi4<0v^'H*iN^4«H(>4 ^^pS^^^^^*»*»^«^»^^^^^'~' 












iC 

8 



eo^OQOOOMeoraeocoqpcocoaocve* 



•iN Oi I* CO CO 1-- i-< 



00 00 

d 

SS 



1-- 01 
CO ^ 

• • 



^•OOOCIKt*'**^ 



^ ro *«J o) *^ 



Sz4 



OI990>999C>OC>0>000> 

^ad5^K«c«cwsocj«^od<>odod 

illilljiilliil 

::6::cj:::':'c3* 
: d >; : : ^ E : : : : : i? : 







•i 8 






lis 

ills 



t 




K 
O « 

a o S 



o 



J § 

3 -o % 

S CD T! 

3 & c 
^K4 






.a 
o 



*j j§ X 

in 

0^ Ck Ik, 




'& 'B '& '& '^ 'w '& 'Q '& 
cdd dddddd 



•* «• *• *• ^» ^* ** 

dddCdddec 

sssssssss 

•pH CM -M •■4 •wm vM •#« 





Iti I tt $ t % Z fi t t 

dddddedcdeasd 
dccddcdddcc 

• «3 a? •S •S aS •«« « 7 •«■> SM *^ 




256 



BspoKT or SxAiB Civil Sebvice Coumissios 



8 



e 

0) 

E 

o 

a 
a 

o 



« 


o 


zi 


1 


« 


a 


a 


o 


U 


o 




S |S 


« 3 -s 

sl 


a 


>|8 


O *** ^ 


III 


5 *8 


• 




8 ^ 


Jo S 


3 «> a 


2.S.1 


l-sl 


^ * 


« 


a 


48 


$!: 


5?: 


o 


H 


OT 


o 


Pi 





S8SS3S888SS8SS8S8S8S8SS8S8 

8888S888SS8S8SSSsSSSS§i888 



eO 04 04 « i-« M t^ 






M M « 









eeo^9^«>4»>«-<<-i«^ 



e o so ao 
w ^^ ^^ •^ 







•2 

S 



o 
Is 



S : C 

•- • a 

•^^ = J! 

"H • ^ 



c d e ' 

«S £ 18 - 

•5 1-S^- 



if 

o 






s « S 



o \ 
«p .9 



» Cn ►^ 



c 
as 






m 



lie 



a £ 

-I 

IS 



c 

c 



es 

flS 



3 



OD 



i 

O 
_ Si 



•§ 5 < 






c9 



^ s oj O :S 



•0038* 



E 

"2 5 1 




Illllll3s 




CLAsamss Civil, List — Stats DESABTltaKTl 



S8888888SS8S888888SS888SSSS3S33SSS33 

ISSeS!§Sggi!SI§iiliiiSSiiSSailiil|i3 



iiiiiiSiiliiiilijIilJilJiisisiliiiil 



ilillllillllitiilllliliiiilliliiiili 






.■ i i i I ; i is ; : ; ; ; i ; : ; i ; ^ ^ ; -I :.i ■ ^ ; ^ : : : 



liiSi|l||f||ir "111 || i all 



1 1 1 1 1 i I i ! 1 1 1 1 H 1 1 1 1 1 1 i 1 1 1 1 1 1 i S I S 1 1 ! I 
tllllllllrlllllllllltlllTlllllllllll 



258 



Rbpobt of State Civii. Sekvicb Couuissioir 



§ 

i 

I 

6 







a -8 



8 - 
c ^ c 

•a • B 

a*i Ok 
« « ft 



7i 



S5 

O 



S8S88 8S8SS8 8S8 8 888S8S8SS88 






s 



0)^ioc«a»co^^fH«^ 






CI 



slilil'^;?!'^ i ^ i 9 il #-8 11-8 il I i s 

^^e4eooo^M^^eoeoc«co90c4«Dco«oicicioc«eo ?3qo 

O0k0>0i90kO0i0k0t0k0>0>0>O0A0i0)0i0B0iO0B0> o>o 

« c* ^r-i c«fH (^ci*^ »i^e«»^ i-«^w 






c 

flS 



I 





4^1652 



HSIIISHillilHHHHIin 

*a '& 'a 'A 'A '& '& 'A '3 '& 'a 'B *& 'A '3 'B 'B 'B 'B 'B 'B 'B 'm *B 'B *B 

gggggSgggggggggggsglgggSgg 

• P^ •»• •p« •9« •*« aM aM v^ •»« mM •^ ••^ "^ ••g •*g -^ •?• "^ "^ '^ "^ •S 'S — S V2 

NaSeaadSca^BSq^HeeccgBgcscs 



Classified Civil List — State Departmexts 



259 



8888 88S88888888888 88888888888888888 



x«raaoaoie^io^aoaoaoaox)xooxoo 

< ^ < 



a a 






ris 



ra 



_; *^m _f c*^ rz* rz3 

a JO i« S L< ki »• 

« « Q. • a a a 

^ fa, < Q ^ < ^ 



r^t^»«.coooQOaoooacxooQOXXooi<*t* 
if ©--JS^ 9 aaaS aaaJSa s» s 






^^ .^^ .^ ^^ ^^ mm^ aa^ ^i^ ^i^ ^mJ m^ m^ m^ «arf mm^ m^ m^ 









« ^ 








si 






01*13 



2 £ «» 
** s n 



s 







AflQS»4^S^^ 




8 



s 



2J> 

:2| 



^^41 "S 



II 



(2 



M a 



g jC • • •§ 

i I s s •§ 
A ^ ffi n A K 



.S.S 

t 

9 

o 






8'i 



a 
o 

-3 

o 
O 






• « 



c !; !; ^ 

rli 




iiiliiil 
•flit I'll! 



Sv^SvcSSSssi^ 



o d 



m'm 



a e e a fl 



« «> o « 



«> e 

- b fe ^ b 

O O O Q Q 



1 1 's ■rill ■till ■ft ■!■&•§ 



i« i-i i« 

O O O _ - - ^ 

d s 3 a e a c 

3 9 9 3 9 3 9 



Q S 



O Q 



h I* l« 

O Q Q 



& 



& § & O O O O O O O C o 

• «4 cfl^ apV vfl^ vff^ •«• cr^ •«« vt^ v^ •*■ •*« cp* v^rt 

dddddddddsesae 

99999999939999 



280 



BxpQBT OF Stats Cfviz. Sib.tice CoMifiasiosr 



g 

M 
GQ 

a 

s 



a 
e 

I 

I 



•8^ 

S8 



S " 



•a 
I 

11 



3 s 

"8^1 
If* 

fi 5 'SI 

c -8 







o 

H 

CO 

O 



S393S S833S3 SS8SS33S8SSS S 
S§3§§ §3§§§§ §S§§§§§§§§§§§ 

<<a^^ 2^»?o<< •<«<-<'?o *»?»2;S^»?<-? 




-i a 5 " - 

« r « 5 « 

^ ® © S «o 

i» « r2 r^ «» 

•-» p^ ^ CO o 











"So rc%si isS^ a 



/f 



Ills 

S d 3 cs 

• P« •«• «*i* •^k 

?« 9 « 
a :i e 
o. «. a o 

s ^ & & 

c -S '3 '3 



1 

a 

3 



.3 
•3 

3 




as?.. 

O tt « tt 

§ ^ § § ^ 

•*^ '^ --^ wp* •#« 

a a o 3 3 

3 3 3 3 3 




CuwBiFisD Civil List — State DEPAETMBwri 



8e88SS8S88SS8S8SSg88S8SSe88SSSSS8838 



S S M S 2 - S "^ 2 *" IS "^ *^ '"' '~' 3 ■* ■" * S ••' £ R I; 8 ''^ 3 S "* " * 8 2 8 " 8 

flliiilissfllllsl!lill!slitiilllllli 



ill i-l II 

■SiS lit II 



£c 



1 = ^1 



UUiHi 







i1f|| islfli 
sssmiieiiis 



fllilllflllililllillfifiliifiiiillil 
lllliillllltllillillHIIIIilililim 



262 



Report of State Civil Sebvice Commission 



II 






i 



S5 

O 



GO 

2 



// 



8S888888888888888888S8S 



t^KXQOaoa090ooooaoQOKt^t^t^KXKaooob>xt<« 



*c 


eo 


«0 M 


N 


•C 


« 


o 


<o 


« 


iC •* 


to CD 


>o 


t* 


•« 


■* 


»o 


t* 


^ 


t^ 


t« 


"^ 




i-t w< 


*H 


f- 


^4 


^i^ 


^^ 


^4 


»-l t^ 


r^ t-< 


^4 


t-1 


•-» 


IP^ 


^4 


»-4 


^4 


i-< 


•- 


• 


01 




3) 
1^ 




3» 




9 


*-4 


S> 06 


OB 0> 




o> 


O) 

•• 






o> 

* 


9 




ot 



^Qr«a»«0'-ie^^t^oco^o»>OQcob>nratO'H<Ne): 







1 1 


1 


* 


S 


HSSSSSSSH 




1 






h 

s 




1 


•g-s 


s 


■& 


a 

1 


c s e c Q 
'S: 'S) -S) '& -5i 


s c c c c a 


s 


c 
•Si 


a 




c 
w 


.5 




ss 


c 


s 


a :: c c s 


s e c c e 


c 


e 


3 


3 


c 


BM« 




v 


« 


V 


V H if a V 


eu «> V 0) ft. V 


o 


V 


&) 





4) 


V 




S 8 


i« 


1 


b 




ki I14 ki b h 1. 


u 


u 


u 


k, 


u 


h 




o 


o 


o g o o c 


3 


«v 








D 










S c 


c 


S 


c 


'S 'a '2 "5 2 

3 3 3 3^ 


c 2 2 2 2 '2 
^ 3 3 a 3 3 


/^ 


c 


C 


a 


a 


■>4 




"-» ■-» 




■• 
•n 




"-5 


3 
<-> 


3 


3 


3 


3 


m 



Classified Civil List — State Depabtmbntb 



263 



SS8SSSSSSSSS8888SS88S88S 88S8S8888SS 



siiii^iisiiiiiiii 



s 









^<^e«D(0(0«ooci(0(0«M 



«D •a «i4 



lO <0 ^ 



1^ M 






Of ^ *» 
3 « O 



o d Sq o 



00 00 *-• .M 

o a a 



^ ^ ^4 Cl ^ CO 

§^3 ^ g. ^& ^^ &•! 






'•WW 

1-» « 



^ M wa ^ 






^4 



2 



e 



2 **■ s" 2 "■ "■ s S3 *■ n "' *" a" i « s g " 2" s" s « s 









4 







3* 

II 

2=0 



o 

3 






T5 
1 



a a 

o = 



1? 

< 

04 X 



SO 



4 

S 7: 



9 s I 
2 2 S 






'Si 

e 



J4 

o 
u 



a 






la 
£s6 



II 






O 

O 









— «• "^ 

a 5 ° 

X •-» fe 



Q . 

. 04 






q 






« 
a 
e 



- H 



d 
96 










.§1.5 J .3 .5 .S .2 .2 .2 .2 .2 .2 .S .2 .2 III I I i i I I 
1 1 » ^ I I S 3 3" ^ ^ S 5 ^ 5 ^ 1 1 1 1 1 J i J I 



s S S S S § 2 

d 3 3 3 :3 S 3 



OCOOOOQOQOOOOO 

•«^ •«« •■« .^ ■■« a^ •«• vtf^ aa^ ••« mm* •m* •*• 

ddddaddddddqd 

333a.a333S*39333 



O 

'S 

3 




«• ^m* mm* ••« ctf^ vtf^ mmt mmm •«■ ••« •«« •«« •*« v*^ ^a^ ci^ C^ "(^ «^ • 

dsddddSdddd S^4l.^%AA 
as*3333333S9 ^aBaoo^o 



264 



BzpoBT OF Statb ClVIIi Ssxvics CoioaBSiojf 



H 

CO 



ft 
o 

1^ 
CO 
CO 

a 
a 

o 

o 
o 

g 

CO 



s 



a 

i 

i 

& 

E 



s « 
•8 .a 



•a 



'if 



OS's 

8 "3 



I - 

ill 

»- ■** 

£ - 



o 

H 
to 



I 



5 



// 



SSSSgSSSSSS888888888888S88 

§§i§§§i§§§§gii§§§iii§iii§§ 






0)a»e»a»9>a»a»a»0) 



:g S »? S 4 <5 < -< S5 * » « * -< < < o 4 < < o S S S 5 



iiiiiliiililiillsiiis 



C4 
C4 



'^ O '^ 



h S; >» ^ 



e 




<M O lO lO «9 
M -^ N 8 M 



CO -• '^ 




e = e c 

J 5 5 5 



e e e 



iiiiiil 




C P P 



a a c 



1 s .a .a J .■ • « 



e 

9 



C 6 

= C 
3 9 



siinii I 

§ .| .1 1 .§ .§ .S 1 .8 1 1 .5 .5 .1 .§ .1 8 .S 1 .1 1 s 



CiAmarBk Chvu. List — 



sss 



assssssssaassaasassss sassssasssssss 
ills §l§§i33l§31i 99399 iisassissessss 



<« M9 r^ r^ 

•« "^ "♦ •♦ 
» Oft a a 



e« :« le e« i«> <0 

at a Oft a» 5 

*^ ^« «^ «« *^ Vli« 






liiiiliilJl 



HMliliiiiili 



01900)90^0)01 



tt Ok Oi Oi Oi 



r^ «e o 

P^ -14^ >H 

O Ot Q 



»« »«• o 

•"♦ »H •-^ 

01 O) 0» 



'•^'•SS^S 



t^e«ofe«^^«^io(p<oi» 



fc-^IS 



of »C o c« 



a to o 

■** w >» 

°"^ s 

ae •-» ^ 



O f-) to 

3 O o 
<^ O 



^ M «* 9 « 1^ • P 



« ■< 00 •-» *^ ■< O »^ 




i4 80« 



-3 W 

§1 ill ill § 



I 





•2-2-Sg-a-s-Sc-a-a-a-a-ll 



■^^ ^» ^^ ♦• ^» ^» «« 

llllll^ 

Itllili 



d 3 



Q Q g § 3 ^ § 



S S fe 

•^ "fa "^ ••• •"• •«> .•• 

3 2 2 3 g fl a 

3 3 3 3 3 3 3 




S66 Ejbpobt of State Civn* Sebvice Commission 



3 

s 

o 

o 

CO 

i 



E 




1 1 



E 5 o 

J- '-^ '5 
•a «« Sl 



2 

O 

H 

CO 

S 



SKS 2 8 8 8 8 8 8 8 8.8 8,8,8,8 8 8 8 8.8,8^8,8, 



I 



88iS8SSSSSSgSi|§§|| 

oooooooooooooooooooa 



1^ 

OB 



V 

o 



C« CO 

Ok 0» 



^'S2g{8d'''822 8 2«^2Sa8 2 2i* 






e^ CO 
Ok Oi 



tti tti t* c% ^ »n to 

«M •^ »* tii^ 1^ •-< •^ 

OI o» a» Ok Ok Ok Ok 

^^ 9^ 9^ fi^ P^ w^ ^4 



OkookoaoaaosoiaiOkataKOkO 



«• gj* ^:222J8iVg«Vg2~225a8222* 



(S 



11 II 



C. 







^55 to 






2w 



CO 



I ^ s g w R 

CO *H « ^ CO K 






^* ^m ^^ ^0 -^^ ^^ ^^ ^^ ^^ ^» 

II Jlllllll 





c e c c 



c = = e a 



.s .a .5 .5 .9 ' — 



mis 






6 SgS^SS&isS&fe&^g&S^&SS 



§ § 



c e 

3 s 



a 
9 



§a a a G 
9 9 9 9 



szeoccae 

9999 = 999 



Ci^ssiFiED Civil List — State Depabtmeittb S67 



S8SSSSSSSSSSSSSSSSSSS88SSSS8SSSSS3SS 

lliisssssssiiissssssslsssssississsss 






a E s *■ f "" 2 s 2 8 -" g ■=" «■ 8" -i s f -" '•" ^" '■" a * 2 ^ " a ' a =" a s 

ssllllllllli^mllllllillll^Jll^lll 



6£|'H-3 :| :o ' 'S -til 



11::^ 






z.? z-i 



iB :j! '^ *^ s; >• Z i; f 
r^ E^Z ^S 



I I ll mill 



ill 



IlllJIIIIIIIIIIIIIillllsllllllllllll 
Itllirlitllliflllllfllllllilfliiilll 



M8 



Rapomr or Stats Civil Sebticb Coxmission 






I 

H 
O 



00 

01 



o 

CO 

m 

a 

O 
Q 

Pt 

a 

> 

Pi 

M 
GO 

O 

g 



f 



s-l 

a 



"S-3-S 



8 - 

5 ^ a 

l§| 

4 



I 



55 
O 

H 

O 

flu 



w 



SS8888 S 8S88SS8SS8SSS888SS 

|sssss s ssssiississssissss 



»- 0^ »- »- le 0^ 

r^ r^ r-i ^4 9^ m^ 

O O O Ok Oi O) 



o» 



O fO <P 
M C4 



<D »- 00 






09^oa»o>oa)oo»0)o»oka)e»oioo 



o 
O 



o 



limtsiUih 






> 

o 



222222 2 oo»oo»o»oo»o> 



O O O O Oi 0& O) 0> Oi 9 




V* «« «* «A «* «« ^a ^a 

*3 *2 *3 '3 '3 'S *3 ■ 

.2 932220 o 

9 B 3 B 9 B B a 



llllllimsiimi 



I 



.9 

I 



b ki 



hf »• 



.9.9 

u 



ilii 



.2 2.2 22225o5oSooooo 
e 3 3 3 *3 "3 '3 '3 'S '3 '2 "5 •» •" •* -^ -S 
§§339339SS3S Sacoa 



OLAasmsD Civil List — Stats 'DKrAarmxwn 



8888888883SS8SSSSSS8SSSSSSSSSSS88S8S 

3S38S3S3S3SSSSSSSSSSSSS8888SSSS8S8B8 



a 2" •" s 8 2 s •" "" "' - a -" • 3 =' 3 3 s" 5* I '*;: i -" s s - 2" * » s s s s" 

lJliiiiilliiiJ2jjilJlJiiJj||}|i!iiii 



i|l|l|-SS«|Sii^siSS|lli»|!l|l}llSt!ts 



li 



I|jj3|is 






§1 ^ £$siisl^ ^§§'^ ^si^'^ siiisilS 



III'' 1^ ill} 



„_, ,5 ill ; ;i| 
|si Ifs Infill] 

I IJI III dlllll 



llllllllllllllllllllllllllllllllllll 

||j!i5|||||||||||||||l|||l|||||.||-|.|.|.| 



270 



Kepobt of State Civil Service Commission 



d 

o 

I 

& 

d 




o 

eS 



I.S 

g-3 



8 w 

c ^ d 

3 » S 

c § S 

I- I 



88883888S88S8888S888S88888 

oot^t»r^t»t»ooococ<9o 



§S§i§§§iil§ 



^^cocQcoeo<0iococoe9eMe*ic4fH^c<Mc« 



0«0>OtCi990%OiCiAOftOO)0>0>0)0 Ok OkCbO>0>Ot OkOl9 









ao O O CO « 9« o 
O •-• •-I ^ o o o 
9> Q 9 O flk O O 






fH 1^ fii^ (-^ 



CI ■^ _i _i ;>! ,.4 A| 



ci G 



> 
o 



"C ^ >k ^ ^ M 



«* . « 



T bo be 



d 



C4 



e{ 5 5 s a ^ a o. a- c. *? d » "S ii g « a s d « d ij' S « o 







d •- a 2 

fcj • "S r^ d • M W > O 




a a 





^\^t ll^^ltl 



a d d o d 

mil 






Classified Civil List — State Depabtmbnts 271 



S8 8S88SS88S888888SS88S83888S888SS888 



^ OD S 









S 03 lO 
CO CO CO 



CO CO 



3 



o 

8 



3 



«D CD 



e^coooaococoeootOiOio>oi^iQ»c>o»oaQ09MC4Mco{Mco^eo^co«f<co^coco 

090tOkOOtOiO>OQOftO)0>OkQOt3>990kO>0>0>0>0)OOkOOkCbO)0>OtO)OOt 

•^c«^e«cfh^oic»«Ohrcoo»h^«o«oc»crt^oiooc»VorM^-^^rhr^co'^^^f»H^ 

a 



•rl •-» 






oSMOOooeoooco»o».o»oioioo«c»ocoio»qo$eiwoconoeO'*oO'i<cO'»'c«Meoco 

^ O ^1-^ Cl»-I w4 r^ Ci w^ ^ e«IM<^^^M'4 CI C*PI 

>> s s 

08 a d 
^ •-» *^ 






O 

♦J 





£^ 



i^ri^l 



> 
• o 



•« ^ 

5=^; 



a 



.1 



V CQ 



O CO 



3 ^ 
_ 3 

S 



S 



§00 
C .a 

< >' 

^ i 



o 



3? 



2: 



5 i 






rZ 

♦» , 

O CO 

^ oa 

S 3 

ci 

M CO 



a 

I 



CO a 
00 K 



06 
zz 

r - 

> ao 



> I* 
1-1 ^ 



M r 



o 



OJH 






^ >i !^ >i 



d 
5 

d 
O 



00 

?0 
C4 

I 



.55 ® 

^ I* g 

ill 



GO 



> 



O 
^3 

dsf 



s 



-^ d ja j3 



d 
o 



d • 

M . 

•2 00 

V o 

d v^ 



-^ 00 O 

SCO ^ "^ Q iH ^ 
>H r^ C4 2 f^ e« 






^S 



■ 

■ 

> 

s 



^ ? '^ J I ^ 

M O ^ *** •S «N 

"*• 01 o e>j S. f 



« CO -H 

-- «M 00 



1^1 

M •-• OQ 



d • >» 

PQ o *^ 

^ CQ o 

o> o «^ 



d . 

^ r 
is o 



•ii^ ^ »-« ?^ t* 



QQ 



00 



^a1 




IllaiillllJlilillllll^ll 






llllllllllllllllll 

I I I J II lllllllslSSj^MJIJsJsMjJfiSJ^^^JJJ 

•M JSi JS mm JS mS ••? •S ••••'• ••^ •«■ '^ • 79 *9 ■•***! *^ '** ^ ^ i* ■*» i* ■** -tS «I «9 ^ «I 49 ■•3 ^ «I ■** ^ 

tnmmmnmmmiiiiiiiiiiix 



•€ 






< < < 



2T2 fisPOXT OF StjLTE Cll^II. SsBVICE CoMMMBIOlf 



B 

ft 



I 

CO 
CO 

o 

g 

CO 

o 



! 





8 « 
1 = 8 



2 

o 

CO 

S 



tf 



8338SS 88SS8388S8S888888S8 

llSssi §§i§§3i3il§l§SSS§8§ 






^^ a^A ^^ — ^ _^ ^^ ^^ ..^ ^^ _* —^ _^ ■ 



9 •« «^ f« ^14 ^4 

*H CO 09 

»» •< (^ < J5 •< 






0% 01 ^ 



llllllllllllllllla 






ce ^ <«< <« «D o 

v4 «4 ^^ *i« »4 «4 

01 Oi Ok Ok Ok « 



• »^ ""^ t* 

f-« eo M 



mill iiiiiiiiiiiifgiiiii 



! 






5£^&> 



c « e <a « -c 

i «< < ^ 9 "* •< 

g £ 1 E E £ a 

JS JS 55 5 5 5 



a 



« « « 4 S 



c c c a a 

as as 



« « 



c a -c 



c 

llllllllllllllllll 



CiAHSiriKD Civa, Ijbt — Stats Defabtkxstb 



278 



§ S S S S S 8 8 8 8 8 8 8 S 8 8 S 8 8 8 8 8 8 S 8 8 S S S S 8 S S SiJ'o" 

is§§§§§i§§§§§S§§§§§§§§S§i§iilii§i§§§ 



22S222222222222®2222*2*®»»®<»®c»o»o><»<»o® 






22222222222§2222i8||88i858SS55SSSSoS 



i 



"5 






t^ r* 









Mini 






fe X 








Sir 1? ir i? b *- *« 
o o c o o o o 



u u u 



C C; 






q q q o o 

t t t t t 



tm U 



ttKKK 



lljsjssjjajijiii 

M tC tC tC U 

c c c a a 



*. -c X •?: X X "c 

- - c 



G G a 
XX XX 



caacSqaeocc 



_ tc 
c a 
X X X X 

a G a a 



o 

CB 

.2 

M 

C 

c 



u 

ss 

3 9 

C X 

S; Si 

a G 



tm tm 



o 6 o q q c o 

*» i^ ■** *i ■^ ■»* ■*» 

O O O V C> C o 

S S 9 



^s.E.a 



« 
e 



9 S 



SSS?Sgg' 



13 8 



». C X X Ik l; i. 

i t i s s S t 

c o o c q c a 



274 



Report op State Civil Sebvice Commissioiv 



H 

CO 



ft 

o 

CO 
CO 

1^ 

a 
a 

o 
u 

1-4 



/ 



g 

i 

c3 





8 ^ 

-a V 

? ^ :3 



2 

O 



8 88SS8 88 8 888S888$$^^^^<?<?(?J' 



aoaoooooooQOWXaoxQOooaoaoaoQOXQOooooaoaoooxaoao 



9 v o u o 

w « £ & V . 



SOOVVOU9UOC>OQ90VVVOVC< 









? O O 



Ilia 



u >> 



•? c2 fe S dS o o S a < 






O CO 

^ »-< w 



. c -^ 

> M^ 

B ou CO 

a •« ^ 

SCO •-• 
C4 M O 



o ■ 

•s-s 















I 55 ^i 55 



CO M ** 



O CO 



o 



CO 



M r? M 

CO 



CI O IQ 



CO g t^ 

•-< HH »-* 



o 



> 






35 s 00 £ O a CO ^ M * 

5 t^ § CO 3 

O t«> ft ^ 4i 

r« lO «M ^ M 

•-• CO « »-• « 



> 

3 



3 CO 

M CO -« 






co3q=^' 

J3 ^ •;: 






H 
t 
t 

A. 

5 



c 

3 



1 






a 
C 






k4 P^ 



as 



c 

E 

o 



G 
O 

c 
a 
cs 

O 



X 

I 



III 



ii ^ 



8 

ct 



o 



6 

53 






- S5 
^•5 J 

^ ^ ja 

III 



M 

O 



1 






e 

OS 






3.S s 






H K ^ 



^ ^ A** 3 :? 



O 




*• ^ 



11^ 



^ b 




2 ^ 



ssasslaasa |a a at a la la 

•" •■* •"• •■* ••• •- • ••■ '3 '3 ••■ '3 ••• •*« .3 .S .S .3 .3 .3 ^ 

K C k t. .. 

S { » «S V 

C 3 O C O „ 



055 



M M M M 

c a a B 
-n -c -2 

% t t 




Classified Civil List — Statb Depabtmbnts 



275 



88888888888888338888888S88S88888S888 

•O*0iQw00waD00vOO<OC0CQC9C0COC0C0C0C0C0e0C0C<0C0C0eQC0C0C0C9C0rQA 



aoaoQOao»i400^o«Oc«Of-4ioc<9i»Ar*ooot«at^»o<-40^AtO?9qoqocO'^oo 



10 O O M3 *^ *^ »^ 



55-^5:2 



O^'^00O)O>C«C0C<i->0>*4eOOO00e3 



•^ ^ CI 



C< M « ^ ^ « 



MCOO'^CtOIMOO 
6l pH ,1 ^ C4 



o d o d ^* ^ '"S ^* n ^ b J li V X o o o o «■ 5 c) o « b o bi > d h '"C -• J ^ •i 6i 

•f'<»'f'»'r«r»r»qOQOMr^ooi>»«^»OfCt»ai>»QO».'3i>ig>i>i«o»<0»-tticco«oo?o^oo 
MMM_iOOOOQOQOO>Ht-4i>«0000'~>000^<^»^«^OMfHQQ>~><^<-4 



^C<?9X«N«0C0ClrjC<«O<»0»0>WC0Mi-« 



M €■! ^ 1-^ r-t i^ fl •^ 



09 M M O «0 
»-i p^ M 



b-xSdddJ^MdMddudddd^hdddB^dM>d^*CJ^^MU 









>*-3 



So 



> 2 



SsJ 






■5 o 



•- I 

2S5 

o r* 

a CO 



? 

-< 



QQ 

d 



83 



3 



CO ^ % 



O C-? 



>^2 

§5.3 






2 



o 
> 



•3 ^ — '*^ ja ^ "^i 

«g g 2 5 2 2 S 



;2g 



M 
X 



9 

> 



Si < ^ 



a 



> 

< 



r3 

O 



d 



O 



'JO 

• • 

2 



2 



O ^ ^ 



2 2 r-^ 






3 3) 
^ > 

M ,.4 ob Cn 



< 
V 

^ 









d 

> 



r. 

X 



s ?i 



25 



CO 

CO 



- i: 

I ^ 

^ d 

X 



s 



d 

O 

.^2 2 



a 00 



OQ 

-a 



OQ 
3 



CO 



d 

J3 

dH 

*0 M 



d 

S 



d« 



QQ 



-a 



1^1 

X Q O 

oa «-• 5 



>i :0 

2 •.>^ 

■3 eoa 






o 
^ 



d 
•d «. . 

* 6 








^ 



>.l : a 

OK 



8 ■? I a 1 .5 

Si-J «8 5 wj 
.- _• 5 -^ •« 



a 
3 






3 ^ 



iil^lllillillilillllliillltllJ^ 



o Q a c3 < s ^ ^ ^ 4 « ^ P H a 





^ k 



illllll 

Odd 

f •^ •n 



^ 2 1 ^ 1 1 1 1 III II U II 

.sllllf ^.^^^^^_„ 



276 



RspoBT ov Stati Cini, Ssrvicb OomcsHnoir 



I 

J 



I 



1^ 
-It 



3 € I 



S « g 



z 
o 



O 

P4 






S88888888888888SS88 8888888 

is§§pj.§§§jjj.ip.i§i§i§§§§§ 



M 



a 
o 
O 






« « 1^ ^ 



a G JO 
»-» ^ Sm 



as 2: 









III 






jiilliliiij^iiiiiii 



«» CO e« to 



CO e« to M M ^ 






^ Si SI 




C " 



X 



55w 






^45 = 







•c 4 S S 




^ 



a 

i 



4o 



E 




S6|§i i 






^^iilll 



lliii 



6 



CI.A88IFIXD CrVIL LiST SpATE DsPABXlCEfTB 



27r 



S88S8SSSS888S8SS83S33S88SS8SSSS88S88 






— 2 MM M <# ^ 



2222222 22222222222222222222222222222 
n'""S2*82 5'^*S-"*22S;§;2''"g^'2 22**i2 22««S3i5;2§8 



iiilllliilliiiiiiiiiiiiliiliill 



fvt? sii^* 










I 




o a ^ a a a a 

^ o c o o o o 

- M »*4 ^3 '^ •*■ •^ ••* 

J a J a a s a 

^^ ••^ ^^ ••< •** •^^ •*« 



•M ^ ^ 



o 



o 



^ .M ^ Ji 

h b U ki 

3 O O O 

^ » > > 



.M JM J4 Ji J4 J^ ^ 

|§l||1i 

■•^ «» «* ^d «S «* «* 

li|iiiili|tlli 

00000000000000 

||||||ISS|S|sS 



IIIIIJjIII 



*• ^ 



«*«•«*« 



is 



a c 



s 

c 



§1 



*• kl ■« l« h 1. 

5 s a s a a 
liilll 



§ 



ffaalaslaslallllasslllljaaaaasss 



S S 

W U b 

5 5 5 

s a 

a a a 



278 



Repobt of State Civil Sebvice Commission 






586. 

all 

si 



■8 

a 



|8 
§1 

g-8 



8 « 

111 



S 

o 

H 
U 

I 

CO 



g 



i 

2: 



o 

to.4 

H 

m 

g 



SSSS8S88 8S8|||SSS 



88S8888 



SSS 

es e« M 





o»oo»o«jood2©oJij>j»Veoj»t^j» 


Sept. 

Sept. 

Oet. 

Oot. 

Aug. 

Sept. 

Oet. 

Feb. 

Feb. 

M«r. 

July 

Sept. 

Sept 


Sept. 
Deo. 
Sept. 



S5okS5SSo»OiOka9aa2S2 

» 8' 8' a S S a" S5 2" 8" 2 fc S 2 6" •"■ S; 

iiiiiimiiiiili!! 



1 



•55 tt 



t 



to 



JO 



^ re ^ lO U 



• o 




SEI^§ 




I 



I 












5 
i 
a 



III! 

E & E E 

3 s a 3 

cc c c :: o ;: 



E E 



t 

_ g 

^ J 



c 

E 
c 



3 S % 9 J 



c e c 

« < g e c d 

f f f "O "C *o 
x> «S w o a> « 

tf tf tf tf «^ ^^ v 

^ ^ ^ ^ <<< 






« eo ^ lO '•• »* »* 

V4 vN v>4 vN v>4 VM v^ 

0> O Ok O Ok o o 

,.; M o » 2 s ^ 

M CO <«• 10 <«• t^ t^ 

^4 vM V4 «M «^ «« «^ 

0> Ok 0> Ok o o 

V4 v>4 V4 «M V4 *M v4 

S2228S'^* 

»n ^ •-» »n •-» o o 

? r 6 r r^ . 

10 a 10 ^ «4 c« >Q 

v4 O v4 «-4 Q O 00 

es mS M M « M Ok 



i 



.s ^ 

s 






gS 9 9 9 9 3 

0; C 0) & ft> « 

ic to to le le to IB 

S S 9 9 S 3 S 

(S < tf et « tf « 

X X .C X (C .£ ^ 
0000000 



Classified Civn. List — State Depaetmbnts 279 



S 



ssss 



lO lO lO lO 



%%8S8§8§8S8SS 



Is 



o 
o 

o 



« O •'J "O '* ^ ^ 



sss 



IQ M M 



•0 

0) 







00 



o 




e 
t 



2; 



•^ T •* 



00 


'•I 


00 


r- • 


«M 


r^ 


^4 


•^ 


o> 


a» 


e» 


e» • 


v>4 


w4 


«M 


«M 


s 


w4 


• 


• 




^Hm 






• 


1 


• 

•g 


W4 


&C4 •< h 


S . 



00 ^ 00 r* 

«-4 v>4 «-4 «-4 

O O 0} Ob 



H 
U 

H 
CO 



g 

O 

u 

H 

to 

O 

to 
to 

3 

a 

o 

u 

H 
U 

S 
I 



>C <H O lO 



C4 



Em •< Em S 



& 



OQ 

« 

M 

a 
'Ji 

lie" 



5 

m 

I 



C 

a 
*) 









e 



c 

f8 



u ft* t. ^ i« 

t; O a: » C 

c a e a 
o o c o o 

1 1 1 1 1 

g I 6 a g 
6 I g a s 

66666 



loootooo^ft^r-oct^toh-ot^ 
o>0}0>a)0}o>oiO>oo>ooc> 



V4 <-l CI 



c >» 



O 



*< -J ft. rP Q. ** 

•< in DO -< da O 



»n t^ •-» •<! < •-» 



c«?oor»^»^o»^oo2Mt»o5 
esoioa»5oaDe»5So»e>2 

• • • • • •-• _• • ^^ • _ .^ 



1^ ^ I*) 00 



t* O ^ o ^ • • 

N N "^ ^ w4 



rt 



e 
G 
9 



-i *5 J3 C C 



»; M ** 



o 

9 




g g c >» • 




^ a 
goo 

h. ^ ^ 

- ^ ^ 



V e> 6; V O 0) 

!c ic ^ JC Ic X 
OOOOU O 



88 



•1 « ^ 



m ic CO 

S8i 

vH ^-4 vH 

• ■ * 



II 



O rj « 

-N CO "n 



380 



BspoRT OF State Civir. SiRTirK Cowusioir 



I 



1 



O 



H 
CD 



Q 
ft 
O 

u 

CO 

ft 
o 

CO 

(/> 

a 
a 

o 
o 

u 

QQ 



S 



§ 

i 






5 ""- 



d 



"S-S-s 

is 

■S > 

a *8 



S 



£ .5 S 



I 



o 



O 



8 888888888888 38 888S888888 

§ §§§§§g§§§§S§§§§§i§§§§i§§ 



» 



o 



•ft CO M M M M 




s^aoSj,^?.? 4 o ■? Sk ^ a s o a 4 .5 6 a 4 s 4 * a 




lilii^l^liils-^ljlllillli 




CuJoartwD Civil Lbt — Stat» Depaetkbstb 



281 



88§S88SS8888S8S8SSS8SSSS§S§§SSSSSS 



iiii 



o 
to 

o 



o o 

00 00 



o o 

CO O 



s 



o S 



g g e »-i « c 00 

o S o S S o» s 



CI eo <«• « 

^4 vrf ^4 ^4 

0> O O Ok 



eoaoooi«ooQOOor»r^ 

O>C)CiOiOiOiOi0kC> 



COfOOOOOfr*Wf» 
OtOOOkOkOkOO 



««*^.-l«MOD«-•^<o^*«^t^oopce»oceoolooo 

CO « ^ ^,Hi-l N ^ ^ mt ^,Mi-l 



•-» O "n 



r^ooe«e>^0QO*•'Metl•^<•'^-<Dt^^^-Qo<D<DQO«Mo•oaoAqct^n9Q 
9CkOkCkAK$oo*OkOkOkOkOko>0>Oke>0>eiOOkoootOAo>ookOkakakak 



C > •» h> 

S o a a 
C5S ^-< 



V4 ^Vi^Virf^Cl ^imC« dvMi-l 



© 1-t »H »H 



IQt«Q«^<HOk»^VcO 

^ «M N t^ et 1^ 












3 M i ^ s 







f^-"<SK 




-Sis"; 

3 3 tf S « « 




Iiii 







c fig c e fi g 



I 






3 



b 

u 
O 

c 
o 



282 



Bjbpobt of State Civil Sebvics Commission 



o 
o 

i 



o § 

If! 




a ^ 

•■a 4) 

ill 






1 



55 

o 



o 



// 



SS8S8888888g88888888S 






S 

»• 



88 



•ii^t-l lOeimMOIMM 












II 



S} 






« 






>i >» 



5 §55-1 f 



if 



•^ •-» "n 



»3S *< 



3 "3 pi 



*^< 



llllj 






1^ *M «4* ^ >-< CD >-< 

2 4-? -I £2 <?-<•<! 



cD>-<^aoa^t>»toto 

«-• « •-< CI ^ »H o^ 



to 1-4 ^ CO «-4 



28-^ 



" p. 



•-» ^ "n 



>» b 



O oS •-> h c 



im^&Sfa:. 



3 -il 




M M M M M M 



•I 

a. 
o 

•» b r 

0; c £ 

hi u ^ 

O O o 
•S '3 p. 



M M 



a. 
o 

u 
o 



a 

o 






H 



u 
O 

2 

a> 

a 

o 



o 
ti 

S ** V 



o O 



•tJ 

a 

eS 



O 

a 

O 
o 



Hall 



.9.3 
6 






Classipibd Civn. List — Stats DEPABTinirTS 



283 



888 



SS 



S8 



o 8 Q 5 2 



lO ^ S o 
F^* »^ ^ « « o 



SSS8S8§§S8S88SSSSS83S3S 



CO 



8 



8*^ $ S S S 
^ 00 eo CO 



« 8 3 

n CO CO 



SSS 



•H M e« e« e« M e« 



s 






<o <D ^ ^ eo >-< ^ 



I 



«<50Q0»n 






O ^ ^4 t^ 






8 



« K e ^ ^ lO 



« ci-e 
5 4" 



h i-» o 



*i ^ ^ ^ 

o o o o 

OOOfa 



»h.iOt^i-ieooeo>-<or«>ei-i 



I 



lO 






1^ 00 c>4 o a «p r«> 

Pi4 ^4 ,M ^4 O 9 O 
Ct Q 9 Ok Ok 00 Ok 



o^eoeooooo«-«or«>a«4er^t^r«h.ciao<-tAio to 

0k0k0b0k0kflb0k0k0k0>0k90k0kC)0>0k90k0k0kO0k o 



O <D C« iH CO 00 M9 

M e9 C9 ,M .X ei 



8e ««• M to ^ 
C4 C) •-< 

"8 g -8 I -g 






C4 






tA 
CI 



«i4 f-4 CO 



«M (D ^ O >-< «H lO 



SCO "X to ^ o 
ri^ «H «-l 



a 






o 

2: 



I 




d 9 *| d 
jQ « o -S c ^ •4J 



oti 



wcJJSs d 





S-sJ III : a 
a ^ .5 "^ o, s 




5 3 2 
III 

aiail!!!!!! 

i ii 2 ii £ J I 

II i I s i i a 



S84 



Rbfoxt of State Civil Sebvice Ooicmission 



CO 

o 
o 

1-9 



o 



04 




Is 

s S e 

£•8 



8 « 

111 



I 






as 



2 

O 

H 

CO 

2 



// 



8 



3 



SS888S 8888888S8888SS8 



8 



«0 






«o CO «o CO « e4 



40 Vi4 Vi4 V4 V4 



01 
01 



JD 



01 

01 



JO 
V 



0» O O C fr» o 

^^ ^^ Vi^ 9,4 «M V4 

9 o o o o o 

*M Vi« a-^ ^4 ^4 o4 


too«o«>^•«ooo«>oo•o ooo 
ooooooooooooooo 


<-• »« ^ «D ^• #0 

«M .M CI ,H W 

• • • . •m0 • 

;h ^ ft, O •< fe 




o o e> «o »* e> 

VN ^4 V4 V^ «i4 ^4 

0)0 

^^ ^-^ t^ ^4 f^ w* 


ico«»«»«o«ooo«aooaoooo 
ooooooooooooooo 


^ •» ^ ^ »- eo 

^ ^ e^ M 

jD X JC JQ C ^ 

& o e c 0> o 


^.»-7»H»M»^»-rt^hr*j5<-".»MtNrjio 

^ w4 MM «-i M ^ 



8 



8 

»4 
► 

■ 
OQ 

S 



V 

8 






e 
o 

M 

JS 




.13 



= t 









o 

QQ 

e 



•A 














O 






s 
o 

C 

S 

•g 

9 
00 



•2 :2 -5 

:s •- T3 

irs s 



J c c c 

t: c & & 

£ •- -o "2 
•^ c c c: 

»• 4J ^ 4J „ 

i^ c c c ^ 

I i i i e 

5. 5 3 9 C 
M • 00 to CP 



c e 
55 



o 



c.^l-11 



.!4 






a 
a 

cS 

C 
« 

c 



C 



■g 



t ** g 



sccecccccecccc 

wm mm^ ««4 •** •*« «*^ ■*« «W« mmm •«« av^ ■*« ■*« ««^ 

ca « " 

A a 



ea ^ « « 

& §> & p> 

£ S & £ 



g « flS et d « 

h. o. 0. a. Q. a 

££££££ 



c9 « f8 

C S C 



SSacAceccad. 



oooooooooooo 



cacaaccfl 

caaeaaaa 

SilS5-5iJS5 
ccsaecsetar 

•C *C X C T -C C 'i 




a a 3 
B n ■> 



GLASsmsD Crm. List — Statb Dbfabtksbi^ 



285 



888 



S8888S8 
338SS8S 

as t^ »• O 5 SS r« 



8 88338S88S388S88888S3 



^ M e« CO CO 09 iM 



eo 



C9C9C40>-<^^fM^r4,^ri4«H^««H«-<^4i-4i-4v4i^ 



« e « 

•4 «^ i>l 

• O Ok 






a»akaBakOkaia»aBakoka»akC3ka»ebakak9akO 



21 



'i 



« e « 

«4 «^ w* 

• a Ok 







3 



8^1 




'S'S'S 







A 



So to ^ lO »« lO c« 
S A ^ Ok fH •i^ ra 
00 OQ Ot 00 Ok Ok 0> 



r<»^ioor«cftotoioi-4i-40oe«oe^toaoak 

0IQQaQ0k90kOCk90k0k0k0lO0l0kCD00 



od'OMf •^ 



0eOiO*4O<H<H 1-4 «-i*^«^A00«-i«O.-«i4iO0>»O^fH«fM 



lO Ck ^ ^ 



2 i^l-ll^-S i tiit4tti$4t^iti^ii^l 



1 



M 

B 

5 




^ S I ^ S 1^ ^- 




«3 b ^ ^ w 



^ >> >» 




sis. a-g-g-g-a-g-a-a 

_, J 

J|||||IIIIIIsi 



Hill 

a a e 



286 



Repobt of State Civil Service CoMMissioir 



"I 

ft_ 

"8 -St 

lis 

OS? 
ge 




I 

2 



8S8S88SS8888888S8888888S88 

82S8s|§^88888888i88SS$$S8^S 



8S 



»>. 00 to -* 
« 01 c» w 



ccr»*oocr»xxoo^r«.^t«ce«DQOt«aoaot^aoo>oioiOiO*o 



•-"-"»* O -N SSI 



ss 



(D00^^Mf-4^tDtO«D*-4itO(O*-4v>4iC>CiOiO 



Mt^c';t«I^OSOOO<«iOC9t^OOWiCt^t^t«<DaOOiOiAiO(OiO 

OC^OOiOCdOOOOkOOSOOOOOCdOOOiOOflbOA 



«"^»*T«^W£«-"OOOC«M^'-" 



>» Si 



o «; 



•>4»oxootDe«-4«Nic*oio*o 



• ^*' ••* ••. •J'*'*' • • • t^ T. 1^^ ** ^ *- Tl • a^ aik ^ ak >k 

i^«5 ~ iH S ^33 ^ S * < ^ 3 3^ M ^ r^ 3 X^ ^ = =* =* 





o.Cba&ac.&'O 



•a 



s c g 



-a -a •» .2 .2 




CuLSsiFiED Civil List — State Departments 



287 



8SSS8S888SSSSS8888888888S888S8S88 
?RSS2Sa«229229288gs8888888888888888 



8 



8 



8 

0> 



00 00 CI lO 



*Qa000»O00^>iOiOt^iO«D00«O>Or^iOtOtQ 



«e*oaoO(Daoe4^>S<*'**'^<"'9*'^ww»ooor«lOlOt«•oeoo«o>or^lOtotQ 
SSokO>oOwO>o9Aooo>0}aooo9oa)a)o>e)o>oa)akOOkO>oioo} 



M 



^ M 04 e« 



82 






«stA»nao(O«oooor«*oooooc>iiQe»*oaooou3oot«ioior»«c«ocot0ior»iotDiO 
abokoaoooa)OooO}oo^o>ooo&0)oooo:oakoaft090Aoo>o>oo 






•Hl-t»iNO»^»^»^»^«^"^ 



&1 






Si 






•l-^ilt'^^ 



-» tn ^ •-» ^ 2 •< 



?*5«l/? s^SJ ft^.S ^o-s ^J o- 









^ ? * « ^ 

9 ^.S I a 



s 



00 

I 

6 








d 

o 



aot^ 



&5 



4 



^ 



^- - 5 ^ fl a S .5 




d 

Q 



I 

• 



V 



^ 



<< 






If ►,'5 0^ Mi 



So^4 



J «< -< 




•^ ^ 44 ^ 






^i b b ^ 



t 



Q o R *& *a *& 'S 'a '3 S 'a 




tt 



I 



d 

Q 






9 

•8 



888 



Bbpobi of State Civil Skrvice CoMMiMun 



1 



I 



g 



o 



i 

H 



III 



I* 

8' 




2 

O 

H 

CO 

2 



8388888S8888888888888S 



•^e«e«coMMc4e<i 



»4 r4 iH ^ iH M >-< 






lo ^' Mi od 

«-• e« 1-1 



M 



01 to Ki Of »i 

•-4 «H ^4 CV 

Hill 






o to 



^*tf xi 



<« >o c« <« ^ r* 

gssgss 

r^ ;a irf « lO fc 
iH c« ,H •H .X e« 



u)io«oow>u3ioto«oio(Diatf 



•-• M »^ 



•-I .-« o» "o •«> a 

w e* 1-1 '-»'-» et 



»X lO 



S50 



liiiiimii 










o|^ j»3h 






!»:«" 



II §1 



a _ 






^u.3n£aHma>^BoQ>oa>n4£Rs 




lllllllll 



Cla86IFI£d Civil Iobt — State Bepastmznts 



289 



SS3SS88SS8SS8SS3SS8 38S83 8S3 88 8 8 8S8 83 
55 5555s55^55§S§§S5§5§55§§§55l83Si§§l 









7 l« i. fc. u 

^ a Qb a a 



•■4 r*? 
1. b ^ 

a a a, 



D. a 










oo 



9 



c« ♦* .2 ^ •'*' 5 -2 -a 
o CO »H io -f 1-; ;!^ ^ 



o 'i 



8 



•a 



I- 






a 



cq :« J 






e 



>> ^ 



•2 a 

« ft o 

Oin ^ lo -•-« 



9 



1 






JOJ 



• • 

J 

! « 

: m 

* ia 


a • 
3 • 

8 : 


: M 










c r 



03 

o 

A. 

CO 



Pu, 

00 



Ik 



ki CO 

S t 

CO r* 

CO ^ 




-^1 

Sua 
a ** 

c2 






J3 J& g g fe r^^ 



11 






3 
«> 

id 



a 
3 .2 



o 






M fit 



^1^1 J -3 6 



o 



a 
o 



•-» < ^ *^ ^ 
6 g^ I I 



ii s .JS "« *2 S J2 o 



« W-H ,rf« >j 



a 



3 
o 






Jal 



e 

o 



0i 



^ « 6 
fa o ^ 









3 "5 O 

o o 



f? a 









J4 



JO !? ^ **• 



"a 



^<3 



aiia6S.a36asssiaa|iiiJ|ss|asBs6 5HS^ 



ceagaSSSSatiKHtsB 
doooooooooo 



^ 5 o o c o 



o c o o 



ooooooooooooo" ' 



o o 



a a a 



«>«>*««i*<AJ.4J«««««J.^«> «J4J«4«<'^ 



•5 js ,a ;f5 .2 .g .a .3 .a .2 .3 .2 .2 .2 .3 .a .3 .2 .a .3 .a .a .a ^ j .a .2 .a .a .2 .a .a .- .a .2 .a 




i\in%x\\\\ 



290 



Report of State Civil Sebvice Commission 



I 

IS 

I 

CO 

o 

3 
S 

O 

H 

ft 



& 

s 



o 

o 

'■0 

i 

I 

6 



III 

s i 



^ 8 

8 -8 



5 - 

Jo g 
111 






o 



i? 



88S888S8888888888888888SS8 
§88§i55is?S§5§Sliii8i§ilii 






3 






a a A Q. a Q. Oi Oi«5 



fHoe«e|or«ooeo«oo*owi^w2 




|| l| IIS 
■flllll'lllllllllllllllllll 

^irt ^m^ P*4 ^^^ ^^ P*< ^^* ^^ ^^< ^^ ^^^ ^^^ ^^ ^"^ ^"^ *^ ^^ ^^ ^ ^^ 








I 



Ci.ASBiFtin> Civil List — State Depa] 



»!!!!!!!!!§!!!!!!!!!!!!!!?!!!??!!!! 



iiiiiliiiiiiiiiiiiiiiiiiiiiiiliiiiil 

» 2 g 5 _■ o „• o- «- -- o- si .- 2 ,- 5 K - 3 •■ a 5 « »■ -- o „• » „■ „■ g „■ _■ .■ 5 rf 

iiijiiliiiiillllillHjUjilliljillil 

iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii 

iiiiiiliiJiiliililiJliiijiliiliilllS 



ii 



lillliiiiiiiiiiiil 






ijjiii iijuiii II u 



iilillWIIillllllllllilliilllll! 



292 



Bxsoax or Stati Civii, Sxkvicb CoiciuaaioN 



I 

m 



i 

o 



i 

P 



1 

6 



111 
<S|| 

si 

a 



III 



I I 5 

;8 - 



o 

H 

00 

2 



8S8S§SS§SSS888S888S888S8S 

§§§§§i§§§§§§§§§§i§§§i§§§§ 






«0 « »» M O) ^ «0 



«oaioio«ai^io«>o«Qae«oe»*-40oeo 

iOiOtOaDQDOOXXO«DiOOiO<DiOiOiOiOiOCDiOiOtte«9tte 
Ok Ok Ok 01 Ok Ok Ok 01 Ok O Ok Ok Ok O) Ok Ok Ok O) Ok 0> Ok Ok Ok Ok Ok 

«>ai«ric«eaViO«3«>idQed«30ek«-<^aoeo 

« 5,5 £ o. 



« n »» to o iH « 



miiiiiiiiiiiiiiiii 




9 

Si 



o ^ 

le ^ 






1 



« £ I s >, 



6 



§ 






_ -I tc ^ ►« 











o o 

M M M M M M 



imilH 



O O O e D 6 O O 
MJtMMMMMMMMMM 




CuLsmnxD Civil Libt — Statb Depahtmbwtb 



88833SSSSSS333SS3S3333S333883SS8888S 
iSiai8Siilii§8ga§8§3iiaSSSS88888|S|8 






55S;S 


22sS5==2=SS2=s==553==-2s5SS53== 


iiss- 

tllli 


nmmmmimmmiium 








22222222222222S°22222252222£2SS 


iliij 


s a 'sij-s 2 s « s s" " 5 aa -a 3 2 s 2 "' - - ="=" 2 "sa 

iiii}iiiiiiiimiiii4iiiiiiim 



iil 









iitlli?ii!iJlli|jiif|iili|fl^J|iilgi 



iil|iii=|lil6||l|iilMI 



JllJllil 



!»331lllslS!ssJiJSjlSII5iaiS!!S2SSis 
llllllfllllllllllllllllllllllllfllll 



294 Report of State Civil Service Commission 



I 

O 

o 

i 

O 

H 
»? 
H 

a 



0* 



c 
o 

s 

c 



•m E 'B! 

O — S 

Q I « 



c '3 



C w C 

-5 -. g 



•2 



B a 



§« I 



g 

2: 



2: 

o 

H 

2 



S88888S8888888888S8SS8S8S8 
88888888888888888888888838 



«OOOQC»^»*.«QOQOr<.r<.«QOXOt»QOOCOC«aOOO»-'?itX 



•-• o «o 
w t-l 

•-^ i^^ ^^ ^3 ••« vp^ 



www 



8:2 



t» o 



O»0NNi0C0^00r^C0C»»C»0OC 



CO 



ooif5«oot>.t>»«r3Coot*t»QOoo««r<.coxooxcoooo*.'5X 



11 O CO 
M r-i 



CO 



!*5 « O ».t 
CI CI CO P^ 



t»o»o»ocici»oeo»-ioo.-<coo»o»cc»Qeo 
»^^nCic<»-«c< t-< t-< ,-4,H"*ec 



•14 •«« .p^ •*« Q) .*« 









a a a 9 «3 
< < < < ^ 



? 



o 



e 
j2 



> 
c 





^ fa 00 

o 



fc 



5 2 S « 

s > tf ^ 






3 S 



5 
GO 



a 

a 



eS 
c 



CO 

O o 



fa 



y. 



> 



S 

eJ 

> 

< 



5 g 

fa {^ 



73 
(4 CI ^ o 



c 
O 



a 
o 



o 



. c 



c 






"a 3 "^ 

fa fa CO o 



o 
M) eS 

s O 

O fa 



o 



c 



'a « 



g 

o 
O 




22222*52 
SfSESgggg 

% 



o 

eS 



2 



9m mm ^ ^m 



2 fi 



S.'§.|&^^E.a^!l&g.&^^^^^ 



b b b« k 

2 2 2 2 
2 fi g 2 



o 

cS 






2 
2 
8. 

o & o o o o o 



o o o o c 



oooooooooooooo 

M M M -it M JA M ^. :>^. ^. M J4 J4 M .iA M ^ M J:i. 



Classifibd Civil List — Statb Depabtmbhtb 



8S8SS88SSSS8SS8S8SSS8SSS38SS8SSSS8SS 
S§||§|||§|ggg|||S||§|gi|8§838§8g§||§ 



mlillliiiiilJL-iljiiiililiiiliiiii 



jlillliijiiiiljjiililliiisiiiilliifi 









Hi i 






iili,||pl|| I ill! 



s 



«>-» if 



IsillSjilliilSlllill" 13 Iji-S 



iijjiijjiiiiiiiiijiijiiiiiiiiijjijjil 



29ff 



Ekpobt of Statb Civn. Smcvicb CoMMisMCWf 



O 

o 

3 

OQ 

g 
o 



i 

H 



a 

si* 

""I 

a 





I 



o 

H 

00 

2 



888888SSS| 
S88|888SS ^ 



888888|8888S$8 
S888|^ 

CO ^ CO CO o 



CO 






OOOOOOaBOOQO 



QOOio««xxc««oo«oi*>ac» 
o»oie»oeetete)c:o»9be»ctei 






o 



r4 f-4 M <^ »^ ^M 









o o o 



S 



§§ 






oo«Oic«acacaoMacaotcixaca& 







6 

A. 

6 



•2 

O 

o 

m 



c. 



o 

a 

i- 



a 8 
2 o K 






e 






3 
o 



o 
D3 

m 



^11 
• •4 



Is 



S3 

O 

6 

m 

•4 

s « 



%4 



a 

51 



» 3 



o 



00 

ai 
I 



s 

£ 

o 

1 

a 
O 



fi a 

(0 « 

E g 

£ £ 

o o 



a a a a a 



§■ 



a 

o 



« « 

a a 
c £ 

o o 

»4 PU 



S E E E £ 

£ £ £ £ £ 

o o o o o 

^ k ^ k h« 




^ ^ O cS 5 <S tS ^ 6 O 4 »? 3 S 



^ 5 ^g & S 

O O O S O S tt 

fc te fc t fc t fer 

3 3 3 9 3 3 3 

4 et tt tf rt ca et 

OOOOOOUfU 




Olasbifisd Civil List — State DxpABTMim ts 2&7 



88S8§SS88S8SS888S8888 
ii8S38§2222§SSS8Sigi8 






O f-i to 



p>4 vH ^4 d 



*-i *-i t^ CO 1^ CO 






-rt ^ lO 



IC iC tC ^^ t* ^4 

^H ^-1 «-^ N 



r^t^lO'HrNvHvHpH*>iaO<^00 






o 
o 



«p m <D 

o a Q 

e» S S 

r4 ^4 «M 

Cf Ok c« 









•I 01 M 



s 



to 



w 

S 
l^ 





Oh 



C 

o 

II 



■I 

22 








O 



:^ a ^ ffl « 






A 



2CQ0H^j=5S^5g 



a 

"3 



u b 
O O 

08 ct 



el 

O 

.2 



II 



cl 




V c 






o$ooooooo«» 






S 6 



noOOoOOOOOOOO 



X3 



U K> 



OS as 



^S||S£ti£$$S3^ ill • 



o 



•H M 



S<3o 



^ 

^ 







o 



a — 



M 
H 



L) 

a 



V 



i 



298 



Repoet of Statb Civil Sebvicb Commissioit 



// 



a 

o 

I 

s. 

a 
6 



as 



'o-s 



s i 



3 e 
e S 



|8 



i - 

•gob 
M « a 

<8 



^ 



« 



o 



d M M N M W M 

3 3 "5 ^- 3 c. "a "3 "a a 



s 



<r o o iM -? 

W CJ M CI 



"r1 "a "5 ^■ 



>. 

3 



O « S3 •-• 

c^ rj n 

3 "ri ? ^ 






d 









H 
O 

> 

08 

H 

CO 

Q 
H 



a 
o 

1<3 « 



=^ < 



S 
^ 



GO 



I: ^ 



2i 






i 



e 

rt 

^ >. >. 

•< d d 

. rt el 

^ X ja 
CO -jj < >, 

5 J J O 

5 00 30 ^ 



M W3 at? r* »y 

fc» ^ ^ "^ /?« 

S 



^1 

"^ d 



2 



5 5 

00 QO 



o 




e « 



n o (i4 << •^ »j B 







3 



O 




4 



& 



H 

ft -si 



E 



CO 



d 

g 

fa 



I 

i2 






£ 

I 



SS88 

>e V « ?« 



•o 


»o 


le 


*o 


« 




m^ 


^^ 


•■4 


■>4 


c» 


o 


c» 


o 


o 


v^ 


1^ 


^4 


v^ 


v^ 


^ 


^ 


* 


9 


* 


IM 


•^ 


wm 


o 


v^ 








• 




e 


c 


e 


o a. 
fa-< 


lO 


« 


iO 


•o 


!r 




^4 


fi^ 


VH 


M 


o 


a 


a> 


o 


O 


*i^ 


r^ 


^4 


«M 


«4 




» 


9 


» 


« 


^^ 


Vii^ 


«iH 


o 


'^ 








• 


• *4 


• 


4 


d 




4 




a 



c 
o 

r 



d 



8 

a 

N 

H 

H 



^. • 8 

fc.4 5 

*i r ^ 
S w § 

e5 d ^ 

*- « 4 5 

lO b- -^ g 

22Sfa 





Classified Civil List — Statb Depaetmbnts 



299 



888S8S 8 8 



?5 



5s88 

O t» CO 



cs 






8S888888S8S8888SS88SS88 



^^8 



8Q O O 
O O C 



ci^oo-Ni-io^ 



^ pS 






•o 


o 


m 


•'3 


•O 


b. 


t» 


O 


*M« 


«— ' 


»« 


^^ 


v( 


^1^ 


-^ 


w* 


o 


^ 


C5 


^ 


o 


o 


OJ 


a» 


^" 


^* 


w^ 


•^ 


»H 


f-4 


^rf 


»-• 


^ 


. 


^ 


, 


^ 


a 


A 


« 


^ 


^' 


Vi^ 


n 


CO 


^^ 


o 


«o 


•^ 






M 


CI 




m* 


v^ 


1. 


1 




••• 


1 

fa 






• 
d 


1* 


•- 


lO 


t^ 


»o 


r- 


r- 


lO 


^M 


v^ 


^rf 


^^ 


^-( 


v^ 


t-4 


^i4 


C-. 


ri 


o> 


5» 


o 


o 


o 


c» 


"" 


•>« 


^i^ 




^^ 


^4 


^>< 


v^ 


^ 


_ 


^ 


^ 


^ 


M 


» 


» 


c 


!*» 


V4 


^^ 


CO 


»-* 


« 


<o 




»— 




ri 


CI 




w* 


1-4 


J 


, 














L. 




d 


^ 


J3 


V 


>. 


• 

a 


^ 


<< 


C9 
•-a 


tf 




Q 


3 
•-s 


e9 



>^g 



d 



V ?: 



5>- 



6 



^ '^ ^ J 2 X 

w «-» 00 S J 5 



i?- ^ ^ a -^ ca 

cr r" ^ '^• « •^ 

- «i ^ ^ ^ ,rt< 

c? — — « O "«*• 




U 
eS 



i 

o 

o 

00 



a; 
o 

c 



e 
c 



O fi S S B << S 



OQ 



0) 




aicsj 



iJ^OiOi-iaOOtCOOQOC^OOOOOOClOCIQOOb'CI^ 

W »^CI C^»-« !-<.-< ,-iC^i-i CI,^^H 

©►i o efl>i«i-'*H^/S*^^^ 3 3 355'^Js;>i 33/S 

^'^|':o^-lQC«o»QOOOM©c^oc^«ocl«o^•^^^ 



CI .-I CI C*^ »-• ^ C^ w* 



^ « »o 

CI -< 



►-5 Z X 






it 
o 

t) 



o 



c • 






3 



72 



5 T? CD ♦- Ji 



^^ 






•r rt 












u 

« J 
< § 

3 
-1* ?? 



c 
o 

CQ 



c 



a 



o 
o 

« 



>» 

a 












> 

< 

a 

s 

O 



C ♦* 



3 






.r^ »»^ __ 3 
*5 "^ *" 



ciO^roQW-riS^**? 



CO .^ 

CI H 



c 



K 2 






c 

c 

i 



a a 

f« CI «p 
-^ v) S 
^ « -^ 










73 

C 



3 S. »5 3 OX 

1 1 J -' a 7 -r 



^^o 




& b O 0; & &> 



3 



«^ ^a^ «a^ >^ «^ ^a^ «a^ 

"7:33383332 

agasgcss 
a Si a S3 Si s s » 

UUUbUUbO 

3333333'^ 



«s 



js 1 1 1 i I i'i ^^ 



800 



SxpoBT OF State Civu, Sebvicb CoaciciBBioir 



a 


iS 


M 






|B 


"S-=T 




fi-" 



II 



8 - 

« o o 



I 




2:; 

o 



888SS8888888888S8888888S88 
§iiSS§§§§§§§^^^§§88i88S8SS 



-cci 



o««ooo«fr^i-<oeoo»^aoooQ^otoo-^aooe4aoeeo 



rH ao 



^ M 



C« 



2-^8 






d b fl S i? ^ tf d e -ti ±» S» .o >» >» e o *^ ♦»* ^ ±» -* ^ ^ >» *; 

•n'<"-»«n»-»«n^«-»»-»O>nPfc«->»-»"->»^"<:O««««-»O2Se»n0 









>t >k 



^ « ^ M ^ 







a 

til 

^ S 5 n 

111! 
Sills' 




O 



.ao< 

i is' 
S'ic 

ao S 



M 

O 

U 



w o 3 i - « 



c 

0) 

J3 



o 

C 

j> « J: -c - 



S 



-< H ^ 



o 3 S 
6^^ 



•3 

m 

8 



I 

o -So 

« 0) •a > 

* .ti eo ™ 



5 



:2 



pa 









^ (3 
fc * _ 

3-0 5 

Ml 

55 >H •* 

wa *** •^ 




M^ JftJ* 



M MJ^ M M ^ j^ 



Ci^AaBrriXD Oivtl Libt — Stats I>bpajbticbvts 



801 



888888888888SS8S8S8S8888SS8§S88SS888 



§§§§§i§§§§§gg 



8 



n 8 a 8 e^ 8 



8 « 



8 



*S|o^eoiOiqo*o*«t^ioi^«to*o*o*oo<«i^«ti«^409f-iceoi-ioO'^«o 






« e ^ M 

•-• « « 1-^ 



ao«-4iC'-ieQi-i^O40o*ioe9«^ 



ft _ 
(£2 



um 



i^^ilUs^ 



<«• e« o •-• <«• « 

*-« pH M 1^ F^ <M 



5 8 cb S 

« ^ 0» 1^ 



»^ ^* I"* *^ ^4 v^ *H iM •>H 

0> 4fe 9 O^ Ok Ot Ok 0> Ok 



=^s5 



-< cS^-^ 



1 1 M 



.•a 



dH 



• * * Mb 

llll 



C* f"^ W-* P^ w4 




O* 8 



illl 

lililllliliisllllii 



-^ttUIIUllllllllllll 
IHIIIIIIIIIIII 



o o o 



I 



llllillllllllllillliliiiiliiilliiil.1 



302 



Repobt of State Civil Sebvicb Commission 



O 






Is 



c 



i 



•« .9 



8 



III 
°|1 




o 






88388888888888888^^ (?<5'(f c?d^a= 

X S ob « 






30 00 



00 


1^ 


o 


o 


eo 


« 


lO 


lO 


«e 


« 


to 


1^ 


00 


M 


« 


« 


00 


00 


00 


00 


QO 


«D 


Ok 


« 


00 


f-4 


w^ 


•^ 


vN 


pH 


vH 


1-4 


^^ 


v^ 


*^ 


r^ 


v^ 


v^ 


^•i 


^N 


r^ 


^•i 


«.H 


t-4 


fH 


^^ 


«-4 


«ii4 


^.4 


r^ 


*-4 


at 


^4 


a» 


^4 




a» 




1^ 


9 






V4 


a* 


r4 




9 




0» 


oa 


9 


0» 


Ok 

1-< 


Ok 


Ok 

^4 


r.« 


* 
00 




00 






r*' 


«* 


ci 


Ok 




* 


»i* 


— 


15 


* 


»M 


t>r 


*i^ 


w" 


^4 


r>^ 


^ 




— 
•0 


3 






^ 

-^ 


• 

t 

o 


1 


^ 

s 


3 


• 

1 


^ > > > > > r^ > 

000000«0 

0222:22:02: 




1 


Dec. 
Nov. 


3 


■ 

c 

•-9 


Aug. 
Aug. 


1-4 


1^ 


O 


o 


CO 


^ 


•o 


lA 


« 


« 





b- 


1-4 


« 


(O 


« 


r* 


00 


00 


00 


r^ 


«D 


r^ 


00 


X 


W^ 


f-4 


r^ 


»-l 


v^ 


r^ 


i^H 


*^ 


^^ 


t-^ 


1^ 


^.4 


1-4 


r^ 


«-4 


1-4 


f-4 


^^ 


1-4 


r^ 


^H 


v^ 


«-4 


«-4 


v^ 


• 


* 


0» 

»-4 

* 


0» 


a» 




a» 

^4 


a» 

^4 


9 


oa 

* 


0» 


a» 


a» 

1-4 


f-4 


a» 


a» 

1-4 

* 




*-4 


Oi 


oa 

*-4 


Ok 

*-4 


Ok 







Ok 



cQo04«i«o<-«*-ib.<oeioiiD«DO»»<3r«-4io»«f-4MXr«eoeQio 

l-4,-|,M<M v^,MClC«f-4 ^ 



^ 



5? >.'i 






:0 






^1 - 

"* o ^ 

'^ •§ QQ 
«» .s .^ 

«2? 
^ :s ^ 



2 « « g «• 




•E5 
^11 i 



I tc o 11 3 S 





< o 



■5 vi "• 5 •^ o 







I 



III 



c 6 ^ 

n OD SD SQ 00 




& 6 « ^ 



IIIL 

fl g a g 
2 .5 «* «t «* 

OD OQ 80 OD OD 



i; & & & ^ & 
-s -s -5 •€ •^ "^ 

Q. a a 0, a a 




• V «> 



Il^« 



OQ 00 



00 OD 



S F S E^ c 
£ £ iS i^ £ £ 

00 00 QQ QQ 00 OQ 



lllll 



c e 

aE< 00 OQ 



Classified Civil List — State Departments 



303 



8SS8888§8S§S§88888S888S88888S88S88 
25S5a!2i§3f?S:*S§SSS8SSS8SSSS8888888S8 



f*-*^©»^^'#coeo<«»"*»«ft^«^r<»ooQOt»-«r<»oooooooo»o«ooaoo»«ooaob»oo 



r« Ok ^ o CO CO CO 



•^CI«DWa»«D«0«QOO 

o o 



C0^4pHtOr^CO«H*-lf-4rN«M*-4lOlO*-4 
r-* ^ r^ C^ w* 






e 



QQ 



55 



O 



i^ H 



2?* 



d MS a J. * I 

llljli 

M '^ O *^ rl? •© 



^ CO 




CO •-• 



^ »<• ^ «0 CO 

wa CO 00 o> to 

« CO (^ «-i i-« 




IIIIIIIIHH 



«'■*'-*> 

•^•£1 



S-^ 



t 

u: 



88888888888888888888888888888188a 



IlllllllllllllllSSSSSSSISSSSfciSSI 

C C C C ^ fa C k c *C *C *C 'C *il 'C *c *c 'C "C 'C 'C *c 'C 'C •? "? •? •? •? •?• •?» "S •S 



g 1 1 1 g I ■= 1 1 1 g 1 1 1 1 -g 1 1 1 1 g 1 1 





Kepokt of State Civil Ssrvicb Coaunsaitur 



in 



in 



5,1 



8SS3S§88S3SSS888S8SS88SSSS 
|§ii§i§lll§llgg§i§S§i§S§§§ 



13 33*3-55 » 1*8 lii -SI 5:|ss*i3S 



liSSIs 



fillilfillssl^lflllllilfis 



1 -I i -i 






a 



m 
111 

it: 



Hit 



miM Jli 






• rrlllfSI: ; ; lllll|||4: ill: 



Classified Civil List — State DEFARxacBifTi 



805 



8 SS 

O Q Q 



S88 888 



« n M 



88 § 









888 88888 



o o 



^ ^ ^ ^ CO « 



W ^ N »^ »H 



or 






to 

9 



bh 



a 
5 






'I 



m 
t 

I 

Ik 
I 



2 






T 

m 






•-4 00 *^ 









1^ 00 »^ 



O »n 



Id ei io 

w* r^ w^ 

ct 9 at 

^4 1-4 ^4 

le 01 ^ 






«3 Ok ^ 
*i4 ^4 O 
01 09 00 



■e 01 o» 

b CB 08 

^4S 



o J 

Si 



i 



s 
^ ^ 



1 1| 




z 



e 





s 

•i 



u 



le 00 le 

^* r^ w-i 

O 9 9 

W^ W r^ 

» • * 

«M *4 o 



^p 



^ 



S4S 



le 00 lo 

VM ri4 ^4 

o o> o 

^i^ r^ ^^ 

» • ^ 

^H ^^ O 



* 2 



4 



^1 

lis 

III 



51 



a 

08 o 3 



> 
a 



.!!.l 




•o to 

C* Of 



••2 S 



.-• 00 

o o» 
o 00 






o 



•O 1^ « 

1^ ^rf Viirf 

Ot O Ck 



O »^ ^^ m-l w^ 1-4 



s 



^- M >» 



8 






<o 9 c< 
e» o *-4 

00 00 o> 



'•I CO i-« 






b- t^ 00 Ud lO 

«i4 •^ «>4 ffi^ ^4 

Ok A 0> 9 O 

*-4 *ii4 v^ r^ *ii4 

^^ "^ *H lO lO 



3 « 5 P O 



•O 119 « lO *C 

Q <-H (-^ *^ «^ 

9 9 0) 

^14 *H *H P^ vN 

«# lO f-4 lO to 

S M c '*£ -^ 




Iltlfs 



306 



Repoet op State Civil Service Commission 



a 
o 



s. 

a 
6 



a 







Is 

g'6 



1 - 
3 « 6 



S 



« 5 

08 



8§ 

O O 



b- 00 



-33 



S8 



8S88S8888SS8888888S1 

8888888881 



tSubuSuSoOOd 



»^ »iH »M ^H C 



«-••-< CO « 



eocoMciciMMe^n 



C4 C« Cl C< M 



W* 1—1 

a» a> 



aoooaoQOGOiocD«Dior^QOaot»ooioio^^iO( 



r^ i-< pH 



•OF^>HfM^-|s.^CQ 



a § ^ S5 -^ §! a §5 2 •- • 



J a 



Is >» 






io«o miocitDtDiotDco^t^aoaorxaoeoiOMMdioc 






CI 04 



I* « «-< 

C4 



(O 00 ^ M 1^ 









o 



o 



« o 

M CO 



d 

» 

s 

& s 

O c« 



So 

rjz: 

CO ^: 
^ "* 

3 
JO 

O 

S2 



QQ 

00 



1 



CO flQ 







go 



3 



§|lll 




t* I 



a 
o 

1^ 



? 



Oi 
6 



I 



6 « ^. I 

OS J4 

0« Pu 



1^ 



a 
t , 



jj . _. z : 5 3 *• 






Immmi 



Hi*. 





:§s;gssH(S(|,lcl 



Classified Civil List — State Departments 



307 



Sg|S|8888§SS§§|SSSSS§i883888SS888SSS 






i-iOiot«t»«o^b>or«aO(OcOfHfM^ 



CO •-« ^^ o» o 
o 



<o o> Ok at vH 



HI a a 



>H t^ o <o 



5Jqq£5 §333 3lS33 33 33 5« §333^ S|33 

SiOXiO<00«D«D«Dt^roOroOCOCDaOO>Ot^O>Oa»t<«iAM<3>or)^wdiQier«(D'«QOa> 
AOoa»a»a>a»a>a>a»o»doo>oob3»ooo3003oa»9o<3>o>o)ook9SS8 



o 




o 

QQ 
C4 










•-4 C« lO 



a» 00 lo S ^ 9 00 



^'lol^o 




s 



-2 a 3 9 * ► ® 







5 -i 1 I 







•M .M 



llll 



M 



M 



M 






••• ••• •■• ••« 



•M J4 



I 



SOS 



BxFOBT OF Stats Civil Service Commission 



T 

o 

i 

a 

o 
u 



a 
o 

f 

6 



s 



II 

II 



^ 8 



8 



I 



5*8 






55 
O 

H 



S888882SS8S8SSS8S888 88 8SSS 



M 



«e to 00 e« 
at 9 9 at 



tOtoatatataot*r»i<»(^i<»<0<OM3 

atatctatatatatatatatatatatat 



o -• 



ri4 ce »-4 i-« 









C9 et «o o 00 

«i^ O •^ «^ •H 

a» 9 a ai oa 



^QOaer^tor^^iecor»^oioo9^'OM30'^ 
oaaa>aio999aiai9S995aaioa»o 



oO'^«OQ'^>eaitoeer^ooe«»^e«^*^«o*4«oc>t«t^o09t««^ 






o 

o 




e 

Ik 

•< " 



I* 

•a -a i* ► a 



i 

o 






HO 
.9 M 



jlllll^ljHlllllll 



308 .ft*^ 



o 
Q 




M •¥ ''i 




S0O0D60Q000HA 




Classified Civil List — Stats Dspabtuvtb 



88SSSS88888S88888888 



-« o « o 



o a 



S S S 



o 

M 

t* t* t* t* 



§ S N 

o» O (^ 



o o 



8 



8 

8 



8 



801 

88 



lO CO 



M 


lO 


to 


t* 


«e 


t* 


C% 


oo 


00 


00 


t* 


00 


tM 


C« 


e« 


00 


r* 


W 


00 


00 


*4 


«M 


tM 


tM 


•M 


••4 


•^ 


tM 


*-4 


«irt 


Fi^ 


w^ 


Vi4 


^N 


^- 


•ii^ 


^^ 




f-4 


•-4 


o 

■•i* 




9 


oa 


9 

*-4 


9 

•-< 


9 


o» 


9 


9 


9 


9 


9 


9 


9 


9 

«>4 


9 


© 


9 

f-4 


9 

v4 


«M 


o 


00 


* 


• 

9 


oT 


le 


^•4 


Vi4 


oo' 


O 


9 


• 

W^ 


• 




V^ 


CO 


f-4 


•-4 


tM 


•9^ 


«M 






*^ 




t-« 




f-4 


^^ 


^N 


w^ 




w^ 


w^ 




c« 








■<OZ 




1 




•1 


i 


1 


h 

« 

s 




i 


i 


April 
April 
Nov. 






Nov. 
Sept. 


e« 


CI 


to 


«e 


to 


^ 


e« 


00 


00 


00 


ua 


00 


••4 


C4 


c« 


^ 


»o 


w 


00 


00 


■^^ 


»< 


tM 


^N 


•M 


v^ 


•M 


»N 


w^ 


•M 


Vi4 


^^ 


W^ 


f-4 


tM 


1-* 


••4 


w^ 


^N 


•ii^ 


55 


o 

r* 


a 




9 


9 


*H 


9 


9 


9 


9 


9 


9 


9 

*-4 


9 


9 


9 

••4 


9 


9 


9 



• • • • _^ • * • • 






J^ll 



«OC>t-i^M«Of-4f-4^ 






9 

r 

r 




^s 





& 

1 1 & § t s 

•g X jc ^ ^ b 

IX Qi A (% Q. i2 



III 
III 



§111111111 



•II 

^1 



||jiiiiiii|mi 






00 



c 

9 



00 
9 



Q 
9 



s 

< 



E 



c 



g- 



o 
'.J 

o 

2: 



o 



O 

4i4 

s 

•a 



< 



5 

i 



lO lO 

«-« ^i« 
9 9 

V «D 

to lO 

9 9 







1 

/ 



Rbpobt of State Civil Service Coumibsion 



! 

I 
s 

111 

nil 



111 



SSSSSSSSSS83 

g§3§iSsill§§ 



* 




S3l=SSS 


ilsss 




llilill 


_ = .„ = 


sSliiii 


nm 



ll^slllll-?-!! 



li 



II 



3.2 



liliisilil 



31 i 



" S 2 9 i *5 



5 , 



5 £ < u ft £ 



a ;-i 


■< ■; 


SO! 


S : 


!s^ 


14 


i£- 


z~S 



I 



11 



Is 

Hill 



Classified Civil List — State Departments 



311 



888888888888888888 



888 

»o 25 »« 



8 ^ 



C4 



O-^'-^^f^w^w^^i-t^^,^^^^^^ 



8 88 

O CO 



lO lO 



— GO 00 i-O CI 
•- "^ C •— ■ t-i 

0) c> o o o 



CO t<- 



COXQO«0O«a0QOQOOOCC«0Ca«QOQOX 



C9 ^ 



•C C 'C -C T 

c :x a. a a 
< < < < < 






•>* 



?: !fe c^ O '^ :^ .^ '^ .:fe J< c^. (5: 'i: (^ c^. ^ ^ r^ 



ace. 






•^ -^ •«« •*« r3 rz3 •#« 

b »• i. U L. t< U 

a a a a a a a 






>>>»>• 



O C O „ 

.M .j« ^ h 

»• ki k. 2 

O O O -O 

>* >^ >- S -I 

^ ^ » •§ (a 

« & o S 9 

2 ?: z o s: 



•Is 



O 












2 

o 

c 
o 



1>^ 






e: 



M O X 



: ^ 

T 

— r. '^ > 

"J -2 - <: 

;28i?3 






OS >> 



u 

c 



O 
• c 



^ay.< 



-2 w ca 



W 3 .♦; 5; 



S3 X 

.2 .i: Ts 

> O C>l 

fri Ci © 



CO : ** 



ft) 









i2 



c; 

Z3 

o 



-^^ 



c 
o 

a 






W CO 



••4 Vi4 10 ^ 



a 



9 



c -t: ^ i-i •§ ^ 

a a s^ - a Q 

mm "^ ■■< ^» N ^^ 

•2 g » 5 5 « 

'c e § s ^ -J 

«* • ^ § ^ £ !• ij 






c 5 « ^ JO 



e 

8 

o 



pi; 3 

si a 



5 c 

ft/ ►^ 



o 
2 



j< -a c 






C w lAi 









5 .i S e! 



O 






c 
Cm 



f ,- •- ^ rt r-i s -^ f* .5 



ft/ e 



£:s 



ki 

a 
o 



o 
O 

•e 

a 

«9 









i- e! a J2 

•»■ O *i^ ^ W 1-4 



5 -^ 



5 



ft/ 

4/ 


»^ 




^ 


TS 





c 


u 












ft/ 
3 
3 

g 



ki o 

w ft/ 

S3 

ft. ^ 

ft/ 






ft, 

ft/ 

c 



22 Ci ^ 



X 73 

0^. 



3 
o 

o 

3 
h4 Qi 



•« kM *^ C« M «« 

C 5 O C C C 



30009000000 



^v ^v '^^ ^v ^i« w ■«» ^i« ^m «# ^# ^rf ^j ^^ ^^ ^^ ^^ 

33333333333333333 



ggslll'gg'i'Slglg'ggg 

'tJ '2 *tS "3 '2 '2 '2 '2 '2 '2 '2 'S -n •— •"• -"^ ••* 

aaaaaaaaaaaaaaaaa 








a 
OS Af 



■mXSOCCCOOOOOOOOOOOO 






ue^ce^CiCft/u&civ&t/vft/ft; 



« « o 



s 


3" 


••4 


^M ^^ 


^ 


• • 


tM 


^ri rH 




>» *-• 


■4> 


es a 


C/ 


:?-J5 


N 


«J« —4 


s 


8§ 


•^ 


f-l lii^ 


t-T 


— <o 


• 


S 


• 
• 


• • 


c 
< 


<< 




T • 


* 
• 


«-g 


¥^ 


rt ^^ 


< 


g » 


C 


< gf 


ii 


X c 


£ 


^ 9 


If 


cSl 


c» 


-< to 




ss 




bi) • 


c 


c -ii 


c! 


■si 


c 


^ 1 


e 


4 


•^ 


/^ .a 


(z* 


^^ 





00 . 

1 J 

II 


H 


<o 




312 



Bbpobt of Statb Oivix Sbsvice Coicmissioit 



§ 

■a 

i 

8. 

a 



B 

5 i ^ 






ft. 



Is 
111 



i - 

« o « 

ir 



i 



o 



GO 

o 

Oh 



// 



<5 

I 
5 






8S8 

C^ 99 ^ 



8S8 



to « 'T 



00 If) QO • 

^H tM *^ 

O Cb 9 

^H oH «-« 


1901 
1912 
1916 


IQ ^ iO 


*^ o •o 


April 

Feb. 

April 


Jan. 
Jan. 
Sept. 



I* « t* 

a> to 



OI •-• 00 



u 

•6 

> 

—m 

PQ 

8 



w 3 *S 
*^ tn CI 



G 






5 

I 



^ •«« 



•^3 



p^ ei « 

Q •^ '^ 

o o> o 

^N r^ tM 

^ o >o 

. ^ 

(• 2 « 



a 

«9 



CQ 



I 



Jf .d -. 

^ -a 3 
'" «® ? 

00 &« (V| 



1 

n 



J 






:2-< «> ^ i2 S 



•■^ k •—• a* ia CS O 

*• S S 2 3 "rf r-« 



E 

c 
S 

0) 



•sals 




111 



8888S88888SS8 88 



8S 



O 1^ h« 
»0 -^ CI 



^cotoco^^coco^o 



lMvM^4v^*-4v^«0<D^H«OvMvM^i« 



^s 



= 5 



d 



If "2 



z «-»•-» «^ o •-» 







i 



o ^ 5 a s 




S 



'•I "♦ 



ooqooot«>fg>eot^i^i^c«qpcD ooo 
Ok O 9 Ok Ob O Ok Oi O Ok Ok A Ok Ok Ok 



^ « 



(£ 



oor«oooo>oc<»C4r«^cioo «t^ 
•^SSQ3S'^t?SS'^$dk w*^ 

OkOkOkOkOOOkOkOkOOOOOkOkOO OOOk 




sp 



a 




Classified Civie List — State Departments 



3ia 



888 888S888888S 888888888888888 



§SiiS8 



o o o »«. o •* 

« N J 



8 






55 ^ ^ 
h- t>« r^ 



•S lo o 25 »o "5 iJ? 
t>« t>« t* t>» t^ t>» t* 



88888 
8 8 8 8 8 



^ c« CO •-■ CO M n 



e«f-i^c9ncie^e9e4C9e«e«<-iioeo 



M C« Cl i-i CO 



OaiQaoooo«DQeoQaoor«*4r« 
^ce a a a a a> a Oi a Oi oi a oi 


OOOOkOiCOiOiOh* 

OOC90»0>OCiO 


O »0 to 00 00 kO 00 

•iH >-^ ^^ — 4 ^^ ^H ^^ 

O O O O O O OS 

,H f-4 (ii^ iH fX f-4 ^N 


00 !:• ^ o 00 
^ p o •— ^ 
0> O O O) O) 

^4 iH rH rH «>4 


a.«i-r^«o*H aecs^-^r»'«o.-«'iif 


0>* — ^^.M^P^ 




^^ o •-* oo »-» 



< 1-1 b 



s»'-»C"<^xa5a!i(»«-»0'< 



9^ ^«*«*-*»-*» ^■«j««.«j ^.2^.o 

5^00 o o o oj; o e p 33 



-<zzcocoSooo-< 









^ 



oiQn900!fOoooc30ot^e»t» 



00«Of-4*-i00'-4iMCOL'3«D'<«0000iO00 
OOOOOQOOSOOOOOO>0>0>001 



00 m >o O 00 

^4 O O ^H ^^ 

O O 00 o o 



^l'^-<*^eooooo«-^^^•o •^'O 



o<^to «o(OiHQe*^^tf3poo«-4*^<^<-4>-i 
^ t-i Ki o 1-^ c^ 5» 



a -S jm» ♦* t; 



Si ■•« «a 

« a a 



a^ e 



^(S^^ccs.^cf^,«^^5 4 



550 a ft o S a-g 3 



i-» •< l-» fri •< 



^H «-• 1-t 00 f-» 



e 



e 



t 



ill" 

< — *• 



9 



d '^ 









5 1;^ 



c ^ 

r > 



8 = 






555g2ia 



c o 

XI ^ 



^1 o 
p ^ g 



.3 

•n 



& 



S «o ej C 

0» •-• 



§ 



a 

J3 



OD ► 



• c 

§1 

OQ OQ 






eo CO 

^ CO 



•S8 



1-2 t! 



a 

4 

5^ 



<< 

IS 

II 



a 
1 

a 
o 

00 *« 
CO fa 



s ^ 

•S r 
o ■** 
^ ou 

e« 00 ;? 
•^ ^ P^ 



E. 



I 



1 ^ 

> - 



a 



& 



1^ 



00 CD 

5 



J 



5 

•O i-« 

CO t» 

CO w 



a 

s 

B 
es 

1 

d 
• > 

oil 

K eg 

•9 PL4 



I 



>s i 

S'i ^ 
;: 6 
E a o « Z 



« -Si 

bus 



5=5 

ee 



a 

o 

.5 . 



o 

§ 



sa 

la 



&3 

S OQ ^ 






o 



O 
>• 



u 






« J? 

« H r; 
t^ j^ ^ 

<< fa J 




* 
S 

aS« I 
s. • ♦* ^ 



- I 
^ s 

6h 




1 1 ill 1 1 111 ill 



1 1 &|8 

rf^ rt 5 r* a 

0k H a h»QB 





S S M 

X -C a 

k u a o 

^ -o 'S c 

'A -^ E o 

a • ^ g 

•3 o c o 



5 5 2 S 

V o c u 

s s s s 



314 



Repokt of State Civil Service Commission 



a 

''I 




I - 

a ^ a 

6i I 



g 

2 



55 

O 



09 

o 



88888888888S8585gS888 888S 



S8888 

r* r* t>« h- o 



o 

8 



S 

r* 



S 

o 






M C« 



eocic«c«c«cici<-ico<^^e« 




. c 

« c^ ft- 

^1 I 
^ _^ cl 

S S M 

lo 1-^ tM 



a 

si 



CO 



S i 



Q. 

zn 



(3 6 

«4 CQ 



a 

o . J. 

B 3 a "g is t 



--• a X ® ^ 3 

•^ *3 "3 " s? .2 

tM e! B (S t: -; 

•-< O fc^ O fc« »-4 



CO 



e« ^ t-T CI 



«oco->c«eoe<9C4ao«r^r«r«t<-t<-to^iQio«f<o»>o 

0000000900090)00900)00000 


•O 00 g 9 

S o 8 s 

w^ w* T^ r^ 


N t-l ^4 ^^ ^H M Fi^ 

'a'a ibis's 3*2 ao-g 3^3-g §9o-g*S && 


Oot. 1, 

July 24, 
Oot. 16, 
Fub. 14. 


lOI'OriMCOM 00t^«l*r^t^«Oi-i,-iM^O»»O 

OO'-«QO--'-t00»-«t-iO--»-«---^O»->»^O0C»-i 

aoooooooo«-*ooooooooooooooooo 


1905 
1918 
1890 
1899 


.-itM^o^«-'-4 .to>->cocceo<o»o^i^«49^io 
o33sJ,23 ~ S ao-g 3 s-g §3j2 go ar 


Oot. 1, 
July 24 
Aug. 1, 
Feb. 14, 



i 



► 

< 

s 

e 

5 



c 

ffl ® 

I ^ 



S? 3S 2 « 
1^ < ^ ^ 



3 b a o 
O ^ U c^ 




Classified Civil List — State Depaetments 315 



§888888888888888888888888888888888 



888 



M 8 



CO 



^^^ ^888888 8888888888888 

•^■K s^rf ^k ^^ ^^k ^K .f^ *A »^K ^^K. ^^ ^^ ^^C ^^E ^^r ^^F ^_? '"_? ^^ ^"^ ^Br ^^ ^^^ ^^ 



CO ^^ «M 









>. > 






I*; M t* »0 M X ^ 






•-^OMtOt-'«M'-»t»i-t»^t-«M»-«>-^i-tOMiHi-i«-«t-« 
M M ^ ^ M i-i 



C4 f-4 «-| tH tH vH 



i-« »o r^ 






e 



-< < 



B 
C 

9 



e 
«e 



c 

^< 

< J 

Is 

s o 






< • J 

°° gfc 

IP 



rt ^ lO CO 



c 

< 

'^ ' 5 

^ o> ^ 

S! X« tt) "* 

^ .M « oS 






S fs C O 

8g^ 

W M U3 



IJII 

< < 5 -< 






w tS « 



c 






a 
•s 



a 
> 






5 i ea "o 

-< M ^ •£ 

»« o t>« _3 

'H M ^ < 



TJ C 



C 

o 



"^ 6 



J = ? 






(3 ^ 



a 



o 






m 

S CO 

£ M-S 

•-» M W 



a 

CO 



I 



> 



a fl 



8 « 



^&l 



:Sfi 



M Z *-< 



» 

00 

fl r r 

^ CO 00 

•g ra ns 

QQ iO tA 

«5 X t- 

M CO M 



^ I = 

Co Q 



Ill 

*Oo 

H •« r! 

5^ :z: 






c 

«9 

>. e 

go & a c 
»< (X4 i-i P^ 



5 fl;S 



B 






« a = ^ U 



< a = S k 
. r" ^^ "^ 

a w o •* 



S 



o 



&u » 



& a 

fc o S 






e . • 

M4 01 

c 2 g 

B C ^ 

a n3 c 



s 






* 



S^l^ 



3 a -S 






a- K 
si d 

a a 



8 

u 
Xi 

S 



11^^^ 



(S4 



4> 

•a 

a 



III 

OQ 

« 






< fa^ 






a a 

:s2 



^ y ? 
■0-5 o 



"- So get; 

•S -S 1 e g g 

12 nil 



c a c c 



«1S 



•S •§ -s .s ^ ^ 




^t 



G 
O 






B fl fl a a s 

a ^ tt d ci ei 

•c -2 x X X X 

g c fi e 2 E 

X .0 X u: ^ X) 

■ P* •** •^ >pi* >^W wmf 

2 Z x Ic X 3 

d 9 fl 9 fl fl 

GO cc a: GO oD cc 



fl 

O 



Si 

fl 

X 




816 



Rkpobt of State Civii. Ssrtice Commissioit 



8 

1 

O, 



^•i 






2 



^ 8 
9 '3 



Mr 

s 



s 

a 

111 

OS ■** O) 
WHO, 

JS - 



2 

O 

H 

2 



8SSSS88888888888S8S888S888 
§S88S^3SSSSSg^S§S88§ 



000fi0)000k0>0)000fi0)00)0w0t00>99 



tM^H^H^H»«(O»-<e0«^«^Oi 






»^<D^Hp^^^t<»0»'^»^ 



8t: 



e« ^ 



^ 

3 



OO 



a a o. ^ 
oD 00 do Pm SQ 



•^ ^ 

o.^* 






> 

o 



e 



o 



!? 









•Meii»-4<MiHCDv-ieo<Hf-4ak 



A lO iH CO 



iHC0tM^4«pH|t«9t-4 



O Q !<« M ^ 
^ « •H 







acaccccccBc 
43 .8 .2 .2 .2 .2 J2 .2 .2 .2 ' 



5 



c c c a c c 
S S S S £ S 

,2 .2 .2 .2 .2 J5 



B C 
5 S 

,2 .2 



a .2 .2 .2 .2 .2 ^ .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 ^ .2 .2 






«9 






«9 






ecEgsesccecssccEEEEC 

• M vp* *•■ •«« •*« «•■ •M •wm •«■ 'P^ a^ •■9 v*^ •#« •«« •*« •*« •*« •»• vff^ 




Ci-AfifliFiED Civil List — State Defakticents 817 



S8888 888 888 88 8 88 8888 888 8 888 8SS8S888 8 
8SS88ggg9§8gSS88888S?S88888SSSS88888S 



*4^«i4r-l«iMtMvMi^^4v4^Ni»*^N C4i>^*^ 



n c« «-4 M 



o9ooioo9OOO9oa)9o»o)o»0boa«e)a>e>ookc>oa)Saoe»a)9a»a» 



^< »• • « »-• 



^^ 



w ^ ^ « wi 



w^ wt t£ t" 



ro ^ «-4 o 









iiummmnHiii 



>^ A -^ 



-O ^ R-^ ft «l 8 ^ « 



4) 



■ ^ > ^ 

S o o a 



ii ,H ^ M ei e« 







ETuatoOOOOOOO 




318 



Kepobt of State Civil Sekvice Coicmissioit 



g 
•a 

I 
I 

O 

O 



5.S 



1 



(3 

o 



■S-S-g 



o 

8 




<9 

2 



2 
O 



CO 

2 



II 



88SS88S8SS8S8S8888SS8888SS 



W 



58 

1-1 o 



S o 8 

d d Ci 










00 

g 




•-4 


eo 

f-4 




?? 


f-4 


iH 


CD 


to 

t-4 




00 




eo 


CD 


CO 

Vi4 


—4 


—4 


—4 


r^ 


'T 


00 

i-« 


00 

»-4 


00 

w4 


*-4 




0» 








o 


1-< 








»4 


^4 




*-4 




1-< 




^4 


^4 


^4 


i-« 









0» 


»H 




KM 


1-< 


«r 


lO 


^4 


^i^ 


• 


§5 


^4 


tM 


tM 


kT 


CD 


r<r 


CD 


• 

CO 





^4 


^■4 


^4 


1-4 


CO 


«o" 


» 




CI 






^H 


CI 
















»^ 


^4 


^4 


tM 


V^ 






r^ 




•^N 


w 


?« 






Q, o a 
<! O •< 


• 


s 


(J ft 

o -< 


1 


s 
4 


• 

CS 


(3 






• • 

£ 




a 
•-> 


-3 


•-> 


< 




c« 


^ 


^ 


M 


eo 


f-« 


eo 


•o 


•o 


S2 


o 


^ 


lA 


«D 


"* 


eo 


CD 


CO 


»o 


r^ 


r^ 


t^ 


e«o 


1^ 


oc 


»o 


^4 

a» 


P>4 
f-4 


g 

f* 


^4 

o 


c» 




^4 

a* 

P>4 


o 




*-4 


^4 


^4 

•4 


1-^ 


»M 
O 


o 
•4 


^4 






—4 


1-4 


1-1 


P>4 


^4 

^4 







r4 
^4 




• 


o>' 




CO 


oT 


iH 


* 




8 


*M 


s 


1-^ 


r«^ 


<0 


t«^ 


• 


CO 







• 




«-4 


»^ 


^ 


CO 


fc 




C4 


«-< 










^4 








^4 


»^ 


•M 




1-1 


•-4 




»H 


*H 






C4 


CV| 


i 




a 




o 


• 

el 




•c 

a 

< 


1 


c 
3 

•-> 


1 


a 


>> 

3 


II 


• 

8 


• 




^ 

S 




4 


• 

c 

08 

•-> 


1 


• 

< 


6 

& 







a a ft ft ft 

ISIII 

00 CO 00 00 QD 



« « V « ft> « 




OOOOOOaQOOODOOOQOQ 



M.ftftaftftftftftftft^fto.ft 

_ OOOQOeOOOOO O G S ^ 

Q a G 



ecaaaeagcGGaa 

OQQDeOODQQaOaQaQaQOQCQSS 



Classified Civil List — State Depaetments 



319 



88888888888888S8888888888888888S8SS8 



CI 



O C4 S 8 



o 
- ^ 



8 

CO 



8 



8 



o o o o 



N •-• N 



oDaoQOQOooooQOooaoaOQOaot>*«otoao^«fr«oao<oo^oo^oOi-ie«acoaooiQOOO 
ooo>OiO>o>o>cfto>ooiOiO>c>c>090o>o>aoo)aftooooaOQOOkO*aoooOGOoAOk 

-< o S 2 o»? 









xaoooaoooaotOQOr«totoXt»r«(00(OQOoooOtMr«^oo«fiaOi-4C9A<-iaociooo^ 

«-4«^r^vH^4^Hf>-)iH«M^NiHf>-)«Ma0CbOOX9^49AO0>t<«0kO^4OAACb0>OOO 
OOftOkOBQOiOiOiO>0>000>OOOOwQOo5wOkOOOOQOQOOOQOaOaftOkObOOOOQOd09 

CI i-i^e^,-H ^ .-I e^e^e^ cieo*H^ cooi,-i m ci^ci m 

c.OmiSu^^JS' 3^ ^J;o^© STS 30i33^»55^^S a® 3 «>S3 «3a 




1.|a|-i=i 



2^^=^ 



;a fc 2 . fa 5 

•s •£ ^ ex 

S a S JS 3 

H C ■ «« •r) 





lllpll^ 









i 



2o^3Swl'^ 




9 



s 



4/ V 



■§ 

<9 



k ii 



& 0; O O 



i 



SS-g ' 

o 



o 

CM 



•3 

I 





OQ QQ QQ QQ 00 ( 




4tf J< .M 4tf Ji .M 



t J & ^ S3 - 



mP 







320 



Befobt or State Civu. Sbbvicb CoMicisaioa' 



t 



a 
6 



an 



a 

JO 



2 o 

» « ^ 
118 

OS'? 
g-3 



a 
o 



«:$ 



a 



2: 

o 



CO 

O 



t; 



8888S88888888888888S88S8S8 

ssssssississssssSsI 



8 

o 



S8 

o o 



SSSsSa)9ioSSaoSSo»o8S8SSSaaoaa» 



s s -^ ~ 

III! 



Illllltllllllllllllll 






l^;| 




>»< ^ 






-=1^ 



a 
o 



|§£f£ 

^ '^ b « ^ 

o le CO oa 00 

5i 00 ^ t- •- 

CO 1^ M M M 






a 

3l 



s 



«D 8 -s 00 8 



■O «9 Cl 

r» o o 



C4 8 





o ^ S 

n o CO 





• a > 5 i 

2 < (£ H a 



MMJ4M^^MMMMMMMMMMJtMMMMMM 



M M M 



o0 0oo5ooouooSoS5 5o5;;5 3 0o3G 



Classified Civil List — State Departments 



321 



88S88SS8888888888888S8888S88888SS888 
gggggggggglllllllllgggggglllllllllll 



•oaot^^iOQO*Heo^^aoooooieaOQOioootor^oiicr«r«<Oict^aOQOaoQOO>ooaoQOao 

3 & o -:; 



O *0 (M tM to 



^^ 



i!illl|s|||iiliillllllllfiilil|5 



J^^; 



^•or«'<i*ioic»^eOfH»-4ooaooo*ocooo>o^>oiociior«r«<oior«aoaoaoQoaixao(X)QO 




« c'S'S'tJ'S'w'cJ'o'C'S'S'S'S'S'STS'iS 



M M M M M M M M M ^ J4 M M M J>i M M J4 § § O O & & 



11 



QOOOOOOOOOOOO 

^ 'fS ••• *^ "^ '^ •■* •*«• ••* -p^ •»• •»< ••* 

§§§!§§§§§§§§! 



322 



Repobt of Statb Civil Service Commissiok 





8 w 

g-S g 

i a ^ 



o 

H 

O 



S888888888888888888S888SS8 



QOQOooooQOQOaoooooooQOooooaer«ooooaoQOootoi^e<(^>or^ 

00Q0a0Q0Q0a000Q000Q0Q000Q000toa0a0Q000Q0^l<«CII^»0(^ 



^ c* 



ct ^ 







^3 



J9 o a« « JS JS c 



COOOOOOOOCOCOOOOOOQQOOOOOO 
.S .S .5 .S -S -S •-» •"» •« -a •"; '2 ••2 '2 'i ■;; '^ "2 '2 "2 'U '2 '2 *2 *2! •"• 



Classifibd Civil List — State Departments 



323 



888888888888888888S8S8SS88SSSSSSSSSS 
§§§§§§§§§§IIIIIIISIIi§gig§§ii§§§|S|| 






i«> »« »« oe oe 

v4 tH (M v4 tH 
0ft 0ft flft flft A 



OO OO OO 4D 4D 
tH *H *H *H *H 
0ft 0ft 0ft 0ft 0ft 



co«ooor.^^r.^t«t«oooooooooooo<D<Doet^t^oo^ac90^fH^oor»r»ooooaooo 
a»0ft^^^^A^^0ft0ftA^A0ftA0ft0ft0ft0ft0ft0ft80ft0ft0ftcB0ft0fta»0ft0fta»0ft0fta» 



oe t^ t^ oo 

•M tH *H »4 
0ft 0ft 0ft 0ft 



0ft <D t^ 



iuhu 



tH £1 ^ tH tH 



«H p^ «H f-4 «H M pH 



s 

z 



l^lll 



fa "^ "n fri 



ll 



« "^ "n 






•-4 OO lO h» ^ 



s s 



1^ 1^ »« OO 00 

0ft 0ft 0ft 0ft 0ft 



00 

0ft 



OO OO 00 4D 4D 
0ft 0ft Oft 0ft 0ft 



OO lO <D 00 



QQ f« f« 00 00 00 00 

Oi 0ft Oi Oi Oft Oi 0ft 



« «D lO <« 
c* ^ ^ 



*H M r4 *4 f-4 



tH tH vM 1^ 

*< "n "^ •< 



9i 94i4 



I 

5 



I 



>t 



a 







S* SB 9 "C 






llilllllllllllllllllil 







i i I IliHii 



324 



Rkpobt of State Civii. Sebvics Couuissioh 



S 



I 



a 

in 

oil 



® • 5 

-II 

g 8 



Jo s 

l4 



I 



S5 

o 



II 



8888888888888888888888888 



S S S ^ Q « 

2 ^ ^ e% S 



§§§§ 



00 OO 00 OO C4 CO 

*H *H ^4 «i4 «H «M 

flk Oft flk Ok Ok Ok 



01 fH 

t 

o 



g.^^^ 



§e<«DQOoo«t^^Me<>o«De«e««Daoaoooao 
OiOkflkOkOkOiOkOkflkCkflkOkOkOkOkflkOiOk 

'^^ S{ 2 ^' 



<D0k«-4tHtH0k»^«^*^<H«M^4tii«(D^^ 



si S^E 



IIIIIIIII4IIJIIIIIIIIII 



ooaoaoooAeor«c«(oao 
OkOkOkOiOkOkOkAflkflk 



QO^I^^mMAtDCIM 
flkOkO^okOkOkOkOkOkOi 



9 (D CO 00 00 

Pi4 »^ r^ *4 <M 

Ok Ok Ok Ok Ok 



C« »H 1^ ^ ph •< 



<DOkf-4tHiHOke0fHfH»i4 



iliiiiiii^iiii 



9i§|3 







a >» 
• 



*H S 4! CO S S 

C« (X (D »H (M Ci 







^ J (S £ ^ 

r "P «f 




I 



I 




a 
« 

a 

1 



-HIIIIIJI 



« e -S -9 -3 -3 -3 -8 ?• r 2; St ^. •^ ^ ^ ^ ^ ^ J 



A (C 04 (^ 



J> ^ > > > 



Classified Civil List — State Departments 



325 



S8S888 

o »« o o Ok e 



o e« ^ to <D ^ 

«H *4 Vi« *^ Vi« *4 

fli flft Ok flft Ok Oi 

«i4 •>« tH ^4 r^ «H 

i-J ^ iH #4 lJ CO 



mill 

O M « to O -^i 

r^ »H ^4 «H Vi« ^rf 

Ok Ok Ok flk 0> 0> 

Vi« *i4 «i4 ^4 tii« ^H 

m m • m m ^ 

fmi ^ r^ w4 w^ n 

liiiil 




1 



: SsS 






K 
O 

55 





88 



•^ tj 


i 


« 


*4 


(M 


^ 


•* 


lO 


IC 


88 


8 


*4 

o» 


»4 

o» 




o» 


*4 


^4 


W^ 9^ 


»^ 


^^ 


Vi^ 




f-« 


•H 


*4 


*4 


eo »^ 


c« 




• 

eo 




* 


• 


• 


•* 


CI ^ 


CI 


«M 




c« 


CI 


C9 


eo 


c« 


^•s 




• 


& 


• 

«8 


i 


• 


• 
«S 


• 


oSfc «< 


^4 


s 


:s 


:g:^ 


s 



r«r«A«p^ci^^>oto 

SOOkO*^*-*^^*"**^*^ 
900OiOtO^flkOkOkOk 



o 

of 



1 B 






CO •M 
CI •- 



c« 

ra 
o. 



CI 



Cl 



c« ro 



^ eo 

S S :?; (S s ^ 



i 

00 







S 
.-3 




o 



1^ o 

a» o» 



a» Ok 






*4 


lO 


IC 


r» 


w> 


K) 


« 


*4 


^4 


^4 


vH 


»4 


«rf 


*4 


o» 


Ok 


a» 


Ok 


o 


Ok 


Ok 


*^ 


^4 


*H 


«M 


^^ 


«M 


*4 


CI 


CO 


• 

CO 


• 

00 


s« 


*4 


July 

April 

April 




•1 


5 


•-> 


r^ 


m 


to 


1* 


lO 


IC 


00 


^4 


^4 


1-4 


«M 


^rf 


^M 


»4 


o» 


o> 


o> 


Ok 


o» 


o> 


o» 


t^ 




«M 


tH 


tH 


^4 


^4 


c« 


^4 




00 


ss 


^H 


^ 

•n 


April 
April 


If 
s 






3 



1 



i 

6 



JO JO 

^»5 



o 

CO s 



£ 



I a s • s I ^ 
I 'ja lis s .s I .S 



Xi CI 




d 
.9 



cc 



o 

9 

a 
.!S 

1 

3 

O 



S s ^ s ^ ^ ^ 

i i § I i ^ § 

S 1 § S I 9 I 

1 1 i a a F E 



326 



Bbpobt of State Citii. Sbbvicb Comkusion 




S 8 & 

III 

S-8 




z 

o 

H 

CO 



#/ 



8 



S 












a 



0» 



•8 

to 



I 



d 

■s 



9 
1} 



Classified Civil List — State Coubts 



327 



O 



o 



o -^ 



1 



s 



I 




8 ^ 

111 



55 

O 

H 

S 



M 

s 

00 



S888888888 



oooooooooo 



v4v4^4*i4«M«M^4*H*H^4 
Vi4^4^4^4vH^4^4^4^H»4 






S 

3 








OS 



si a '^ *" ^ " i^ 
»>i S^ 11 Is 



M 



iiiilili 



f5 5SS5i«55S 

•p4 •■■ •■« •■« •*• •#* '^ *^ 

•a 8 

g4 




S8SSS888 

04 04 esT ei e« ci cT esT 



*4tH»HeoiO«o»Hiir 



•-* 1M 01 

-^ ^ d o' •§ 



i "i J 



« M V 




1 







§2 



1^ 



52 

CI M 



« 8 * 






I 



J 



e 



III I ill 




d 

o 



E 

I 



.3 .9 .5$ .S .S .S .S .S fl 
lauqcatatdccitdid ''^ 



828 



Befobt of State Civil Sebvice Commission 



O 



a 
o 
'it 

i 

s, 



•S-9 

I 



a 
o o 

•a *5 



1 



"S-9-E 

as? 

g'8 



I - 






S5 

O 



S88S88888888888S8888888888 















o 
O 






O M> K 

•M »M o» 
Ok O QO 



•O 04 «0 



to 

00 



^aoa^QOi-«^et^eoao^ioi^ 

00k90000t0i0ft0b O^oOOtO) 



e« CO .-< eo N »- 



i-4^*-4f>4i.4i^QoorH^O<-4co^coo*ea>a»<o 




I 



53 a ^ 



S^^4C 




a a a «^ 

•533 - 



d d d 
5 555 

(8 eS (8 eS 

'S'S'S'S 

« (8 (8 (8 . 

h b »< b h |« 

^ .£3 .£3 .£3 .£3 ^ 

a a a (x a a 






I 



a 



ig 



a 
I 




ill 



l||§g|l|ll 

dddddd«<?fi« 



d d d d d d « 
5555555 

O 00 00 OQ OQ 00 ^ 



•;• 

^ « o e- 
S£ 5| 



(jLABSivum Civil List — State Cotjbtb 



329 



88888 
3SSSS 

•^ et ^ <« 00 



8 



88888 



00 00 00 00 00 



88 



88888888888 

eo CO "eo" eo CO t^ ^ wm 



3 



1^ 00 r» 

s s s 

r^ mm m^ 


1918 
1918 


^ iC 00 


^ OO 


July 

Nov. 

Feb. 


July 
Oct. 


•^ 00 K 

w* w^ t^ 

c» a a» 
vi« vi« r^ 


1918 
1918 


^ ic eo 

1^ 


m^ 


July 

Nov. 

Feb. 


July 
Oct. 



3 3 

1|5 



CD 

-a 

o 












W O ^ "3 
^ « "< < 



* 



G 



c "a ^ ?: C 



^ 



o 
o 



d 



I 



! 



3 

OQ 



If 

b 

6 



«o 00 e lo <o 

mm 9^ w^ ^m mm 
0> 0k 0k O 0> 



^ Oi <^ o» 



ra 






lO 


00 


to 


•o 


«0 


^M 


^^ 


w^ 


^M 


>^ 


O) 


Oi 


a 


e> 


o 


>^ 


^4 


•>4 


^m 


"* 




^ 


• 




o» 


v^ 






CSI 


«M 


• 

•9. 


• 


• 


=5 


• 

a 






^ 



s 




I 






}}l 



i-<:^(Vi »<P< 



o o 

•§•§111 

•^ "^ »-» < < 



&& 



3 









i-i CSI 

< S 



00 o 









&1 

< 






9 

B 

O 



h 00 f-i 



^ 



i 

O H 

fa Sz3 



o 

a 
g 

O 

a 



o 

o 



a 

a 

I 



0) 

-3 



M 9 



o 

M 
> 

P 



•oco<o<or«^^Qpi^<ooo 

OiO0kAOl9^OOO>O> 

»^«0«0'*»H^f-iO«0»-«00 



N 




S k q 






90i0k000000i000)0k 



^ ^ CSI I mm mm 



Ro 



o 



► ^00 

•5 ** - 

o Is 

® lO "^ 

M to CO 

*-• Q S 

•M c5 « 



I 



< 

III 

r rH 















M 



- CO J ^. 

^ -iJ °° ;S 

2 9 9 d 

«1» -f « o 

C^ ^4 ^4 v^ 




^ a S 



a 

9 
O 
o 



SS&E 



•a o. ft * 

_ O O "O 

d a a a 9 
5 5 5 5-^ 

•g TJ "g •© ♦* 

« «> «> V •d 
•3 75 o -3 J 

>» ^ ^ >» b 

&&&&§ 
QQdQoQ 



0* 

.4 

-I 

S » M »« t« 

"S "5 fi s « 

• J3 .fl .13 

fl a oB cs « 

2 i: a a d 

5 j» V «» «> ^ 

fiS O OD OQ 00 fi 



§ 



330 



Bbpoht of State Civil Sesvics CoMitissioir 






0) 

Q 

H 
CD 

U4 



O 



CO 



111 

11 

a 



'II 

I 

g-8 



5.9.9 



3 



55 

O 

H 

CO 



888S8S8SS888S8SS8SS88SS 



hri^h»t^t«h»i<»h»r»i^»«i^t«t«t«i«r»t^t«t^»«roh» 



oe«iocot2{»<Dh-o<DM^^e<«aooQor«e^c«cor<. 






«feokO0*ooaokAflkwak99O>ako)oo>oAataka> 



v4'^*^w4«Hpi4pi4pi4^4pi4P^Vi4*H^4lO*4^HO>'4*^ 



s- 









: >^ o >; ^ 



^- ^ O ^ >* 5h . 



QQ ^ CO 



», 55 55 - 

. . • QQ 00 «i 
«^ 4^ ► ^ ^ CO 






:Oo : : : : 

: >^ >; 6 cj d ^ 
j z z jh' >; >; >* 

. .^ CO • . > 7 
. ^ — ♦* ^ «» ■•* 

• a g CO 55 00 ® 




m £_• CQ 
^ 3 2 

55Q£ 



'^ 'S *l '2 s '5 '5 '2 i « "2 '2 "2 *= -g - - -^ - ^ -a -5 -5 



Clas8I9i£d Civn, List — State Coubtb 



331 



8888888S8S88S88888888888S888888888 



•OCOCOCOCOiOCOCOtOCOCOCO^^^^*^* 



(»i^»4«aoooieaoioo»ooa»<ooo»^eoiocoao«-iro«e«o c«*c« e »« <d o ^ u) oo 
oicl9ODOk90»oka>Oft0»oka>a>a>90»o»okOfto»a>aookOiQOOo)O»akOk9a»^ 



« 0» M ^ 



82"S 



^i< ^H Vi« VH v4 00 V^ 



«0 ^ «H 



If) »4 lO ^ lO 
^ 01 



4 55 I 4 -< -< 2 Q O 4 5 £ £ 4 »? 4 »? O 4 Q fi < 4 Q •? O cX S Z Z ^ »? »? S 




U S 8 CQ ^ to 



*4 m «f «^ *H 
•o ra ab Q *0 
•-4 c^i ^ 9 CO 



J 







332 



Kepobt of State Civil Sbbvicb Oommibsioit 






si 



11 



3 o 
8-8 



i - 

I- ft 



o 

09 



2 
O 

H 

GO 



S8888SSS88S8SS88SS8SSSSSSS 



S 00 



n o 



a686aD95SwaDQO 



§ 



fao«Di^o^r»^^090»aoi^«De<«Ofti^aoa>«oot^cooo 

feco»«0'<*t^^^<oaa»aot^<De4c«aa|«aoao^aor»eoao 

-||S|SS|i§|SS8S:g||S§|||4 3 3| 

^O»nO»-»»-»^'-»'-»O«^«-»»-»«^^»<5Z»?i^0Q^2*S»^»5O 

• o :: i :;:::;::::: 6 : o ::::: d • 

3|||I||||||||h^|||||||||||| 




lll^flib-illllllllliral 



•3| 
1 1 




3S335255555255S55s5ss5o5S 



^ *• ^ 

9 ° 9 

III 

•a -3 "a 

8 c 6 

•O TJ "O 

ta (c <g 
dad 
o Q o 



*» •^ -^ «* 

(3 £! fi o 

•t 0) • 

^ «« 4J ^ 

«5 «• «» S 

« « oB eS 



•Q "O T3 "Q 

6(356 



^^ -^^ ^^ ^^ 

^ s s s 
llll 

«* 4J «J «> 

eS «S « (8 

-a 

d a a 

c365 




1111111131113111 
SI 



d 

•8 

6 



e d d 

0; « « 

"O ^ TJ 

(C (fl <d 

c3 d a d 



•a -a 

•a "a 



d d 



•o -o "tl 

6665 




llll 

S 8 8 g 

•OSS' 

"all? 



Classified Civil List — State Courts 



333 



S88 8888888888888888888888888888888 

m^ ^* w4 ^^^^^^^cocoeoeoeoeoeoeoeoiocomiocoeocoroeoeomcorocoM 



90ft «ooDOD»0fto»c>a»a»oD««o»a»9Saaa»Bftoaa»So»SS5SSa»oftS 









^ »^ w^ w* 1-^ e* 

=2 



^Ss iii§83|sis8ii|isss8||sss8sSsss8 



42^ 






1-1 M 



04 



04 



tf) »4 0» fH lO C4 M 

^4 tH t^ d 






>*d>^ .S5fe^ :^fe' 
Z >4 ^ • r^ . ^ r 



>* >; ^ » ^ ^. >; >i 

±5 J . » 5 00 *j «i 



o 

55 



O 






CO 

•5 






H O 8 

J'' 



o • . . o • 



2 

CO - 



r:^> 






"^ a "^ I* « < 
><§ > « t: o • 



lo ^ ^ eo 



89SS9!S:; 




ftS4S.$ 



I 



: : : : i ! i ; ; i i i i i : : i : i : ; : : i i : i : ; ;| 
:i : i : ! i i M i i i i i ii Mi M i i : i : ! i :§ 

llllllllllllllllllilllllllllll-s 



1 



i 



a 
o 







884 



Repobt of State Civil Service Commibbion 



s 

i: 

8 
T 

H 
O 

s 

CO 



H 

g 



i 

o 






% 

•a 



I 



Jit 




i - 

SJ.S 






o 

H 

CO 



// 



S8S8SS8S8SSSS88S88SS888888 

§§§§§§§§§§§i§§§§§§§§§§§§i 



MMMMMMmMMMMMetMMMetetetetetmMMel 






«>4 tH 00 *H 

--J 

»n "n Pm "^ 



ao*Hr<««M«MtH*i4tH»40oio*^e<t 



«M tH to ^ »» »4 *i4 



vi4 (ii^ *i4 ^ 

CO 



9 8:f i 










i:?^M^^i 






bd »ZS ^ _ ^ 

mil 

»n •^ "n »^ ►n 






4i JM 41 

"S "3 "S TJ '3 o "3 



*l 



lllllllllllllllllllllllll 

3 



1! -S -H •S -K 

>i >k >k >k >» 
«« «• ^ «• 

I 



•"* •"* "e* •"* '^ 'ti 'vi 'ti 'et 'St •*! »i »i mi 

llllllllll^^^^ 





a a a a a 
5 5 5 5 





a a a a 

sss 




Classifibd Civil List — Statb Coubts 



885 



888S8888888888888888888888888888888S 



e«Mc«e«e«eie«c«e«e<cie«e<c«c«e«e«c«e<eoeoe9e9eoc9ioeoeocoeoflocoeoco 



CO eo 









88 



^ ^ «0 ep 

•^ •-• fi * 
A 0> 00 QO 



lOtii«Wt-lv4f-4f-4«M^4v4v4^4 



I 



(O vM (M 

04 



ri > > 

S o o 



9 ^ S ^ S-Sji 



a d ^ 
« rt • 






a 

«9 



i 



^ tp eo 
A a *4 

00 00 o> 



co«ooc«eoi^>9<P<ot^ 



lO a vM 



3SSSSSs^S^$sS$^pS«^S-3«^«-409J9*-«ooooo9»^^SS 
S^«o»«daaSoSSQOooo»SSo»8D0»aio»9S3oo»SScbS9Sa»o»«S 



,M ^ o ep 

jfc •^ "^ S ^ 

9 O 0> 00 00 
^H »^ »M 



-"^S 



CI 



«^ «H f-4 

04 



r^ *H ^4 tH d lO 



o 



I 



I 



^"S d S d 






c 






llllllllllllJIIIII 



^4 «0 *4 
CI 

4-<« 



i 



a a 
m 08 




I 



J« 4i Jk( Ji 

• S S «t 
•3 -3 "3 "3 

*»♦*•♦*♦» 

llll 

•O •« 13 TJ 

• • • • 
^ «• «• «* 

jjjj 



•3-3 



•37J'cJ'3'8-3'3"3'S7J'3 




a 

Q « O S 

o a €X a 

^ 51 5L 8. i 
CD on vi Qi d:i ^ til 



mini 

CO 00 OQ OQ dOi « OQ 







mm 



336 



Report of State Civn. Service Commission 



H 

09 



o 

u 

a 

09 



/ 



8 

1 

s. 

I 



a 
5 Q O- 



as 



I 



2 « E 

OS? 



9 

a ,». a 
I a 5 



3 

z 



o 



888888888888888888888888S8 



1^ 



coeocoeoeoeocoeocoeoeocoeo^ciMOVMCtci 



00 e 



•o 2 '^ 2 2 fc 
O) o> oi o 00 o 



SCO ^ <4* C« 
o ^^ *^ 
O A 9 






''■--g--2-*'"'2''"''3''2a'*''2'*8-"'S 






83|48||S||||||||| 



C 



?8=:5S 



00000^0*90^000 



i 



^»«oo«oee4coao 

Oflft OkO^OftOOOOi 



CO ^^ rH pH ^^ '^ 0* 



•M f-4 to 



2*g 



^ (O o 



■8 g-tl 3 si a s s| s s-li silllll ill 







1: 



o : 

So jZ 

•S ® >» 

« '^ 2 

•^ W to 






''Z 



CO 






6 CD 

«o "P 2 

8 J 8 
•^ 10 "^ 

S C4 S 



'Z 



^^^^ 

2 ^ «D ^ 
CO 04 M) C« 



• 



9 



• " - - 

♦it®. 



00 



^•s^ 



3 9 2 



5isS^ 



1^ • c^ jq 

M '^ "^ ** 

^ « ^ 00 

8 > 8 



tJ 2: J3 *» 

a *H 16 00 04 

1^ £1 W 

n 04 e« 



>z^^- 

Z rZ^ 

^ -S o 9 
8 Si 8 






CO 10 

3 



S§li 



:6« 
z^.'^z 



- r* 

»-i 04 e« 
et ^ ^ 




s " 



III 



b&a>««>«S8 







O O Q Q O 



a a 



§ 



SM »« N fc* k« • 







Classified Civil List — State Coubts 



337 



S8888888888888888S88888S888888888888 



0>aOOOOk990990k90kOkOftO>C>OtOkOkC>AOO>0>OkaOQfOO>000>OiOOta>Ok 
Ji pi C* C% a C* r^ Ci WW •-• ^»^CI fHC< 

i-^ d d q 4 64 4l%c^44i^'gi'gi ii a 6q ai a^Q G ^ qi q 

ici :::::::: ^ ••::::::::: -d :::: :o :::: : 

55 5 ^ 55 >. ^: rS5 2; Z 55 Z r j^ ^ 5^ . . ^5 ^. J * 55 ^ 5 S5 ^- j>^ ^. 5 j^ ^5 ^ 



Is 



V »• 



■s 







• « a '3 



•I 



o 

a 






a -a "e >. • iS 



tf bi S g « 



ali-i'sl|i:!'sllii|i^l«"^l'2-l^?ii:55l||i 




3 few S ; 

4 ?H;n^ 



888 



RxpoBT ov Statb Civil Sbbvicb Oomuission 



s| 

a I a 

h 

a 



3 

8 

T 

H 

O 

s 

H 

0) 



g 



e 

o 

O 
U 

a 
g 

D 
0) 



g-8 



J-sS 
■is 

2 - 



I 



o 



// 



8888S8SS88888S8S8888888S8 



I 



isiliil^lslilsiiisiJlllii 

S -"' S -^ ^ '^^ ^' a -^ '^' ^' -^ 2 " 2 2 -*' 8 •"" •"" *' -^^ '^* t: 8 




gi^lliiMiiJlliliiilliiii 







•3 •« 



lllllllllllllllllllllllll 



Ci«AssiFiED Civil List — State Coubts 



889 



888888888888S 



888888888888888 



o 

8 



b*b*t*t*t*t*|*«|»« 



1^ t* 1^ t* t* 1^ 






M 9l CO M 

f a « 8 *^' S 2 -^ 2 ^ '^" -^ -^ 

|s s| s s^l^l s s s 









e* 



•c 



o a a q x-^ a K a c a a a a a 






a 



d 



sill 



• *!* • • • • • • • 

qkqaaqqaa 



"6. Jo 



>'>i^>i 



-If: 

J ? g > 



CO ♦* 



2i 



06 



OD 






CO 



8 S 

lO o •-• 

•^ SI S2 

•^ 00 00 



Si 5 

I 



°° J 

CM T^ 
CM _>» 

« l^ 

^ CM 
CM 9 

S2 



■fc* *» 
CiJ CO 

s a 

r:8 



H 
O 

s 

H 
CO 






■Illlf b?^J^ 



c 






o 

o 

CO 



o 

o 



CQ •-• ffl CD « . 
«• -J J ^ < 00 

0* ^m Sa a 

W P A* 'd .C9 8> 
•S «* S r^ i" ;T 5 3 K 



>.8 



M 

O 
O 






II 



->o»Pkioa»<->aaCQC»^oo 




d 

JO 
00 



d 



..111111111 «« 

^ 45 ^ :? ^ ^ ^ ^ 5 5 < < < 



1 



o 




340 



Bbpobt of Statb Civil Sebvicb Commission 






H 
CO 



o 

o 

CO 



O 

e 

CO 



o 

a 

i 

s. 

a 

o 
O 



a 
Q i - 

s 



lis 
g-s 



^ o s 

S S a 



2; 

O 

1-4 

H 

1-4 

S 



/f 



SSSSSSSSSSS88SSS 



cocoeococococoeocococoeooocooo*o 



8888 S88 



CO fH 10 



r»c4»ocooa>«t»eoc^GOGor>.oc«'<i • 

00>0>OOiO>OftwO>000>OOi9A 


,1913 
,1918 
,1909 
,1917 




April 1 
Sept. 23 
June 1 
Mar. 1 



t-«cllOoeoa>«^•co^<oooot»r>e^lc9 

Oi0i00i0>0i000>0>0>90>0i00 



^ • ^ • • • •x • 






So. 



a G a tt 




S 

1 






H 




f^ eo ^ ^ 

Sfsa 

•^ 00 "^ "^ 




8 8 
00 







•3 .2 J 

S-S »^' s.fe 

a V OS J5 u « «8 

•< n u u ofo ^ 

S S S S S S 8 

'•^ .»< .w« •>« .^ •"" .^ 

4J «» -tJ 4^ •*.» •«-» «; 

S 9 9 S 3 9 3 

•-»•-» I-* "^ "^ »^ •-> 

SSBBS as 

•I- -2 -i! -S -ii -i- -a 

4) ft> 4) ft> V 8) O 

"S "S "o Tij "3 "S "S 

Q> ^ 4^ 4^ ^ C^ C^ 

^? ^3 ^5 ^3 ^J ^3 *0 

<q (d ua (C3 (d (a ua 



S S S S £ S 

• p4 '^ •v4 a«i« a^ a^ 

^^ ■** -^ "tf ♦* ♦* 

•^ "^ •-» "^ •-» •-» 

006000 

4.* .«i* «« -trf ^ .^ 

.14 J4 ^ J4 J4 ^ 

U »« »« ki k h 

"o "o "o "5 "S "5 



d 



d 






(d(C(d(dua<C(d(^ 
c c d d d d 



M « €0 



1-4 H K) 

virt O «^ 



4S£ 



SS8S S 

01 Oi 9 Ok A 



a» Ok 



^ • w 



I 




Classified Civil List — State Courts 



341 



§88SSSS888S8S8888S8§8888888SS§SSSS8§ 



8 

CO 



§§ 






S8 



8 



oeoeoe4e«C9<4i<4icocoeocococoeocococie4cic4c«C9Mc^e4c«e«e4cicie9e4cocoeo 



22 


Ok 0» 


1^ 


r4 
0» 


^4 <p4 rM 


»* o 

1-4 *.4 


^4 ^4 


»M 


^4 *>4 t-4 


*>4 

o 

f>4 


f"4 


00 GO 

*>4 m^ 

o 0» 

»H 1-4 


00 00 

1-4 »H 
^4 1-4 


00 

1>4 

o 

1-4 


00 

1-4 

o> 

*i4 


00 

1-4 
^4 


00 

8 

«p4 


O ^ 

rM ^4 


1*4 1-4 

1-4 1-4 
1-4 »H 


CO CO o 

1-4 rM 9 

9 9 00 

rM «p4 ^4 


11 


— ^ f-T 


t- •-« 


* 
««4 




C« tH •J' 




1-4 ^4 


* 

04 


^4 


r4 ^4 


1-4 


1-4 


1-4 <p4 


— — 
f^ 1-4 


*H 


1-4 


^4 




g« 




* » • 

»H 9 r« 

^4 


«p4 li^ 






• 


• 

a 


« d « 




g-gl 
»?fa -< 


• 


33 


d 


a' 

•-> 


d 0* 

08 C8 


d a 


d 

•-9 


• 

d 

<8 

•-> 


• 

a 
a 
•-> 


a 


• • • • 

III! 


• • • 

o o o 


5o 


1U07 
1907 




o» 

*>4 


1-4 

^4 


iiiiisi 


1 

GO 

f-4 


t^ 


8g 

S 00 

»H f"4 


^4 


!>• r* r» r» !>. t* t* 

0) 0> O 9 O O Oi 


1 

r4 


^^ 


11 


r. t^ r« r« <o 

O 9 9 O 00 

^ ^4 *>4 rM rM 


o o 

9 9 

1-4 rM 


^4 ^ .-1 ^ ^ 

a a a a a® 
-< << ^ -«! fe 


» • » 

• • 

d ^ ii 

4SS 


d' d 


^"8 

Is 


* 

• 

d 


• 


CI 

4S 


if 


* 

^4 
J? 


41 


* • 

d JQ 


v>4 

a 


^4 

• 

d 

OS 

*-> 


d 

08 

•-> 


1-4 


m m 

« 1-4 

1-4 


• • 

d d 
08 « 


««4 1-4 r* 

m 





d 

s 

I 

■ lA •-■ ••! ^ 




ggs 




^ .M ^ 

k h k« 

ft> « • 

>» >» >k 

«* «* 4i> 

d d d 

W & Ol & 

h o « « 
» 73 •© "O 




.M -24 



d 

I 



•a •3 %! ^ ^ ^ ^ h I' *-• ^ ^ *- ^* *- *- ^>4luhi4X*a'5-3>3'S-3 



Mm 

Ji » iJ .S 2 2 «* 
c-3 « «•§,•£•§. 
«> «« 4* 4* 7 7? 

Illllll 

d d d 

5 5 5 
CQ OD QQ 



343 



Repobt of State Civil Service Commission 



I! 



II 



SSSS8S8S8S8S8SS888S8SSS 



55 



§§§§ 



s 



eoeoeoeoeoeoeoMcocoeocoeococ«cie«e«c«e«<-i9 






lO 



M 



o 

o 



I 




III 



} 



'& 



s 

2 



z 

o 



a| 3 i'^«-s 11311-11 13 iOt^ is 



eo M lO oo 00 

i-< 1"^ O "^ ^^ 

Oi Oi 9 Oi a 



090kOi&00009aOO>OD 



^^^Nr^r4r^vH^*i4vi4l0^4lO*^v^vHl0^4lOvH^4Vi4vi4^ 



M 










4> 4« 4> 01 

.C3 U3 .£3 43 

cx a a cx 

ffS 08 fiS ffS 

M & 

o o 

a a a a 

iJ 5 5 5 

U> GO 00 CO 






4^ a< 4>° V V 

u: u: ^ U3 ^ 

a o. a a a 

e) cs « 08 g 

S b M & M 

c o o o o 

G a a a p 

&> a» V V V 

«j «rf «' ^ ^ 

00 CO GD 00 GD 




0) 4* a> a« 4) 

^ U3 U3 J2 U3 

c. a A a a 

a 



Clamifiid CmiLisT — Stati CoDBTs 848 

iiiiiiiiiiiiiiBiiiiiiiiiiiiiiiiiiiii 



liiiiiiiiiilisiiiilliiliiliiiiiiiiii 

-■ -- -• -- J _- _■ - „■ „■ _- _- „■ „■ „- ^ „■ „■ „- „- _- „■ „- „- „- „- „- „■ _■ -■ „- „- „■ „• „■ irf 

iiiiiiiiiliiiiiiiiliiiiiiiiilliiSiii 

-■ -• -- -- t.- -■ -- _- „- -- ^ _- -■ -■ -■ -f -- -■ „■ «■ «■ r.- «■ -■ r.- -- -- -- -■ r-' -T - - -I - rf 



ipili mm a ,.; Ilii! iiii 



Mill n iiiiiiiijiiiuiini 



ilill!llli|lillii|i|ii!li!lll!!illll 



344 



Repobt of State Civil Sebvice C!omki8Sio9 



«5 

T 

H 



H 
CO 



g 

O 
xn 

g 

o 
u 

M 

a 

I 
I 



d 
o 

I 

I, 

a 



o S 



■^1 



& 



•Is 

g-3 



^ « s 

J- ^ o 



^ 



55 
O 



00 

O 



8S8S888SS8888888888 



88 8 



S 



i 



W N « 



'^ •© 






Si ^ 






d » V ^ 



8t 



o 








at 



s s 



SSI 

«-» »^ H 



^ ^ lO K> 

f-4 ^4 *^ O 

Ok Ok o> OO 



c>icoeo(»ioioo»ooaia»aiio 



,H*Ht-4dlOlOf>«vHlOfH«M<0<-**^^^<-4^^«-«<^ 



ii Si 



i 



ei C O ■- 



e >» 



SS 






e 



e 





at 



a 



ss| 

^ "^ H 




e« 



O 



H 



6 



« 






at 
5 W« 



j 






.A 



b a 



3 

2 



2 



a 



a (3 a : a 

JJ ;J|i5i£l| 









^ -s 



s 

es 






m 



a (3 




<8 



a fl 

as 








at 



o 
et 



O 
at 



C 



C 
. -. ,- . -_ - . - _ O o 



^3 ^rt Tjj ^^ ^J ^3 ^3 ^5 "Q ^Q ^3 
00000000000000 



<<<<^^^^<<<<<<<<<<.< 



Classified Civil List — State Courts 



345 



SS8 



09 e« 



88888 88888 8888 



o o o o o 



00 00 00 CO 



8888 



o o o o 



•O M lO 

* • » 



CO ^ r« v-i o 

1-4 O •^ ^4 <-4 
Oi Oi Oi Oi d 



a o q a a 
*^ ^ *-> ^ *^ 






r» e* o 

V.4 «p4 »4 

Oi o> o> 



t-4 <0 lO lO *^ 
CI ^ 

>. >t >> u 

•2 «s « d c 

d M W4 «-• eS 

•-) »(S ^ nfi 1-3 



r« ,.4 ^ lo 
<o fi o «-• 

00 40 Ol 9 



• • • * 

K) «-4 ac lO 

rl MM 

«? k 'A' 

■A' £ S a 

S2sl 



C« M K) 

«4 ^4 1-4 

o o» a» 

V4 ^ ^ 


OQ M r» «-4 o 

«p4 O «>^ «.« *i4 

o» 9 Oft a» o 

ap4 fH ««4 «p4 p.4 


t* C% t* CI o 

*i« O •>< •^ a^ 

0> O Oi Oi o 

wm w^ w^ r^ 1^4 


1807 
1891 
1904 
1915 


w4 r* ^ 


1*4 


•-4 O to lO M 
M »^ 


2-88 


Mi 


• 
• tto * * ' 

Q 5 a fl s 




Oct. 
Dec. 
Mar. 

Sept. 



J 








1 






^ «• «2 





H CO »J »:4 M 



I 

8 S is 1 .S 

8 S S S S 

•*4 •^4 cprt «»• •*« 

<^« .*» .^ ^ ^* 

3 9 9 9 9 

»-» "^ •-»•-» •-, 

Q O O O O 

^ «* «« 4^ '^^ 

V o 6 « O) 

^ ^ ^ jS ja 

a a a a a 

fl IB IB 

go d 

«4 •*» -^ 

« • • 



g 



8 I S 8 S 

•«# •^ ••« apf •ffi^ 

lilli 



c o 

a a 

•^ .3 .S .S .S 
.^^ .^j 4j ^ ,^ 

O O C) o c 

0) « w « « 

3*0 "O "tJ "O 

ua «3 to ta 

a a a a a 

aaaaa 



I 



i 



"S J w ^ 

list! 

12 c? ^ ^ 




ao •? O t^ 



OD 




CO 


1^ 


^ 


M 


1-4 


»i4 


^^ 


».4 


a» 


o> 


o 


a» 




^4 


«p< 


fX 


• 


* 


• 


^ 


t^ 


n 


^4 


rM 


• 

s 




• 

8 


C 

<8 


•^ 


f** 


»^ 


•-» 


CO 


1^ 


^ 


CI 


»« 


m^ 


1^ 


1-4 


o 


o» 


O 


at 


^4 


w* 


1*4 


fM 


» 


» 


• 


» 


^4 


Of) 

M 


IM 


^4 







I § " ^ 



S S£ 
CD o (B n 




846 



Bbpobt of State Civil Sebvicb Commibsioit 



111 



all 

g-8 




2 
O 

H 



// 



8S88 



S8 



to t* 

Oft a» 






1-4 CO >H r-l 

^ «S (3 d 



CO l« <D M 

«p4 ^i4 Q ^4 

Ok Ok 9 Ok 

^N «p4 r^ vH 

• » • » 

1*4 CO (^ (^ 

i|88 




M 



II 

OQ «' 
JO 

>»-9 









0) 



n cQ > ^ 






s 






3 9 9 9 

»n •-» "^ •-» 

h »« h h 

0) « a> 0) 

U3 ^ x: .£3 

a Q. a a 

O 6 O O 



a 



d d 

9t 0) 



■ 9D ■ « 



a 



d 



d 

0) 



"tl "O "O "O 

<d (d 

d d 



(Sasa 



CO CO 



8888 



e e o e 



o6 






eo « ^ K» 

•>i4 o O *^ 

O) 9 Ok Ok 

«>4 v-i 1*4 *H 

C9 fH fH *i« 

« »^ •-» "^ 

CO « ^ lO 

•" 9 O (^ 

Ok Ok Ok Ok 



CO v^ fH *^ 






I 



^^3 

•^ t-k "^ 






CO 




a a 



d d 
S S 



8 8 S S S 

•rt 'f* *f4 '*? "^ 

9 C S ^ ^ 

9 919 9 



888888 



n 



CO 00 9 <M 10 »* 

f^ «i4 O ^4 v4 ^ 

O Ok A 9 Ok Ok 

^4 Pi4 ^4 »4 fi« v4 

»H 00 *H ^ ^ « 

CO 00 o d lO r» 

1-4 ^4 O 1*4 ^4 »< 

Ok Ok A Ok Ok Ok 

V4 PH V4 fi^ t^ <-« 

» — » * * • 

V4 00 ^4 V4 v-i v4 



illii 





Sw<«; 






9 9 



o 
d 



a 
o 



I, 

1-5 

53 55 5 



2e| 

8 8 8 

III 

*^ •-» •-> 



Jji M M 

ts ti \s 

-3 73 -S 



333 



II 



o U 




CuussiFiED Civil List — State Cotjbtb 



847 



88888 
8 8 8 8 1^ 

» * • * 
09 CO CO CO 



8888 8888 



o o o o 



888 



CO CO CO 



88888 



o o o o o 



SS o •-* "^ 
8 a o o 

•n ^ oB ^ < 

S<« CO 1^ 1^ 

V V "i^ ^ 1*^ 

w eo -^ 

|||3| 






K) CO <4* OO 

^N «i4 «p4 f>« 

O) 9 O Oi 

* • • * 

04 «p4 v^ .M 

|338 

fo n Ml CD 

t^ rm w* w* 

9 Oi Ok 9 

v4 ««4 fH «p4 

» » • » 

CC «-« vH w4 

•< "^ •-» "^ 




s s s s 

•«4 VP^ •»• •»« 

^ ^ 4i« -^il 

i s 9 s 



lO CO ^ 00 

^4 rM ^4 ^4 

Ok Ok Ok Oft 

^i4 fH ^4 vH 

» » » 
1^ «-4 fH 1-I 

|sss 

< "^ •-» •-> 

K> CO ^ 00 

IM «p4 IM <p4 

Ok Ok Ot o 



9 S ^ a 

-2 ^ J * 
< •-> "^ ►^ 



•g 



o o 



3*3 



66a 



Ok 
Ol 



Ok 



Ok 



CI 



r4 r4 01 «M d 
09 Ol M 



* * • 

3 38 

•<-<Q 






Ok 

»« 
Ok 



o 



to 

Ok 



M 



• * • 



>? «< Cm »? Cm 




w a> 0) 
^ J3 .X3 

A a a 



a 



s s 

CO CO Cfi 



S« «) a> « 

u o o o 

• «« vr* ap* av^ A*^ 

4>> ^ai •♦^ ♦-^ «> 



a 



3 

O 

O 



•2 



848 



RspoBT OF Stats Civll Sebvige Commission 



n 

H 

i 

O 

a 
& 

CO 



d 

I 

I 
6 



1-^ 

"^ « I 

a 



S 



II 

IS 

cS >-• 



8 ♦. 

^ « a 

8* & 



c8 

X 



S8888 



a 



00 



o <P <o 00 <o 

1-I O »H Q »-• 

^i4 «p4 ^4 (^ Vii* 

r^ -^ ^ 1^ ^ 

CI CI CI 

^ ii si ^ ^ 



O O <0 QO O 
^^ O *H o «^ 

O 9 9 O 9 



CI CI 



CI 



^ 



0) 1? «S »3 .<> 

U4 S S SS {X4 






U3 

V 

O 

Pi 



8 



00 

ja 

a 
a 

cS 



•3 

a 



iiPJi 



(U 



.a 



B 



CQ 



o 



V 



d 
.3 

.a 



•8 






d ft o 



9 



S : I 

ft> d S ^ _fl 

♦* s^ «i« ^ r 
03 O K w H 

.1 .§ .2 S .§ 

'■5 *•» '♦* '■•rf V» 

S 9 9 9 9 
•-9 "^ "^ "^ "^ 

O Q O Q O 

4J .«5 4>» <«« ^rf 

M M M M M 

U M M hi ki 

« V V 4; a» 
"S "3 *« "o 75 

!5 !3 3 .55 3 

4J 4^ •** «< «» 

B d d d d 

« S « V V 

"O T) tJ "O "O 

(d (d (d (d (C 
a e S S S 

66666 



8S8SS 

» » » » » 

00 CO CO CO CO 



r» 


«D 


eo 


CO 


>»i« 


s§ 


s 


00 


9 


9 


^4 


««^ 


fi« 


rM 


1^ 


1 


»4 




00 


10 


1 


CO 




CI 


t-4 


08 


1 


d 


•-> 




r» 


<o 


CO 


eo 


f 


s 


00 


^ 


9 


*>4 

9 


1-* 


^i« 


^4 


i-< 


1^ 


1 


eo 


* 


g^ 


•0 


• 


!R 


• 

d 


C 

9 




SQ 


<8 


S 



& 



t> a> 



u u 



5 



«> ^ «» .^ 45 

S S C 8 8 

M M M M M 
00000 

o o o 5 o 

CS OS PS tf tf 



o 






s 

i 

H 






d ;&4 
« Si 



tC^ A Pi f*4 



»> h W) l4 

0) o «> « 

jd .d ^ ^ ,d 
a a o. o. a 



& 



8888888 



0000000 



90 1^ (O (O 

i-« O •-• •-• 
9 9 9 9 



^ •-• CO 9 <-• O •-« 
C« •-« ipM 

s alls ^2 



eo ^ «o CO b> K) vH 
v^ O <^ ^4 O Q *4 
9 9 9 9 9 9 9 



«^ f-« CO 9 «^ O (^ 
CI «-• »i4 



S'^ 



•^ *» « ^ ** Z t-» 



H 
U 



H 
01 



u e 



§ 




g 



8 I 



CO 



« « o ^ w I j2 
^ w ^' o ^ . •< 



O Q O O O 

d d d d d 

V c; a> V « 

^J 4* A^ «< «J 

CQ CD CD 00 OQ 



$ § s s S I s 

••^ '^ "^^ mm* •mm ••■ ••* 

9 9 9 9ll9 



Classified Civil List — State Coubts 



349 



888 88888 888 8 8 88 8 88 8 888 8888888 8 8 



o 

8 



§§ 



S 



§6 S tfS M> 8 lo 

Oi (O O CD (O O 



COCOCOCOCOCOCOMCOCOCOCOCO 



0» 



•-» z •-» 






•H r« o 



Is 



(3 
•^ Z »? 



O 

1 

< 

1 

©So 

n8n 



ill 

^ ^ ja 



8 8 
III 



n ^ to -^ -^ go 00 
»^ o f^ »^ ^^ 9 ""^ 
Ot O Oi Oft Oi o> o> 



eo f-« o •-• i^ 

o g ^ "8 g 



CO 



^ 2 S ti s 



»o o ■-• 
02 S 



CO r« (O <4* <4* QO 00 

«H Q r^ ««4 t-4 9 "^ 

Oft A 9 Oft Oi O Oft 



^ p ^ «^ •© O 

W tH 1-1 



o ^ 



05z: S 




4i M B 

552s 




(O <o t* o o 

P} S A Oft 

00 00 00 00 



e« 09 M o r« CO 



c« o CO 90 r» r» 



~ aOOft9ftOkOftOftAOftOftOIOIOftOIOft9 



W CO 'I* CO CO •^ «^ 



f-l fH 00 (D 00 



I »4 v4 



r4 fH Oft to 






O'0r*<p<D00C4cie>icDr«o 

CftCftOftO»OQ«^'-**^»^»^»^ 
a0000000w9OftO»OftOft9O> 



CO <0 CO CO t^ to 
O Oft •-« '^ •-• Oft 

00 00 Oft Oft Oft 00 



CO CO ^ CO CO *^ vH 



f-l fH 00 CD 00 
CI 



CO CO 00 •-« »0 lO 







s§ 



h- CO C9 CO 
!>. kS ■»!• » 
«-< fr» tH 5 




I 



»l 



Ce< 



QQ 



;m rf o 

S J3 bi 



55 Q H 






CQ 









S 

« 8 S ^ 



Q ^- <^ .• fa £ ^ 'g 



43 'a ^ 



-<^5:woos^(S64^ 4 



*• %« 



^ 






0) « 



a o. Q, a a 



o. tx o. A u o. 



ddddddddddddCs«o4»a>a;o 

OQQQQQODCDCDaDaiCDaQCDQQi-lOOUOOOQ 



850 



Rbfobt of State Civil Sbbvicb Commibsioii 







H 

O 



H 
CO 

H 

g 

o 
u 

a 

CO 



a .». a 
• o « 



i 

5? 



2 

o 

H 

00 

2 



SS88SS 



S88SS8 
§§§§ 

as tf) lo 91 

M 09 M M d M 



SS88888 
§§§§§§§ 

CO CO CO CO CO CO M 



00 « ^ CO !«• CO 

1-^ a o •-< o •-« 

Ok w 9 Oi 0> Oi 



d d d a q 
as « 8 at «d S 



CO « t^ O g «D 
9 9 9 9 



d d e 
« « a « 8 « 



JS.e 



8 ^^ 
S |tf 

§ 22 



2 



CO 



a 
|l 



P 



I 









6 





a 

o 
H 

CO 

u 


.0 



M 

3 

O 

>< 


O 

.a 

< 



8 8 8^88 

llllll 

N- •- •n "^ »n •-» 



H 



!«• K) r* 00 CO <D 

«p4 fX Q *^ l-^ •^ 

9 9 A Ok 9 9 

Virt ^N f-t ««4 <p4 f-* 


»4 ,»• C4 fx v4 ««4 


^^^0 
•<S « 9 3 « <8 


r« K) r» 00 CO o 

I-* t-« o ^ »^ •-• 
9 9 9 9 9 9 

fm, ,^ f^ w^ 1^ m-t 


fX IX M v^ ^ «-^ 


^ Bsi »n »^ •-> •-» 



I:? 
99 



GO 



I 

o 

Pk 






a 

5 



0) 



J^l 




< 



. « • cS 

::2 2u 



S 

•c 






V 





S o 



S,fa 
!* — • 



"I 



tl 



GO 



8 



« 6 « 



o 



lai^ 




M 

O 




1^ CO CO K) CO (O Q 

S,X tX fX 1-4 ^ Q 

9 9 0» 9 O 9 

^4 ^4 jH fH «X (^ V4 

!«• CO CO lO CO CO Q 

S«X «-( fX «-( «>^ Q 

9 9 9 9 O 9 

Vi4 ^N vX IM ^4 ^4 v4 

8 •"* "" •"* -*" 8' S 

-^ ^ < ^ •-» ^ H 





d d 

CD CD OQ 




CuissiFrED Civil List — State Courts 



351 



8888S888 



8888888888888888888 S8 



cocococoooco^co 



<D <«i CO 



09 CO 






• • • ^H • • • • 

SSS|S8SS 



do 



00 
oo 



00 



55 



M 

d 



S II 3 1 S -5 ►^ 



o>; 



roo 
-< go 



,. .i O ai (i 3 ^ 






s 



tiiiiiii 
llllllll 



ooioa»aot^»eofO^^«Dooooooi^<D<p*^e9 eox) 



r^fi^»^^t-4»H»H»Hi-lCg«i^i-l«»i 



PH fH «^ ^4 ^ K) 



•A 4 






aoi090oi«eoeoi0^^ooooo»^(0<p^^ 

a&a>90i0i0i^0i0i9a&O0)0i9C>Q0Q09 



vHfHvH^*Ht^fi4rH«^eO«-4i^^«Ml^l^*Mpi4fi4 



-es 



ls|3||8|||||||||| 



:3S 



r» CO 

8S 








a a a 

« «> «) 

•o ts -0 

tq va (d 

d d 



352 



Report of State Civil Service Commission 



«3- 
•I 



O 



H 



Q 

O 

Q 
H 

0* 



d 
o 

•a 

i 

a 
5 



5.S 



°« I 

3 s ft 

a 



I 






I' 
S-8 



U 

a «M 

V o 



a 
o 



- '"^ 'i 

fi tf i; 



o 

H 

QQ 



S§SS 8SS88S88888S88888888S 



O 
g 
-«• N ^ -H 



CO 



o> 9 o cS 

*H »4 <>4 rM 

^ •-• K> lO 

u o S ^ 



8 



CI 



1-4 K) lO lO 






O 



^O 



JJH 



r .^: 



;5?; 



1 la 

CI w* 

8 -^ « 

o 

a 

H 

K 



V CO 



^ 8 



O 



PQ Q 



s 

3 c} a « 
8 •a «0 -^ 




8 

a 



H 



H 

6 



8 



O Ok 



eocicicieoeooeoeoci 



«30orixo«oo090toocp<pc4^oor«oDr*H^ 

f^ C« CO ■-• N 

>»• • •®* • • ••? ••t''^^* 

acdfl q«aaa0cadqkcSaa«« 

toeo^co «fi(pcoooio<D$«pcit^aoi>aoNm^ 
oooooioooociooaoo^oaDaoaoaOaiOwdAO 

l-if-^>O«-<Q»M<D»4'f-rf-f^C«00l<>C0'o«O»^»^0»* 

8S|S||S SS§§ SSS|SI S8|4 

1 1 sjlli II ssl 111 3««l|« 

(oepiOQcieoic<o<-40cocieoco>-i^^«Qioss; 

C^^'^Q»OviCC|iOQC4^^ciQ^lp9e!iejC0 

totoc4C4^<^f-4cdciOvH<Mr-icoc(ra«mW>ei« 




: « .a q 

ss ti 



a 

i 




? S >.^ 4 k ^ ? s i I 



.£ o ^ 



O V « 

S M ja 
ft ft 






Ipllllll^l 



Cx^ASSiFiED Civil List — State Courts 



353 



388 



S 



88S88S 
!§§§§ 



h> h> t^ h> !>• I« 



88888888888SSS 



«oieeococoiocoeo<ocoMcoo«e<« 



M ^4 Q 

» » o 

• « * 
S X >» 

» » S 

• * •• 

ill 



n* CQ 







CO t^ t^ lO CO iO 

»4 »4 ^4 *4 ^4 »4 

O O Oft O O Ck 



F* «-• « "^ »J «-• 



e^4^4^4QdrH«-4^S<-40^H 

90>0>09wO}0>Cl90>90ft 

r4rHr4^4^4^4rH«>4«>4^^p4rHrH 

eoi*V'*'*p4^ioiorf»4uJ«dflO 

8SSS8 SoSSSSSSSSSSSS 

^4^4»4«^«i4^4 l*4r4^4^4r4^4iMrHrH*<»4rH«-4*4 

• • _fc • » » ak 

■o lo g ^ lO rH 00 

tH «-< Cl ** 

^ V • • 



Pi ^ CO ^ Ok ^ 



^31 



S o 




5^S S J S"? 








8 S S 

*^ *^ 5 

9 9 9 




CO b* Pi <« t^ rH fX 



Mil 

1-9 ^ In Cm 



Hi 



• ■ 



I 



1:^ 



«n 



• 2 



1-4 Q e> « 
»o 55 -f rr 
•^ »^ eo O 



«* w 
•^ ^ 




w *^ ^ 

O g M 






6f^ 5 

o *p o 
'^ tJ ca ^ 



a I 



t a >. d i,^ 

s» S 5 '5 o o 
q © © 9 3 ra 




•3 








«• «• M 



r3 



§111 

g j9 « CO A 



a. 

2 

6 
o 



854 



Beport of State Civil Service CoionssiON 



Q 



O 
O 

o 



S 
g 



o 
o 



I 

to 



8 « 



'1 
I 



fl 

I 



OS? 

g-8 



I " 

|§l 

5 






88SS8 



M M M M M 



h> 4D t^ t^ t^ 

Vi4 O *4 »H ^^ 

Ob O O O Ob 

vM rH rH ^^ ^4 

^ at o ^ ^ 

ittss 

*4 tp t^ ^4 •>« 

*i« O •>< *4 Vi4 

Ob Ok Ob 0> 0> 

^4 V^ rH Vi4 ^^ 

111 9 1 





•a 

«> 

*§ fi 9 o o 



I 

S S H S (^ 



» 



o ^ ^ 



3 h fe 3 3 
1 1 T 8 1 



888888888 
§§§§§§§ 

oi ei e« M M e« e« 



SSSoSSSS 

SooSSobObSSS 




sdliS gg 






S m S eS t^ S 8 



I 



«s 








•K •!< 







8S888 



e« e« C9 C9 M 



i 



io <e C9 00 (0 

*^ O ^H V4 V4 

o 9 Ob o o 



|3S8| 

Z i-j i-> "^ 2 



III 



O v^ ^4 vM ^ 




I 

g 

o 

I 

I 



»^ < O PB *^ 



jiii 



CiASSiFiED CiYiL List — State Coubts 



355 



S88888888 S 



88888 88888888S88 8 
!§§§ §§§§§§§§§§§ I 



M e« M M 99 



•0 fO fO 



88SS0SSSS 
88S8S5SSS 



as 






I 



OQ 



III 



Q 








IIIIIJJ 

5 &&&5 




S 



i 



as 

I 

"I 



i 
I 



i 



flQ (O M CO 00 

»i^ •i* W^ »ii« ^ 

Ql 0> Ob O O 



ck90fta»fllaftOAofta» S 



00 e ^ ^ 00 
j ii 9 fl « 



CI 






1M 1.H I 00 






£2 






I 




"^ o ^ ^ <0 ^ 



I 

.a 



00 



Q ^ ^ «0 
CO «D »4 d CO 



3 J 2 c 5 

I -Si!! 



M 




As ^^ ^V ^^^ " J," ^, ^^ ■•■ ■■ ^3 ^v 



1I 



\ 



S-<9 



i 



^ S 8^ 8 

JIIJI 

ft "^ ** ft *n 

ft p s B 3 




. . ja 
^ ^ ft 

II 

. • a 
ill 

S g 8 g g 8 1 



{||ll 



3 73 *g •Q ^ 



g 

1 



I 



8 






>4 



1 
! 

a 



856 



Hepobt of State Civil Sebtiok Coiuciasioir 



I 



-If 

8^ 



s " 




I 



o 

H 



888S88 



«o <o b* 



Oft <-i CO 1^ «D 00 

<M *4 <M f-4 <M »N 

O A A 0> Ok 9 

*4 *4 *4 rH rH v4 

1^ 9-! 9-i ^ ^ aS 

assess 

•^ •^ "^ "^ "n "n 



oB S 60 



mil 



I 




. ^ <2 w 

!»• B O la •< K 



II 



A ^ ^ < 



iiiii 

- • • v ^ o 
(^ 0c| (2 K K {^ 



» 



888 



I* CO «* 

t-l t^ nM 

<» Ok o> 

^4 ^4 rH 

<o of ^ 

III 

1^ (M t^ 

>H ^4 v^ 

Ok Oft o> 

•H .M t-l 

<0 01 ^ 



0) 



I 



"a s - 

X > 
& 

•^ 1^ •-» 

2S5 



Si & 



9 o V 

III 

Add 

8 « o> 
•g "tJ "O 
«3 (d (d 

d d d 

666 



88 



•O CO 



•i^ 00 

i's 

li 

ri 00 



SS 



e 

II 



88S88 



8 



CO 



et e« ^ 



to 

Oft 


1^ 

Oft 

W4 


1013 
1016 


00 

9 

•>< 


^4 


m 


28 




■ 

1 


1 


Oct. 
Oct. 


• 




V4 




1013 
1016 


^4 


1 




SS 




1 


1 


Oct. 
Got. 





a 









5 J 1 a" -" 

III;:! 



•a l-i 






*S d > >t 



o 



tli. 



\ 



i 



Classified Civil List — State Cotjhts 



888 
§§§ 

• • • 

iO fO iM 



SS8S888 



M 1-4 ei M M f-i 



III 

•^4 ^4 rH 

^i iM «iM 

• • • 

Hi 

lii 

•^ »^ »^ 
O O <tf 

-• • • 



M lO lO lO lO « « 

^4 ^4 O O O vN f^ 

Ob O 9 w O O) O) 

^4 ^4 ^4 rH ^4 ^4 ^4 





• 

1 






• 


^4 


* 


.1905 
.1905 
.1905 


01 


s 



•H ^ Q O Q « 
« ^ « .-I 



< a 5 5 5 

S 4 ^ :z: ^ 



3^ 






t 



&8 






4 



JO 

4! 






e ^ a 



•^ »o '* 



*S ^iS cO O 'J* CO 



o 
o 

a 
g 

CO 



6 



111 



•?Bu 



O 

n 



9 

H 

8 

a 

& 

o 



"5 3 

o 

s 

> 



I 



« 






Ills" 




S. : 
£ ■ 



US 
Q. 



-^ J4 M M 

1 1 S S 

«0o ooo 






8 



»ti 



1^ 



i 

o» 



s 



^ p^ 



O 
CO 

o 



0) 



o 

CO 

jd 









88888 



C^ r^ 9^ ^^ f^ 



U) ^ «o t^ o 

Q -^ »^ »i^ iM 

O 0> Ob Ob Ok 

^< ^^ ^i ^N ^i 

•-• © rs «M rH 

>o ^ eo r« o> 
O '^ S v^ "^ 
9 0> 9 Ob Ob 

«H *i^ *i4 Vi4 ^4 
•^ © ^^ V4 ^4 

CI 



s 



^^3 3 — 



^ : -« I ^ 



2C H A 



e •§ c 2 2 

O 4 ri* ^ « 

^ >-» w <* -> 



a 

4) 



e 

4) 

e 

U 

«s 

c. 
o 



o 



•? 



c 5 
t i 



V if 

^ JC 

a a 

& Si 

o o 

a 

a S 

m m 

CO S 



^ ^ ^ 

k k b 

& «) o 







w 



858 



Beport of State Civil Sebvice Commission 



en 

o 

•< 

H 

Pi 
O 

H 
O 

O 

o 

i< 

H 

CO 

o 



^1 
^11 






§ ^ 

3 • a 



1' 



i 

2 



2: 

o 

H 

03 

2 



8 



8SS8SS8888S88S8 



SSSS88SSS8S8SSS 



& 






S 









ii*^dSOcDis>nisiscDaDisaSwaD 




5*«|^lll||l 



I 



• s 

0k Q £ 



Pli Pli flu Pu 



9 hi ^ k h (■ 

Jii|i| 



O 
i 



Classified Civil List — Normal Schools 



359 



888888S888S888S88888888 88 888888888 
SSSSSSSSSSSSSSSSSSSSSSS SS SSfiSSSSSS 



o« M e« m M 



01 



o^ioeQoaMiOaot^o 



iO GO «0 iC 00 00 

•M (M Vi4 HM *4 *4 

Oi 9 9 9 9 0) 



« O 00 

•^ rH v^ 

9 9 9 



00 •M 

9 9 



00 t^ e« 

m^ r^ r^ 
9 9 9 



ei o 00 00 <o 

1-4 Vi4 ^4 ^4 *^ 

9 9 9 9 9 



04 



«» 4* ••«•<«* 



>»-$;>> 



oS « 6 •-> n n 6 n *? n •-» O n n O ^ (2 O (S n n n oB OO 2 O x oo O oq oB n od 



e^iO MMiCOOI^OCQiQOOtOiCOOOO *^Q0(0O00 
999*^9999990099999900^9999 

*4<iM^«9^4«^^^*4^^«^^^'^<^«^<^«4>^9'^«^rHrH<M 

.•.<^ •••..........•-« ..... 

*4 M ^ »^ 

• • ^** * * ** ^^ * • • • • • 

n»Oi->£i»0(n*-9ao>nOQB<IBO'<c20cSc£<2J$QB 



00 ^ 
9 •-• 



00 r« M 

^^ r^ wmt 

9 9 9 



C9 O 00 00 «D 

•^ Vi4 Vi4 Vi4 *i4 

9 9 9 9 9 



*4 eoiMt-i»««ciMoi*i4<M 



«« «* ST 



1^ lllllllll 







^ 1^ M IQ ^ ^ 



i 

2 > 3 ^ 3 



>t 



CI eo ei 



^9< 




t 

Q 

a 

§ 

s: 



i -i 



o 




2 

S 






M •• M 

jjj 

«M (M (M 



a 



III 



IN 

s g I 



a a a 



^«» ^^ ^^ 

III 



iiii 

nmm 



Ik b b b Ik 

S||SS 



u o 



lllll 



11 



Ik h b 



^ %* 



llllllll 
gggggggg 

aaaaaaaa 



860 



Repoet op State Civil Seevice Commission 






o 

IS 

g 

O 
O 

o 

H 



I 
I 

<3 



e 



s_^ 



\ 



g-8 



111 



I 



O 



•I 



I 
8 



00 



is 



S88SSSSSSSSSSSSSSSSSSSS88 



6S5tfcS5aBo>?«D«««S«d5w(»aBoo4i»oQ(ISa 






I 



r^oeoeoooetDoi^oooeoeaoco 



CM -^ II 



•M «« to o 



4 4 



UUUilllUlVuliUum 





a 



J 

5 



Z(S£S$ 






i 



= :§ 



i'E 



I 



I 






9 

s 



il 

I 



s 






-% 






H 







9 



•*^ ■** 4J 

III 
III 



mill 





9 9 



I 



(4 hi 

' 2 



II 



a *^ s ■*» ■•» 



^ 2 § 



hi (4 iU ~ 

o o o o 



|222 



s J J J J J Ji JJ 33 



tttttttttt 



2 2 



CuLssiFiED Civil List — Nobi^al Schoolb 



861 



8 

S 

1^ 



88SS88S 
|$§§§§§ 



8 



8S8S8S888 

88 






888 

»• t^ t^ 






S 



00 ^H o OO t« 00 oo 

rH a vN vi^ o vN f-4 

flft w Ok O O* Ok Ok 

lO ^ ^ t» t* t^ ^ 






llll.:? 



0k0k0kCkOOv«0)0k 



(BdodDdDootnaoaS 



^1 



00 •^ <0 00 ^ 00 00 

v4 a •H <-4 o ^4 <-< 

Ok 00 Ok O «• CI Ok 

to mi wS tm t* tm vi 

ham 







8 



Of-i<0^iOQOt«Ot^ 
OkOkCkOkOkwOOkO 



dDndDnQDaidDCD'^ 











if 1 1 




- i -2: -a 5 a 

2*^ '^•3 d9 



jIj^Ii 





•E 






81 « o V a> « « 

fi H h H H H t< ti t< 



862 



RspoBT OF Statb Civil. Service Coumission 




8' 




i 



o 



88SS8S888888888S88 



o o o o 9 

vN ^ ^ $ lO 

p4 ^4 fiN O ^ 






8 ^ 









>l 

3 



«>' «i 









M 



9 










s^ 






(nisdQCDi&P'4(u(u2>n(na2aQdQi->aQ»^ oB qq 




s 









^^||g5«S 



o o o 



IU% 







U V U O O U O Q U C U C O O O Q Q Q 



& S; t S & § 



a 
1 



«> 

» 



& 


s 





§ 


« 


j3 


7 


a 


H 


^ 



1 

s 

i 

hi 

I 



e 

i 

e 
c 



Classified Civil List — Nobmal Schools 



303 



8 



88SS8S8S8SSSSS8S8SS88S8 
















c « 



11111111111111 

i ^ ^ {S ^ ^ ^ (£ ^ f2 f H H H 




wvv^v 



BxpoKT OF State Civil Service Coiocisflioif 





8 *. 



1^^ 



I 






o 

o 

8 

01 



9 

2 



o 



2 

o 



00 

O 

04 



88S8888S8888SSS8888 
§§§§§§^§§§§§§§11111 



»^oeao<oaoao«oaoio»«>t^i<»t^t«>t^t^i^t^ao 

iilflifliiimiiiil 



00 ^ eo 

•H CI 



ioiiiiiittttttiiti 



I 



o 

CO 






O ' 

•a • 

. ^ w 

i< J 

. © CO 

* **4 "^ 
H « n 

§^^ 

w »^ ro 



o 

n 



> 

1 

a 
^ o 

21 



o 



^ o 



A 



II 

IB IC3 

A A 

i t 
<< 



^111 

^ A^2: 

• S * 

1^ N -^ 





O 



^ 

h 



|i 






§3s-s 



III 



I 



b & ^ & b & t 
M M jq Ji M ja je 

HHHHHHHHHH 



us 






^ & t £; 

X! jc .c .a 

c c c o 

s s s t 

H H H H 



o 



q O _ 

0) o 3 « 

H H H H 



o 

X 

o 



0) 



8 

s 



•4 



o 



lO 



>• 

o 



1 

•Q 

a 

•E 

O 



s 



s 



s 



J 




3 : ^ 













Classified Civil List — Normal Schools 



366 



8888888888888S8888888 



8 

® - . - 

V M N N 






a 
t 'i fi "S "S "2 "S 

6m 66 6 6 







366 



Report of State Civil Service Commission 



o 
o 

i 

o 

CO 



O 



1 

a 
6 



a 
o o 



! 



si 
<3|i 



a 



o 



g'8 



S 



S-3 8 



1 



J - 



2 

O 



88888888S 
S88S8838 



8 



iiiilliii 



o 



QQ 



I. 






t 

6 

m 

< 

«i3 




I 



d s & • 

_ X US ^ ja 
V e V u o 

1 1 ti t 

b^ b- b* b* b* b* b* b* k^ 




8 



M 



8 



CO 

1*4 




f-T 


sf 


< 


1 


(0 


f^ 


rH 




1 


1 



1 

a 



a 

I 

9 
CO 




1 



Classified Civil List — Nobmal Schools 

S88888888888888888888888S88888S 
f^8SSS888888888SS88i8888888S||8§ 



§ 



367 

SS 



9S2oo85Sa»0a»S999aoo»ok9Oioaka>a>a»9o»9a»o»a»oiekoo 



§ is 



as 




r r r r '^' '"' r '^ -^ -^ '^ ^' i 






OQ 



o ^ 
aS < 

82 

o ^ 

1 ^ 





I 

I 



Jl 



868 



Rbpobt of State Civii. Sebvioe CoicHnNSioir 



1 

s. 





o 

H 



H 
O 

o 

o 

u 



o 




s 
2; 



2 

o 

b 

00 

S 



88888888888 
§§§§g8llll§ 



^ M M M 



O 0* A Oft 9 9 9 Ok 9 9 Ck 

(sooraOoSiSisi&tti-**^ 



0909999999 



QQaoaoOaoaiaQQon^*^ 







I 



H H 



2 35 8 8 8 8 2^ 



CuussiFizD Civil. List — Kobuai. Schools 



369 



88888888388888S8SSSSSS8SSSS 



§§S§§il§§S§§s§§ 



o» s s 



00 



s 



8 



eoi<»«t^i<«co(Ooeoo 



o>ea»t«>et«ooaoooooxoo«aO(or«r« 



fOt^e«^r^coooo«<o«>eaoh>>oh>xaoooao»ooxx«r«r« 








II •€ •§ •§ I -S -g •€ -6 •€ •§ -S 



h h ». hi u 

O A) 4; V 

,£3 X .a .a js 

(i/ O O P o 

s s s s s 



"8 

O 

CO 



9 

■< 






3 



I 



a 

H 

K 

H 



» 

c 

s 



1 

'S 

•§ 

a 

S 

t 



370 



Repobt of State Civii, Service Coumission 



g 






g 

■a 
i 

I 



5-S 

III 
<sli 



a 



Is 



8 ^ 



8 



2 

o 



2 



8888888888888888 
S88S88888S8S888SS 

ro«e>«"e>«*e>«iH«-««-<t-«iHfi«»-«*H«J«-« 
qeqeaeoe4<p<oooaOiHaor^acoM 





■0 




.siJuiilsiiiJ 



1 




a«HHH 



ijiiili 




Classified Civil List — Normal Schools 



371 



8888888888 

ii§i§§§§i§ 



8 



8 
8 



8 



888S 

• » • • 
^ M M M 



<OMcoaor«ooao«Diooo 
«DC9eooot^oooo<ow»ao 

• • • • • • 
















-a 



5 



M 

H 



^ 



iiijjgi>gis I 



a 



8 



^ 

a 
•< 









00 M» lO M» 

00 00 SB o) 

Pi4 *M Pi4 li^ 

-" I 2-^ 

i I ^i 



OC M) lO M» 

00 85 85 o 

W^ ,^ ,^ f-i 

•" I 2-^ 




ssiss 






a Q a a 



l| 

illiiilf 

0000000 5 







-, "J ™ > Bi « a 




I 




872 



Repobt or Stats Ctvu. Skbvice Comuission 



I 

z 

I 

i 

O 

g 

o 

o 
o 



3 

o 



I-- 

111 



III 



•SSI 



I 
3 



-& 



i 



2 

o 

H 



88888888SS8SSS8SS88888888 88 
8S8888S888S§888SSS8SSgS8SSS 

g „- „- „• ^- „• „- _r -• - «- -- - -- - -; - «- - - - «- - u ^- - -• 



• ••_•«••••••"••••■••• " " * ^» • • 

lllillllillllllillllllilill 



o5 



CO OQ 

IS 



s 

a 

2 

8 



<§lo(§Soo32 




S$88>S^ 







S 



^ g c -c ^ 






fi o ffi - 1 »? ^- ^ 




I 



s g^ 



oj 



illjljllllljlllljililljllll 



s s s i S H S S S S 8 8 f i ,8 I 



h ». hi W »« M 

V « O 4) V 

.13 X ^ ^ .a ^ 

(» O O O V 




Classified Civil List — Normal Schools 



373 



888S8888 
8SSiSS8i 

«^oooooocS 



8 



8S 



S§§SS 

ss 



CO M M M 




• • • • • • J 



9 9 at 



M r^ 00 00 00 

Oft Oft Oft o o 



• • • • • • i 



I 

a 
O 




a 

I 



? 






» 



illJ 




•sllll-g-s-s 
ttiiiitt 

hhHH HHHH 



§ 


Oft a 


• 


SS 


s 


Feb. 
Feb. 




1905 
1912 


wi 


-^'8 


1 


1^ 



^ C4 Q <0 
«H Q O «^ 
Oft O O Oft 



. «I 4i «i «> 

•g Q, a Q. a 
O 00 qS n (S 



•^ M o «o jj 

Oft Oft A Oft Oft 



I 



. • • ■ 

a A a a 
o8q8o8q8 



Odd 



; o 



a 



J 



9 
00 



M 



W2 




O 



2.00* 

1|i|iir 



I 






ha 

1 

3 



•n ^ XL M ^ 

"in 



%. % 



•§.2 



*.fc»t< v*^ 



37+ 



Repobt of State Civii. Sbbviob Cohmissioh 



1 
I 







g " 



I - 
111 

III 

r-i 



2 

o 

h 

s 



%%SS88S8S888888SS88888S8S8 

§§ll§§§ll§§$§§§§gggg§§!§i 



-- -- „• - |- -• -- _: -- - -- -- ^- g- - ^- „- |- „• ^- «- -- ^- -- - -• 

■gill I iksiiili^^n I llilllii 

nil I llllllllllll I SiiUm 








I 








^ mt 






l« U h t4 

S tt « V 

~ js a: M 

c o c 



1 






I. b i> b h 

t> Oi C &> V 

U3 X X .cs u: ^ 

c Ci' u c; o o 



J 
S 






C 

ee 






H H H H 







Classified Civil List — Nobmal Schools 



375 



8 S 



8 






00 

a* 



oo 

9 



i I 



t 






S 






888888S8SS8S8SS8888 
SS888888888S8SSSSSI 

2«OOaeOfOiO«D<DCOOQOeO«t^OQO^O<D 
aiooao9aka)ooftai990>wak9Qfefiook 

«- «- -• |- - -- J «- rf «• «• „- «• «- „- „- «- 1- „• 

|- «- ^- |- „- «- „• u rf „• „• J J -- -- J „• ,- ^- 






I Is 



III 






■8 



t 



5 B 3 



a 



§ 



g 

ft 



e 
I 



I 






? 






S QQ »i4 E 



I 

e 

» 




laliliii 



I 

01 



J 



I 



I I 



..nil 



||JI 




%*^ 



376 



Rbpobt of State Civil Ssbvioe CoiocisaiON 



o 






O 

o 



o 



1 





i - 

Jo 8 



55 
O 

OQ 

2 



M 
H 
00 

o 
■ 






88SSS8 



8S 
« 1^ 



le M oe oe lo t« 

•H A p4 v4 *^ f4 

Oft w Oft 01 Oft o 

*H I li^ fH «H f-« 

Cm so OQ 00 00 ^ 

•o 9 r* 00 lO r* 

*4 9 O *^ "^ *^ 

Oft Ov Oft O) o> o 

«"il C ri ^ w^ wS 

£ S^ OD oS (^ 




I I ^ I J 




nn 

. < i f s 




Oft Oft 






Oft Oft 



"2 & 



^ 



a 

• mm 

K 

o 



88 

11 










(1[$ 



CuLBsiFiED Civil, List — Nokmal Schools 377 



IE!l!H!!!!!!!!?!!!»?!i!?!!!HI!!! 



iiiiiiiiiiliiiiiliiiiiiiiiiiiiiiiii 

,- -■ „- _- ,- J _■ _■ _■ „■ „■ „- „- o »- to" - -" -' -" « -' -" -' -' - a -" - — «- -- iif - «* 

I tli I iiiiiiiiijiiliiiiiiliiiiiii^ll 

iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii 

I til I iiitiiitijiiiiiiiiiiiiiiiiiiil 



jliijiiliiiiijiliii 



iiiiijij 






WW 
1i illisi 



378 



Hbpobt of State Civil Sebvick Coumission 



J 
I 

I 





i - 



I 

s 



5 



•9 Ok 



o 

H 

OQ 

s 



S888SS88S8888 



8 



8 



QOt^OOOOaOCOQOOOQOQOQOOOOO 



'«»^^«»^'«»«'«* 



OOt^OOQOOOQOaOQOQOQOQOQOOO 






2 






z 



i 








4) «# «> 

je M ^ 

o o o 



« «» « O 4« 4) 

X JS ^ X X ^ 

C> O O O V O 



CiAssiFiED Civil. List — State Hospitaxs 



879 



8 

•a 

i 

8, 



a 



H 



a 



I 



•S-9-C 

|ii 






1 



o 

GQ 



8SSS&SSSSS 

§§§§i§p.§§ 

glllllllll 

s a - a - -■ s • s -■ 

aqaqqdaaaa 

a as saa $s$s $ 

\ flllllirr 

«• • ^ *4 *tf *& *5 *4 *fi *4 *fi *S *4 

oS5^£^8(3s»^ (^aaaasaaaaa 

5^<0M ««*t^c« paDaQaQaQaQQQaQQQQOOD 




8 j^S 




8 8 



N^ 



-3 



a 
J 






i3 



I 



8 « w 



o 



OQ 

- 1 



|l,5^§J 



"2 

8 

ca 




i 



380 



Report of State Civil Sebyice Commission 




o 

S 

< 

o 

n 





52: 
o 

H 

OQ 

2 



S888SSSSSSS88SS 88888888888 






M 00 00 

v4 «^ •-« 

Ok o» O) 



« » lO r« 00 00 30 

V^ P^ *M P^ M *4 ** 

O) O O 9 9 O 9 



«iii4r^«iii4*Mie«^«-4f^|i4 



828'^-^'' 



*>«<DCQvi4ii4^4*^iO«N«4 






2^S 

9 9 



1 3^ 



^ >» 



d a 



O C 2 •-> ^ "n X 



Ot 9 Oi 9 Oi O O O Ot 






00 lO 



00 00 CO M 



e M 



o»a»ooa»a»o)a>o92 



CI S S 



^ U) ^ <D «^ »^ 



ass--*- S2«'---6S8"'2 






^1 



|«- 



OO 






I 




pQ pQ pQ n ^ 

'« -a 'S 'S 
ix] (c di iX! 

COaQQQGOQQaDKcO 



333 

III 

txi tc 31 




2 S 5 ^ S ^ 

'^ -^ OD h- — 



33* 
It" 

55^ 
550 

CC GQ 0» 



(9 

133^1^3 

illiiii 

5 s ssssi 

QC 00 oqS xoox 



■ 

i 

5 



I 

I 

PQ 











jS>:0 IBS' 







44 

5 

GQ GQ 



d 

S. 



ft! c 

h ^ «i 



c -^ 



^ S § S S 

-, .d .2 .£3 J3 J3 

Pi A Pa A fit Pi 



-I 



iliiiiiii I 



S S ^ S 

* S S 9 



Ja a p g 
5 5 5 5 



^555 

CO QQ CO GO 



CO 



{Too 

^ b b 

Vj CO 00 O O 



JO ja 
c pb 




g e 

llll 



Cjlassifi£d Civil List — State Hospitals 



381 



88888 



8888888888888S388 



CO 

o 



(O 00 00 r^ r« 

^4 r^ *H *H ^4 

9 01 o> o o 

tM Pi4 1^4 1^4 Pi4 

10 O lO (O 1-? 

(X 114 <>4 iH 






-I 



to 00 00 l*» t^ 

*4 •-« fM ^4 v4 

01 01 O) O) O) 

^4 *4 (iH ^4 <.« 

• * • * ■ 

to O lO Cp «4 

•i4 *^ ^4 «■< 




;! is .S 5 J 




g 3 y'S c, 



Si? S-g 3 

ll«|2 



a 

M 

s 




<5 flu ^ fa 

l^llil 

X < OH SS 







.s .a J .2 .9 

11111 1 

ssiss 



0) 

? 

a 
«s 

6 



« O CI CI » ^ 

v4 di t^ vH iH O 

o « Oft Oft o) 5 


00 lo CO 00 r^ to 

rH ^4 ,>4 ^4 *i4 a 
O O) O) Ok O 00 


N C4 lo 00 r^ 

Q •H »H ».« .-< 

8 o» Ok a» o) 

•^ 1^ ,i4 ^ ^ 


»^ge«-"^«-»«Ot^io«ood»J"t4" 

itiiiliiiifi 


Oct. 1, 
Not. 4. 
Feb. 8, 
Jan. 1, 
Aug. 16, 


S 8 ^ 3 S o 

00 oD Ok 8 O) S 


00 to C4 00 (O lO 

^4 <>4 ^4 *H ^4 ci 
O 0> 0» O) Ok S 


o »- 5 00 ■* 
8 2 9 o) a» 












• • • Ml • • • 

• **^ • • • 

||I|W 

55 5 :5 S 5 
5 5 J e 4 5 j 



e 




0?55 



S pQfQ (3 S Is 




Rbpobt of State Civil Servioe'Cokiiission 



a 

if 

8 

T 

o 

< 

H 

O 
O 



1 1 1 



51 



fl «• 



s 



Hi 

g-8 



i - 

g-s 8 

^ t) a 



z 
o 



888S88888 



S88 






I? 



t* W <* lO 

•-• •- W •M 



lO ^ M ^ w» 



00 00 w 

v4 ^4 ^H 

o o> Ot 
^^ *^ *M 

^ rJ li^ 



*-ioOeor«<«<ooa^r^ 



»-• c» ^ w 



o 

2: 



§•1 



« 00 r^ 
v^ v^ »M 

o o a» 

»^ ^H »M 

•M tC « 



P*^ ^4 *^ 






o 



► 

o 



§3 




sit 

S S iC 

S is 5 
5 55 

I Oj 00 cu 

V 2 S 3 

n n PQ 



x S >» ^ '§ '. 'set) 



K 
O 

2; 



B 







S g • . 
^ ^ SI 

e q -5 S 



I 



Ilia 
ss<S 



CO 




i 

i 

< 



00 










Classified Civil List — State Hospitals 



383 



8888888888S88SS8S8S888SS88S8S8S88S 

ii§§§§§§§§§§§§gsiiiiiiiiii§§i§iig§ 



t%t%t%t%t%c%t%*'^^w*e*w^w^w* 






i 






M 00 iO ^ ^ 



•-• le M .-• I* « 



s-^s 



1^ « ^ CO 



eook<o^co<^to<^>^<^«o^^<«'0 



C4 



^ «-i ei »^ « ^ 



iiiiiliii^iiliiliiililizMiialilii 



^ 



5:§l| 



Q O O 



^ O Jg 



e ^ 



lllllllll 



"§?^? 



1 

0) 



33^3 




s s s s 



• • • m • • •> • <• 

lllllllll 

SSooaQSooQDnM 



3335i 

1115 i 

tzj CD K j E 
5 5 5®^ 

00 00 (C M <« 



J • ^ 

(B ^ IB 
« * « 

3S3 

••• ^^ •■■ 



t 



I 



la* 

m oi >« 






o 

I 

9 

too i 

5W 



I 



J 




•a "a •* flu ^ "a 



i§iiS8§sg|| 



P o 






^ a a a ft a 

M 40 4* <«• <«• 




384 



Hefobt ov State Cim. Ss&vics Coumission 



I 

I 

CO 

O 

m 

H 
H 

CO 

O 

i 

n 





8-6 8 

.3 - 



2; 



o 

H 



8 



I 

I* 



OQ 

i 

i 

p 



e 
>» 

I 

hi 
O 



I 



1^5 



SI 

5z;S 



►J 
z 

i 

L 



J! -a 

.2 11 



I 

GQ 



•g 



o 



.A4 

I g O : *g 



1 



8 

a 



6 



88888S8S8SS 

§l§M.M.M.P. 






3 



a s a" sC « s t; "' fc a s -" 



A o. o. o. a 

• «« •*« •■« •«« •*« 
v« «« M vM m^ 

« • « « ■ 

^4 ^N ^4 ^^ ^^ 




I^lfill 



3 3 3" 3' 3' ? 3" 3 3 1 5 1 

iminiiiiii 

K s n s » £ » » & ff ic s 

acooaoaoaoKSnoDaocx 



a 

o 

S 






K 

la 



a a a a G c q 

•i •§ I •§ •§ 1 1 



>t >» >i >» 

Oi A Qi CU 




.M ••• -e 'S 

f) « ■ f 

5^ >» >» 






>.i 



•^ -o 2 J.- ^ 



. h k« k 

o 5 o o 

a e g 

Ob oS (C 



Mil! 

nil* 



CuiBuiFif^D Civil List — State IIoapitaxs 



385 



S88888888888SS88SSSS8888S888SS8888S8 

3S§i§§§§§§S9S8S8SSi^^§^^^'ig8^S2§ii|| 

Sioc««3«aBraS)oS5'Ht^eioe$oooa)Oftaot«>t«f«StOM5^O0ie^ocoo 









^4 *H O *^ *^ *H *i« 












fl 



2<<ssc%:s 


















a a 
3=S 



II 

33 ^ 

8 f <3 



c. 

3 






s 



o 



a 



e 
c 



^5 5 Sif 5 3 






s 



0.3 

^ -. g 

ill 

A O uS 



a 



is 

C 
a 

O 



-3 



■§|l 
Is I 



■=3 
I? 

3s a 
"II 

5 « 



8 

hi 

GO 

< 






OQ Qi 



Si 

S2cS2 

38 






,0. 






IfilllllNII 



12 

"3 3' -I 

•0^333 

QQ CO '4; •< n 







J « a 






c 
a 



^ .3 -< QQ ^ W 



l§^^^ 



I Hi 



IlisiiMliHolililill^liil 





e 

g 

u 



c 

3 o. A a o. ObCL 



.5 a a a a a 
8 5 1 1 5 I 

00 QD W iO 00 QQ 



a a Q, a -M 



fl fl e e 
n a £ S 




<< 



886 



Eefo&t of State Civil Service Commission 



a 

o 







! 



I 

< 
H 

o 
n 

CO 



g-B 




H 

8 



2 

O 



88888 



So 



SSo 



88888888888SSS 



fOM>^*^M^N^N^N 



O ^ OC Q OO 
•M t^ ti^ o »^ 

e» e» e» e» e» 

*H v4 *N ^i^ *H 

• » » » * 
«i« ^4 ^14 Ok ^4 



M 



ao^ooe»^ap(Oaor.aor«ioo« 
c»e»oao»ako»e»aae»oft09oa> 



•^ O •^ •< "n •» •? < O »? »n -< •? Q Q •? 4 2 •?« 



e» 5 * Ok 9 
'^ ^ t^ cS o 



a 



c 

5 



c 
> 

c 



I J3 



^ 



til 
9 Oi )> J »^ 



5 III 








o fl 1 1 "S 





M 



"3 



aoko»aao»okOfto»o»a»Q090k 



« «0 O 00 lA 



to O w lA ^ ^ 
•-• »H .-• ^ ^ 



^ It «-i CO O ^ M 



4ZO-<4b.-<QOOSS 



1^ 




u 

11 

> 

w 

H 
11 

li 

9 
C 

U 

t 



Z 



CuissiFiED Civil List — State Hospitals 



887 



S8888SS88SS8S88888S88S 



c? et M ^ tM ^ 



^ e* ^ 




^•8 B^ I E C 



o 
o 












iljiiiiljiiliaiiliili 






« 00 !>• 

t-« j~ .-< 

O g^ o 



00 ^ io i« e» •-• 



CO *o ^ « ^ <«• <^ 






i ^-i 1. 8 H s 3 s i § ti ^i il tj 5 ii 



-3|| 
■fill 

tC EC Sz] Si] 

ssss 

so 00 00 QCl 



3333 

•*4 ••■ •m^ •#« 

s tzs H m 









J 




llilllil l! Ilj 







888 



Bbpost op Statb Civil, Sxbvice Coiuussion 



i 
I 

a 





III 

81 



5 8 

• o 12 

III 

g-8 



I - 

« a 

«9 



I 



S88888SSS8 



8 



i 



2 

O 



|§S§§|I 



«0 O Q 

r^ r^ <« 

00 00 O 



aooco<Dcic;^iOeo«4 



«H ^4 ^ ^ 

ah 



« a «H 



•^aS 



_• 



CD o sc H» oB 



90OeQ<DM<Na0acq«4 

iiiiiiiai 









d 



•S a 

II 



CI.ABSIFIED Civil, List — Stati Kobfitals 



S8SSSS88SSS3SS8SSS88 8888888888888 

Sii§§illiill§liSi^S§ §§§li3iiiil3i 



esiaaiaaaaaaicicinciaaiSSSS 

_• :■ :■ :• :■ ;■ 7 :• j ;- :■ j- :■ j- _■ 5 :■ :• ;• :■ 
UimiiiiUiiiiiUi 


iiliiiiiiiiis 

ahihimii 


iiiiiiiiiiliiiiiiiii 


iiiiiiiiliiii 


B- i s -■ -■ • 1 i s " s s a a -• s - § - a 

mmsummiiiii 


immmm 



1111 



I iliiiiiff '■ 



III 

1 1 5 

iJgJfS SB" 888 8 8" 8 ■S^-aSSSSBttljs 

I £ s s s y sassaasa tSxs s s a s s s zts 



fill iiiimi 



4 3'33"3|335'^ " 
;1>lll|IIIJi 



nil. 




jlilill 



111 



sei 



390 



Bkpobt of State Civil Sebvice Commissioit 



s i 

all 

s ! 



I 



I 
I 

00 




O 

o 



O 

m 



o 

CO 

g 

u 



I 



X 



X 

o 



S8888888S8 



8 00 <D d 



1^ Ot QD OO OB 



Ok A S w 9 00 



>o r« 



^ M tM Ok I-' 



g-^^^ 



>» >» 



•^ «-» •^ O 



^<^ 









11 



s s 



00 



ss 



« 



s:: 



O M 1-4 












9 

< 




•m 

iS 



1 

s 

I 



s ^ 

fe J 5 o 



e 



c 

a 



t -S 1 S -S S -3 -I -a 



O 



8888 
§§§§ 



(0 1^ r« 30 

v« v« W4 aii* 

O 9 Ok Ott 

•i* ^i^ »< -4 

* » » • 

t^ ^4 ^14 1^ 

*< •? O •iS 

CO t^ t. 30 

vM ■•« w« w« 

9 9 9 9 

f^ m-* rm ^m 

t* r^ r^ t» 






« 4) « 1> 

S V • s 

Jtf J4 ^ J4 

US .a U3 j: 

o o o : 

Ai 9u a< a. 

• • * • 

3 3 ^ S '^ 

• ^ ••• •** "^ 

c a a Q 

O ^ 

> 

g 



i5 



a a a 

S S S 

S X X 

« « 3; 

•*3 «« «J 

SS 5 

00 0(0 v: 



* 

w J, »• 

•5 5 2 

c > ? 3 

0^ o 18 : 



.C 



O 4) 

fi c 

•J 3 

a c 



S 
.9 






4> 

C 
u 

a 

1 
1 



:3 

S 
CO 

O 

H 
CO 






8 ^ 

M 

OQ S 








X 



o 






CiJissiFiED Civil List — State Hospxtauh 



391 



SSS8888S88888888888S8SS88888SS888S 

§§§i§§§§§§§§§§§§§§§§§§i§§i§§§§§§§i 



CO n M M M M 






e»oa»e»a»o»9e»e»oe»c»c»o 



— '-«a»t-«*o»-rt-»io^irfiH^ioVrf»^ 



CI 

s 



o99o»aa9aa99ao9Ae»o»e»a»c»e»oDako»90)C»oo)oo»9c»e»9e»9 



«j «> M 



na 



..missfjiiiiiiiiiiiiiiiiiiiiiii 



C0<-<*^-<0*?'? 



a 

9 





lljiill 

00 < (C > •< OQ (C 



a a d 

OQ (C OQ 



893 



BspoBT OF State Civil Sehvioe Coiciciwion 



1 
8 



I 

GO 
O 

m 



a 

in 



III 

g-8 



§ - 
^ s I 



I 



•f 



i 

2 



z 

o 



SSSSS8888SS88888888 



AO»8»oioBoic^Sa»ai8S8cBCB9A 







(3 



fc« h k 

« V & 

'O ja M 



8 

« 

C 
C 



•a 

_ _ -tf ^ fl X 

lili='§|-si|s| 



6. 



el 



* «9 



C 

c 

6> 



I s s 

o o o 



1 



w _ 



i s a s 



J--. - = ==•. 



S $ 




S 

o 

i 
3 

I 



Ci<AssiFisD Civil List — State Hospitals 



893 



8888S88S8S888SS8SSS888S8 
SSSSS2S8^SS^^iii§S88S 



Mc««9«>»Mc«e«e«Me« 









fff ^ «>H iM rH 



!Ja- 






jiitiiiiiiiiiiiiiiiiiitt 




lilliiUU 






894 



Eepobt of State Civil Service Commission 



I 

i 

O 

n 



a 
o 
'S 

a 

& 
8 



5 § 

iSll 
11 



ill 

<S|| 




1 

2 



2 

O 

CO 

S 



S8888S88888888SSS88888S8S8SS 



§§ii§i§ii§§§§§|giii§lsli 



CC 






^•^i^^N^Nt^eo^^eovHio^^co 



CO v4 lO ^4 CO fi 

r^ ^4 ^4 M 



o6..^.^«g2-.««--£«" 



qpo«<pao«e«aOf-i^coeo<-iiDao^<o<-ot»<eao^ooacaoaCN^ 
9SSSoSo»95Soo»o»e»c»oka»c»a»ooaaooo99Q 



^^^«-^«^«g«g2§oo.--r2»og2-«g--£ 



-* r; « w - 



& 



mmmmmii 






Si-^ 



e e ^« 




a 






55 i -^ .,• -? - ? — • • 






1 



^ 



^i!§ 






~ d 



4r T«i 



a 



ft • 

S3: 







li> 



•^ 
1 



8 



a S § J 5 8 X 

o 



e 






•^•jS 



• S3 a 
9 O « 

iilillliest&aj 



s s 





J 



SSslllllllllll^l 



Classified Civil List — State Hospitals 



395 



8888S8SS88888SSSSS88 8888 8888 



O M OO lO CO 00 

^4 *i« vN viS o o 
Ok 9 A O O Ob 






ov<4^^<-4t«^aoiO<-'*HtM^t>.^io>ci^O|9 ^tM^ 



!llll|8|lll 



33 9 
•n •-» H> 



llligs 



I 









00 



1« 



eo^a«oooo>or«o^ 
o»8ako»ooaa90»o 



(0 00 

5» S 



r« 1^ 00 00 

r^ ^^ w^ w^ 

o e» 9 a 

•is ^N tM »^ 

• • • " 

1-4 «0 00 -4 



O l» 00 00 

«M v« *i^ vH 

9 9 9 O 



O ^ I 



<r lO 00 <-« 00 «o 



« ^ f-i 1^ ^ 



8«o ^ 



sassa 



o <-• <0 '^ 
M CO 



«-i »o 00 "^ 






o :^ 







CO 



o^^dci^cdudo 







r • « » • • • • • 

?2:S5«"5522ZS5 







sill's 



i 



^ 



• ^ JB r; " * 

« 9 1 " ^ -i 












» -■ a a 2 V 



9 


t 

o 



e 




llllllll 



as 






«? 

O 

a: 






OQ 



8S 

566 



llli 



3»ti 



RcpoKT OF Stats Civu. Sebvice Coioussion 



i 

(0 

O 

i 

CO 



^ 

< 



s 

i 

J 



s 






a 



a 
S 

e 




8 



V o 



a 









5S 

o 

2 



SSSS8SBiS8SSS588S8 

oooDff«9eoeii$n»*29«>fDO«ooo 



« 


to 


C4 


«f 


e 


00 


■0 ^ M 


o» 


00 


W4 


v4 


o - 


«» «3 


•• 


^N 


•■t 


^M 


m^ 


*.« 


«^ 


o § o 

^i^ r^ ^4 


^< 


^■4 


*.« 


^rt 


§8 


w* 9m 


r^ 










a* 






o» 


'^4 


f4 


0» 


CO 


• 
to 


• 




» 

o 


• 

f4 




* 


W^ 


^ 




•o »o 




• 


o 

c 


• 








April 
Aug. 
Aug. 
Nov. 


■ 

.5 


• 

> 

o 

2: 


a 2 a O 3 o S 


u> 


fi 


M 


n 


lO 


»«- 


»• r» ^ 


eo 


oo 


^^ 


e« 


o «^ 


IS 

*-4 «i4 


^ 


o 


•.4 








o 


^ a <-) 

o» « e 

^M «4 ^M 


^4 

f4 






Is 


^4 



CO «9 lO CI ^ « ^ 

I- «-• C< 



IT) 1^ ^rf lO Q IC lO 



^ to r^ 

^4 C9 ^ 






■ * - z 

3 3 33 

•** *4 *9 'tf 

rill 

Si »c| S TX4 
^ .S <S ii 

OQ CO 00 0E> 

a d d a 

«9 c9 « 91 

» ^ » ^ 

I III 



3333 



A a a a 
S S S S 

tc 'tc tti td 

it 2 .3 

so QO 00 00 M 

e d d d ' 












d 
a 
•3 

•a 

•c 5 2 S 

.^•i-i-i 
111 

o. a a 



I 



& ^^ ^ 



IIIIIIII 



2, .3 .a .s ^ 



d d ^ 



*d *i a a 2 ^ • 
^JJ^oQwoQaoO 




5 



Cu^sstsTBD CrvrL List — State Hospitals 



397 



88SSSSS8SSS3SS8SS83888§8 

i§s§§§§§§§§SS§S§S§i§i§§l 



lO CO M 



hhuifmtfnmuihi 






rx ^ 1-4 M ci M »« 






i 1 1 i ^ ^ I ^ 3 6 i s i g. 1 1 «• 1 M t5 1 J I 



c 



C 

o 



•5 







6HRa 



'I 

5S5S 




e 

c 

a 
E 



I 



3 2 £ S 



^ Jj .S J2 
*o *C *C "O 
t? "O "t! "O 



^ ^ 0^ ^ 



o 8 c 

>C !C EC 

Si S S 

s i s 



r oc oc 00 OD 



5 5^ 

K jj ^ 

r •« -3 



§1 

■si 

c 



II 






8 = 



§Sh5 



£2§S 



eo 03 



I 

c 

1 



c 

< 

s 






II 



QC 



53S 

III 



Is 





c 



O -<: S w S 



V 



C C* 

Ill 

00 ;>. 6& 



R 

& 
T 

C 

B 



s e 
« Jl 

•^ •0 s s s s 

S8 




o 

c 






.c jC ^ 

c a c 

« « es 

fek• u 

o o o 

C C C3 

^ S S 

B c a 

•5 "D •§ 

B c a 



Ijl 11! 



398 



Report of Statb Civil Service Commissioit 



o 

3 

a 



s 

I 



2.S 



"S 



S 



a 



Is 

9 '8 



§ - 
• o g 

2|| 



-& 



2 
O 



88888888888S8 



00 



O t« CO CO CO 

v4 *4 •>< ^4 *4 

Ok Ok Ok Ok O) 



^ 00 «« CO t^ r« 

A *i4 ^4 iprt ^4 pH 

00 Ok Ok 0> Ok Ol 



o o 
055 






<0 CD CO CO CO 

wmt ,^^ ,mt r^ f^ 
0> Ok Ok Ok Ok 



^ on CO CO t^ r« 
Ok ^ Ok -« ^ «^ 
00 Ok 00 Ok Ok Ok 






s 



^ to 



s-^ 






3 ft P O * O .0 



^ ^ ^ 

Ai n a - 

El. £ |s< •<•<•< O 



o o 

55 



c 
•I t? 






• c 

: > 

g S 



I 



I 

a 

:3 



•• 

a 



09 



si 

»- OQ »^ 



S <&2 

nil 

§ .sf a ►J 

^ S 00 M 



a 
2 

I 


& 






< 



•o "d 



S 






».33 . 

III. 

00 00 QQ 



1 




H 

»4 

H 
a. 

o 



is 

o 

2 



cm 

" i 



eS 




CO 8 

CO 






I 

o 

0^ 



I 




II 








Classified Civil List — State Hospitals 



399 



8S888888S8588S888888 



88^S 

S5 CO i-i o 



«0 <D Q O 

»o r« » c^ 



^ «o «o 1« 



OO UO O 



akako»aoa»o»o>o»aka»akakO>o»ak9a»o>oa» 

•^j;j;,^4o#S(jSo«?aSoa52:»:;o»?'->*-»o 

§aoao«4QOi-4C«iAC9iow3i^r<*aoeoeoM3gm^ 
00»?a82'<*<»?Oo8»?a5<»?«S5»?«<*< 



S S3 {IS tE| 



s s s s 

S S 3S 

CB 0} OQ 00 






^8 



< 

1 



5 



13 










8 
) •A 

Ja • °Q «) «j 

CQ p. g p. - 






J 






OO Q e« 

^ SB ^ 















>» 

3 



ill ! 






3 
I 

09 

I 






flll5lillllll|g|l6ll I 



n 




400 



BsFOBT OF State CiyiL Sekviob CoiaoasiOK 



! 



I 

to 

O 
O 



CO 

O 
H 

i 

CO 



H 
CO 



a 8 & 

a 



11 

g-8 



i " 

£ o 



I 



I 






§ 



o 



OQ 

o 



2 

O 

H 

t 

h 

0. 

91 
C 

O 



§S88S8SS88888888S888888SS88 
»89mSSSS8888SSoBS9Soo«>ao8<o 



CO 04 ei 



M •-• 



5 Ok 


1^ « 

Ok 0» 

1^ »M 


^4 


Ok e» 

^4 ^4 


^4 


QO 

^4 
^4 


V4 


00 

^4 

o» 

V4 


to 

^4 

e» 

V4 


o o 

V4 •-« 


^4 


«>4 

o» 

•-4 


00 ^ fP 

<-• <^ O 
o> fo S 

•M V4 *.4 


V4 

o 

»«4 


09 O CO 

^4 «M wl 

o o» o 

V4 «i4 «.4 


eo CO ^ o 

V4 «>4 ti4 fi« 

e»oe»o 

«.^ «i4 *4 fi« 




■ft » 

m4 fM 


s 




^ 


* 


•ft 

to 


•ft 

4»» 
V4 


* 


f-l ^4 


^ 


o 


^ t* ^ 


• 
«.4 


^-«>oo 

^4 ^4 


» • • • 
00 »^ ^4 r* 

f.4 


Sept. 
Sept. 




i 


II 


1 


• 

1 


s 
5 


» 

»* 

•< 


• 

V 

& 


II 




• 

< 




• 

o 


III 




C4 «0 


o *- 

Ok 0» 


CO 

Ok 

^4 


o *4 

S o» 


*4 
«-4 


^4 


^4 

Ok 

«-4 


00 

o 

^4 


00 

*4 
«-4 


Is 


^4 


o» 


O ^ lO 

s s s 


*4 


C4 O «-t 

•>• *4 «M 

o» o» o» 

V4 «M ^4 


e« 00 ^ o 

^4 V4 VM ^ 

0» 0» A O 

^14 ^14 P4 ^ 


• • 

82 


1-H CO 
CI 


N 


• • 
CI ^ 


^4 


»4 


^ 


«-4 


• 


• •ft 
^4 


r^ 


tcT 


^ 94 ^ 


^» 


oTcT e« 


00 •- •4 ^ 

f-l 


May 

Dec. 


si 


s 


is 






1 


1 


tt 

•^ 


8- 
55 


>* 


• 

M 

3 
•< 




• 

1 


1 &2 ^i-S^* 






ff?^ 



•§||l|l| 



a 



3 

s 

o 



^ J o 
S Sj^- 



3 

1 

1 



Its |o||^s||i| 



-• ft: 






m EC 



5 5 5 5 55 5 a5|>5|'5 



5 c/j 

a 

£ 00 £ 



>^ M ^ 




5 : 5 n 5 

lllll 

^s^ s 

C 00 «^ » 



55 
S S 

55 
5 5 



I 



M 

O 



e% ^ •- 






a 
•f 



1-3 

e5 ^ 3 

ja •= J3 



J<5 



M 



« 

c 

C 



X • 3 



^ t 



s 00 ^ 

tc ft2 < 



s* 



a 

cs * 5 

§ E 2 



■•J 



I 



n: a 









c 






S tf C3 



bH 3 

C s. ^ 'U ^ O, C K ^ ^w^= St 'f OSSX p 



5 






5 

c 



Is 
il 

St 



d 
•s 
a 

d 

« 



gs 



^1 



a 
5 

« 
3 
O 



e 



O £ Q 



s 

d 



o 

U H 




d 



d d 



d 



s-s-atl 

d d d c o •« 

5555 11 
• .a .9 .« a S 




CuuisiFiBD Civil List — State Hospitals 



401 



S8888888888 



00 

o 



9 § 8 8 S ; ss :!: g 2 



akC!ooeor«e«t^30a«D 

fllOO>OkObOkO>Ok9 



^ ^ h. <o ^ O 

^ e^ <M •-• 



co^^o*^^^^**^^^ 



5 3 M 3^ Ai ^ 33 s5 
r«io«oc9Moa»«o« 

^ e £ S £ £ <JS S S £ ^ 







M 

D o> Si 

IS - 

•S o fc a 

.^ »i4 ^ M 

(§2§2 




I 



s 

o 

U 
I 

z 

o 

25 



o s 

H 



=3 



g < 8 « J 

'ii -^ 'ji .0 



DISD D 



ct 



J4 

h 
O 

3l 









S'' a "Sl-^ b 1 & 



6 
d 

O ci K 



e 
JS 
3 



6 

8 '^ 



I 







31111 



1^ I 3 S 



o 
♦» 

o 

i 

I 

< 



4 

o 

o 



8888888 



lO 


CO e« 


• • • 

e<i M 1-4 


• 


i 

^4 


CO t« 

a o» 

f.4 fi^ 


<D «0 t^ 

«« *4 «-4 

Ok O Ok 

^4 V4 ^4 


00 


e« 


^'00 


»^ « oT 


CI 

*4 


1 


U 


III 


3 


94 ^ r« 

Si S ^ 

OO 9 00 

*4 i>4 ^4 


fi o CO 

<p v« ^4 

9 Ok a 

V4 *4 ^4 


•o 

♦.4 

Ct 


s 




pi in t^ 


• 
•-4 


• 

d 


Auk. 
July 


June 
Not. 
June 


• 

e 



333333 

iiiiil 

ti! EC cd tn K tc 

S 3SSS S 

SS SSSS 

oD en tn tn tn oQ 

nn nn it n 

•a 's -a 'JS 'H 'a -z 



a 



a 



E . rA ^ SI ' ^ 

01 



8'Sio 



•^ III ill 

C C W O K < < 




I 



M o a a 

^ •§•§•§ 

■g u3 .a JQ 
.S a a a 



^ 



Q a a 
•^ . j .s .s 






3 



V 



i 



402 



Repobt of State Civil Sekvicb Commissioit 



1 



III 

i8 2 -^ 



a 



lSi| 



i 

o 

i 

u 



g «» d 
^ o • 

B Q ^ 

p B a 

m 



o 



888888888888888S888888 



§§ 



M CO 

^^ ^4 CO ^4 1F4 



Ses^SSSS8§|;gS| 8 



oo^a»aooc90oo^MK^•^•ooK•f(e^•^v^••o 



«-• W« «»^ OI«-« ^"-i 

c, 



00 pH (-4 ^4 lO 

w ^ ^ 



O CO to >H 
CI 






— • • w • 

^ o >o a> «-« 



>» >» 



S8SSo8SSSSsoSo»2SS 
2" "■ 2" i g -*" 8 2 2 2 -*" S f 2 * S -"" 






oo 
o 



3 
90 



I 



i 3 




■ 2 ^ " "S ® 

O N ^ 9 ^ ^ 







2^D 



J 



as 



00 3 



9 «f 

'^ fi S I « 

p kS lO B e« 



3l 



n 

5 



i^g 



hll 



91 

u 







is 
It 



i 

o 

V 

O 

Z 



I 

•5 



Classified Civil List — State Hospitals 



403 



SSSS8SSS888S8SSS888S8§S§ 



M%% 



I 



p e« qp <o 04 qo Op 
e< CO o r* CO o o 
CO o r« 00 i^ t« t^ 



lOeOCIMMfXi-iiHfirtM 



S oo 






00 oo A ^ 
*^ 1^ A O 

» o» S S 



O t^ «D l« 

^4 *i4 #14 *4 

a» o o> o 



«^Qf^p^»^p^»^^c>o»«Hod«o^»-*«J<ooe*^ 



S 



S2 



lOfDOMi-iOeO^'H 

*i4 *i4 *4 *i4 fi4 e^ ^4 



Ijitiliiiiili'illiiiiilii 

0,M,-ii-iQO..-iC«geoa^w3oor>»oo<D^co9C»cot^or« 
o5ooSokSo>OkSSaOQoSooo>o>ooSSSSS5o>o)w 



CO ** 

O ► 

H 3 

CO 3 









O 



•Ss a o o i ? 



9 

3 



il 3 



9 9 

33 



9 

3 



I 



9 9 9 9 



9 

3 









a S 
» I 
a 00 



: >» : 

so 



I Is. ^-9 



I 




o • 



a 
, E I a i i g 4 



i*4 



Si$ SuS :^ 




« 3 i S^-d""8\:*^^ffl**^80 




T3 S »^ • 



d q q a 

a -3 .a 



3 -3 S 8 s • 




5 

a 



iiiii 




404 Repobt of Statb Civil Ssbviob Comcnszoir 



8 



o 

09 



8 

1 

I 



111 
<sll 




8 - 

lis 






O 
en 

2 



88888888 

<0 O 00 00 00 00 00 



8 



e9i-ti«oo«ooocot« 

Ok Ok 00 O^ Ok Ok Ok Ok 

§r« 1^ 00 <D <p •-• <o 
a oo <^ *^ Q ^ «-4 
00 00 Ok Ok Ob Ok Ok 



ssss: 



o B, o 



^4 fi^ C4 ^^ «-4 



M 



^ 

3 



s 



I 



JS 

2 

'** «> <«« 

GC £ 00 



5 

I 

m 
s 

02 



3 3^ isr: -- 




e 



c 



Sis 



•& •- ft* 



S 8 



•I'll P 2 







a 

IS 



B *« 



II.- s 



•e 's -S "s '3 



B 

•9 






B ■ 

a ■»- O 

8 

(2^ 



B 

8 



* c c- ^ 

• X K •< 



Ok 



9 



o> 



a 

9 



! 



5 
'5. 
8 

OQ 

1 
I 



6 

2 



IT 

1 



B 
o 

a 



•s -3 
I I 

s 



CSLAflBETiBD Civn, List — State iNSTiruTioins 



405 



O 

1 

6 





s ^ 

a ^ a 

Pi 



i 

z 



o 

09 

2 



8SSS8 S8SSS8SSSS8S88S888S 

§§§§§ s§s§§si§§§ 

8 " " 



09 M 



M »4 01 



r« t^ t^ lo lo 

*^ **^ **^ fi fi 

9 O O K K 

^4 fiM *i4 ^4 VM 

lo ^ i-T fij »«r 



9a»oio»990ftOftaiaia»aka»9oft9a»aka» 






1^ 



OOOVA OftOftOk9999Oft9QOOiakO90k9OfeO>d6^ 

lo oj i-i* 1-4 «-! •-« <D lo iC o •-« lo f-T 1^ e« t^ 00 a» of h^ Oft o «J ^ 

isii8 iiiliiiiliiiiiiiill 



! 



9 



9 



o i:: 



I 

.S'O OD 9 







M 
H 




H tQ n J^ •< 




:9 



>l 



^? 



< C3 « i2 w 7 



i 



Jii 



A — o c a 








° s 




I 



I 






40C 



Kepobt of State Civn. Sebvicb Couuissiob 



1 



si 

i -a 
a I a 

&n 

8! 



|8 



,^| 






1 



I 

lis 




2 
O 

H 

9) 

s 



88§S8S8888S8S8S88SS888^S8SS8S 
§§§§§§§|§§§S§§§§§§§§§§§§§§I§I 



SSSSSSSoSSSSSSSSSa»akSSe»^SSa)ooa 



« «-« itf •-< eo f^ gj 



t« n <^ « »H eo 

< »n •-» < 



«-4 ^ o o <e t« 



^ «-4 ic 



oTrfoi-flde^wi-Jio^ 



s: 






w 2 



^ •^ 



lltllllllllllll^llll 



SSSoSSSSoSsSSSsSarSSSSSSSfloSSSSS 






» » eo ^ lO M 



as 



llllllliillliilllillfill^lili 










OOOOOOOOOOOOOOOOOOOOOC30000000 



Clabsifibd Civil List — State ] 



§sissiiiii§§i§;s§iiiii§is§ss§iiiiiii§i 

--■-■- - - ^ - - - - - _■ -■ - - -■ - - -■ -■ -■ - - - - -" rt- -r -■ - -; -■ -■ - -■ .' -■ 

iiiiiiiiiiiiiiiiiliiiiiiliiliiiiiiiiii 

lil^jilijIiiJlajiliiiJijiiJJlliillJlll 
iiiiiiiiiiiiiiiiiiiiiiiiiiiii!isii!iii 

!iiliiijiyi!ii!iiiiij 

m m II mih m m 



iilJJlijiiiiiiiiiiiiiliiiiiiiiiiiiiiii 



408 



RrpoBT OF State Civn, Ssbticb Comicibsiok 



8 

1 

K 

B 

o 

O 



-S .9 •- 






^ 8 

1 1 

g'3 



I - 

III 

5 * 



o 



QQ 

2 



S8SSSSSSSSS888SS8S8S88S8888 8 

§i§§§i§i§i§i§§iHi§§§§§§i§i § 



iiiiiiliiliiiiiiiiiiiijiiii I 



3SSwSSa»SS»SooS3S3aAO»AAA9oa»S8 a 



8 *^" 5: S5 i § - - 8 • '^ -"* 2 2 ^ 2 



<0 Ok (0 



^^ 



lO 1^ » t^ 01 01 



llljlll 



I 



s 



99 



liiiiiiiiiil 






I 




1 



§ 



c • g 



• • • 



• • • 

• • • 



i 



a a 






1 



£»i< 



Classified Civil List — State Institutiows 409 



8888888888888888 



88888S8 
§§i§§§g 



8S888SS8 

«6 'I' ^ 



o o 

<D 01 

n to 



-*S^:5'"'S'^"«*2f?f'""'^"8 8"S^" 



Oo^taaot-anooo 






»-« « »^ t» »^ t» »^ 



III 






r* g g g 
8 S S OS 



oooBososwoooiAotoi 






00 
0> 



f-r«oioioodot-««o^cf«-««-« 



«i4 Ct (^ r4 (^ 



^ M 



882^ 



iilJllli 



^4 0« ^^ (• «-4 V^ ^4 



Miiiii 



iiiiiiii 




^CfS^p^p^ £h 



•SI 

wooooo4 



«1V «« «« «iV «« m^ 

JB c a a 3 
ca B d d a 3 

<<<<<< <t5 




410 



Repobt op State Civil Servicb Combcission 



to 

o 

CO 

8 

s 



d 
e 



S 

6 








o 

QQ 



H 



1 

o 

s 



8S88 



8S8SSSS8S818SSS8SS8 

§§§§§§§§§§1§§§§§§§i 

*«•»•»•»*• Vk * * * * • • • 






OO c« >^ *-4 

»^ #e t^ »^ 



illllliiiillJlillli 



0)90100 OOOftOlwOI90kO>OwC^wOkOOOkOaOOOk 



00 e« >H -^ 
»n ^ "^ »n 



i 

CD 



I 



I 



to 

O O *** 



8 . E5 
Ha 8 s 

•-» Cfc < 00 




to v^ t« 0» 

s4ss 



•-4 •-« mT e Ok <D 



«>eifhr<#^H|iocfak 

lliiiiilliiiii 



-f 



<5 



! 



i§ii||iii| 





Classified Civil List — State Institdtiows 411 



SSS8S8SS<SSS88SSSSS8S8SS888S8888388 

I!!!!?!!?!!!!!!-!:-!!-!!-!-!-!!!-:-!!!!!?! 


iiiiiiliiiiiiiilliliilliiiiliiiiii 

-■ 2 = -■ s a -■ a a - - s - - - S - i - -' = - = = - - i - s - s - - - 

ViUmiimnmtimmmiimi 


iiiiiiiiiiiiiiiliilliiiliiiiiiiiii 


uuimiiiutimnummuiih 


Sa&^aa6a&&&o&6&&o666aa66&&a&6&&& : 






iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiir 



412 



Report of State Crvn. Servicb CoMiassiOF 



i 

s 
6 



si 



II 



S'B 



8 

to 

o 

CO 

to 
o 

H 
O 



8 ^ 
c ^ a 

Pa-*' 



o 

O 



S8888888S888888888888S8888S 
§§§|§§§|§S§§§§§§§§§§§§§§|§§ 



r«e«c«oA<H<-4coot^ooe«:fe«coe«c«c«ioqaQe«AO«-*o«« 

llH^llli'llllll^llllllllll 






§i^^l^AOcoi-40c«^<-t^e«coAC«tf«M>qaQc«ooo^o«^ 
90k900kOOOQAOkOkOOOOOkOOaOOtA w A Ok 00 Ok Ok Ok O 9 








kl 



i i 9 

o o oo 



T'S'H'E 

c9 a s 3 

9 3 3 3 

o o o o 



eS 

a 

o 



et ee 

o c 



o 






I i 

oo 



M M M •• M M M 

08 CB CB flS flS CB 

OOOOOOOOOOC? 



II 



CuLSSiFiED Civil List — Statb Institutions 



413 



8888SS888888888888S8S8 8-8 8888888888S8 



888S888888 



8 



888888888 



lli-l-tt^§il||H^^|||-li|||g|l||i|aiis| 



(^^(^(^r^QOiMaoooaoaoaooOM 






§ t5 a- '^ "^ ^ 



sjiimiiiiiiii 






•3|SS^ 






>» >l 



"C >» - "ti "C ^ " a «• • ii^ • • 5» 




S 



e2$ 



OQ 



a _ 



CO - 



i 



a 



i 

s 



o 

a 



.^„, ^ . ilix 



si 

o 

a 



S 

o 

c 

o 

c 



a CO 

^U3 









ill 



o 




III t 



a 

s 



QQ 
5 



•S.2 ^. 



A 



^ 



« 







c s 



8 ^^ 

mm 3 S 

m a et 



s c 

M M 

C C 

> > 

OS 0$ 



s 

e 



& 






o o 






c 

a 

Q 



c 

a 
t 

c 



\i^W 



414 Report of State Civil Service CoMMiBsioir 



I 

ft 
o 

CO 

g 

ft 

O 
H 






81 







o 



8888 S?888 
S888'S888 

• * » at V^ • M M 

8 •» 
8 



OOMMt^iOWGOCO 

^•-»fa"<»^»-»«-»«-» 

00000)0000% 

d C4 «-4 1-4 ^ 

^i>^fa<<;H»i-,aQin 



88SSS8S 



8888 
§§§§ 



«9 e« 



CO oe o 
»^ t-» ^H 
o o o 

t-4 9^ W^ 


oe 

o 


00 oe 00 

m^ m^ w^ 

o o o 

^^ pm 9-^ 


^^ iM lO 


to 

t-4 


00 lO kQ 

VH ^4 *.« 


April 
April 
Deo. 


c 




00 oe o 

w^ m^ w^ 

o o o 

pm w* r^ 


00 

o 


00 oe 00 

t-» ^H F^ 

o o o 


r^ ^4 M) 


* 

^4 


00 o »o 

Vi4 Vi4 VH 


April 
April 
Dec. 


• 

c 

08 


Feb. 
Jan. 
Jan. 



^ le lo CQ 

•i* »< •* •* 
o o e» o 

9^ tm w* pm 

• • • • 

^ « iO R 

^H w* »■ •• 

O O 9 9 

P^ "^ ^ •* 

• • • • 
n r^ ^ " 



I 



g 



g 



^ s s a 



2 



o 



e 

o 
E 



(S2£oS(S(S^ I l(S2(S 







C 
C 

o 

' a 



e 



1 1 p S E £ 

* 6 5 — £ £ 

^■a ^p« ^^ 



2 





fa fa 




Classified Civil List — State Institutions 415 

88888888888888888888888888888888S88 
§§§§§§§§§§§S§§8§|§§§§§§|§§|88§§§§§§ 






s 

1 

•i 

a 
o 
o 



-- ^ — - ^ — - '^ 2 2Z ?^ "2 _Z Z '"^ *^ *^ *^ ^^ 



00 e« 

S£5 






• • _• • • • • 

•-• (H <D m ^ (H ^ 



ll'llllJljIIJIIIIlllllllllllllllll^l 




41(5 



Bjcpo&t of Statb Civil. Sssvics Commibsion 



I 

i 

I 

a 




'^1 



I 



H 

a 



« s 
la 

- «■ a 



o 

H 

CQ 

s 



88888S888888888888888 8| 

3 



eo "* "* 

f^ <i4 ^^ 

Ok Ok Ok 



OkoakakakaakOkOakakakakakOkakoakaioi 



OkOkOkackOkaiaiakOCkOoakOkakOkaioakakaci 

^2*^2S58*^''^a2«S'^2'^«28S8a 




• ••••••"** • ••• • 

• •••••** * • ••••• 

iiiiiiiiiiiiiiiiiiiif|| 



o 






►1 



5 



'5 

N 1 












tf 

^ 



Classified Civil List — State Inbtitutionb 41^ 



8S88 



8 



c* 



88888S888888888888888S8888 
S8888S88^88§§§§|||§§8§|§§| 



CO 



IS 

CO «-H 



ei ^ ei 



H 



« M 00 lO 

t-i ^M ^^ iM 

O Oi o> o 

v4 vi^ *ii« Vii4 

f-7 W) K> (O 

6 ^ ^ "S. 

O C4 00 lO 

vH erf vH rl 

Oft O 9 0& 

1M ^4 ^4 v^ 

f-7 lO M) (O 

^ •?• "S «> 

jp a a g* 

P -< •< « 






OD M 
I * » o 

O ^ 



^ e^ i! 

M lO CO 



2 

&4 



ll 

1 






a 
c 



c 

85 



S k 

ll-ss 
^ u a £ 

^ W V-* w 

a a a a 

2:5:53 

^ a a a 

5688 
14 



^r^r«t^r«ao^r^aoeoao<^o^c«iOi^aoooooiococ4e!eo«^ 

OkOOftOtOftO&90kOtOOOftOftakOkOk90k90k90kOkOkOOkOk 



^^•QOft^cteOi-* 



• 



MBeO<H<D»i4<D»i4lOietO<0*H<D<DlO»i4a»i4 

mmfuuhhlhihiU 



i-4COt^t^l^Q0^^00COt» 
OOOOOftOkOftOtOftOtOoOOt 



^•^iOt«t»e«aoococ«c«^o 



cQ oT iQ Ok «^ ei c^ 



a'^s^s-^a-^s 



o tC lo kT •-« ^ 



«-H 00 <o le »^ »^ 






o 

m 

► 



0. 








I 



80) 



a 
o 




1 



a 



|l||il1|i^lall| 









418 



Report of State Civil, Service Commission 



a 
o 
-a 

t 
I 



s-s 



•5-9 

OS 

a 

«> 



l« 



Is' 
g-8 



i 



I 

o 

CO 

o 
o 

09 



8 ^ 




z 



o 



8883888688S8S8S8888S88S888 
8888888888888888888888885S 



888 
•^ ^ 191 



888 

'<• •* ^ 



Q0000>00O000>Q00i00O0tO0iQ0900a00ii0b0>O)0000ww 




•a :a 5 :a J 



III 



8 

(2 



00 at 



^ ^ « 



a S a5 5 
jP en 2 00 t» 

•^ t* lO ^J « 



r rO r 

5 CO = 00 



<S 



t^ > N O » 

CO (M Fh ^ <^ •-• 



4 

I 




9 



11 



^ S3 



o 









•dij 



fl "3 



. = >» 



3 w 

■9u 



•3 a M w ^ 






=si2H 



a » 



a a 









"g "2 "E T "S "H "2 



t3 "0 "g 

k< b H 



M M M M H M M M mm M M M M •• P* *4 M« *■ »« ■« fe4 >• *"■ ^ ^ 

iislilisliMlisssMS sisjii 

oooooooooooooooooooooooooo 



Classified Civil List — State Institutions 419 



888888888888888888888888888888888888 



S2 



"* lO « 

^ a i-H 
o> w o 



cq CO 






•• • • 






lO ^ 



mm 



^ e« 00 c« <D »^ 00 



8SS 



O ..H ^ ^ *^ 00 ri« 



s-s 



eoeo«-<'^t-«a»'^«o 



I 






ooooooiaoaoaccooooook00oDa>oo«woo 



OOoQi-H^i-HC^ioiceiio 
0)aoowoat90kOiOw 



<0 

at 



^ 



^ ^^ ^^ ^^ ^^ ^^ ^"^ ^^ ^^ ^^ ^^ ^^ T^ ^^ ^^ ^^ ^^ ^^ "^^ T-^ »-^ T-^ ^^ »— • ''-• W-^ " — • ■ — ■ '-^ ■ — ■ *— - "^^ 

o^Deo•oV'fWflOW«'-?eoe«aafa»o"»ii^"odoQep1-7Veoeo 

m . _ ■ . . ^M . • 



<D <«• 1^ 




M 
OA lO lO .9 

^4 F^ ^4 U 



o a o 

£3 S 

g 0. H 

*fi CO •« 

^ r« C4 



^ t* «0 00 

o CO « So •« 
^ .^ ^ ^ ,.4 



n lo S M 1^ O 









1^ 



ss 




111^ 



^^^iiiiiiimr^ 



I||llll1111l11iiiiiiiiiiiii3i§iiii^^ 



^11 



420 



Report of State Civil Sebvics Commission 



I 
o 

CO 

I 



a 

o 

I 

8, 



S-3 

"S-9 

si 



g-8 



it 

« Ok 



I 

I 



i 



55 

O 

H 

QO 

2 



88888888S8888888888888888 
iiSS888888888888888888888 



»ii4 
t-4 

9 

1-4 


•.4i-4^4l-4*i4F^Vii4vH 

99999999 


1017 
1017 


1017 
1017 


t* t* r* ■* 

«i4 ^4 iM p4 

9 9 9 9 

1-4 f.4 Vii* ^4 


1^ 1^ lO 00 00 

Vi4 F^ ^4 ^4 ^4 

9 9 9 9 9 
r^ w* r^ 9^ r^ 


1018 
1918 

.1918 


1-4 

• 

z 


June 7 
Oct. 2, 
July 18 
July 4 
Nov. 7 
Nov. 10 
Oct. 20, 
Sept. 10 


Oct. 1, 
Nov. 17 
Oct. 1, 
Sept. 4, 


Aug. 15, 
Sept. 1, 
Oct. 4. 
July 15, 


Nov. 12, 
Nov. 10. 
Sept. 1. 
Nov. 6, 
Sept. 18, 


Oct. 7, 
Oct. 15 

Nov. 18 


1-4 
1-4 

9 

w4 


«i-«Ot»t»l^l^t» 

■^^H^^rtt-1^4^4^4 

9 9 9 9 9 9 9 9 

^4^4^H^4*i^*ii«i-4t-l 


1^ r^ 

9 9 

1-4 ^4 


9 9 


t^ r« t« <« 

^^ ^H w» m^ 

9 9 9 9 

pm r-^ ^H r^ 


t» 1^ lo X 00 

^H VH v« *i4 VH 

9 9 9 9 9 

^H •-« ^i4 F^ ^4 


QO 00 3C 
..4 ^ •* 

9 O O 

^ lH "4 


1-4 

2 


June 7 
Oct. 2, 
July 18 
July 4 
Nov. 7 
Nov. 10 
Oct. 20, 
Sept. 10 


Oct. 1, 

Nov. 17 


Oct. 1. 
Sept. 4, 


Aug. 15, 
Sept. 1, 
Oct. 4, 
July 15, 


Nov. 12. 
Nov. 10. 
Sept. 1. 
Nov. 6. 
Sept. 18, 


Oct. 7, 
Oct. 15, 
Nov. 18 





§2:r 






E 



i e 
is 

CD 9 

CD r 



OQ 



. _ Eg 



o 

z 

QQ 



a.&llllSgia§JisH§|jS3jJ 




i^ASi 



ii3S§SSSS3SSSl93393l399n 

OOOOOOOOOOOOOOOOOC30000000 



Classified Civil List — State Instittjtions 421 



S8888SS888888888 



§ 



o o 



88888888888888 



8 
S 

Oft 



ooaOQOcoaoaoaoaor^t^t^t^t^t^QOao 



xe>ioOQ^aoar(Oo«poa>qo«H 



00 

Oft 



ootO(oeQeQQO«-*aor!^'<39f'^*'d<o^ 




1:3 









I 



3 



mill 



3 



oo30aoaoxoOQCaot^r«r«i^iot«aoco oo 



o o ^ 
o 00 S 



g^ «-i © o «-< 5 o 
o o o o o o o 



00 

o 



00 O (O 



« 1-1 



« -H 



00 1^ 



s;-'^ 



•A «0 ^ 



eQiOi-«aooooo«De4e«^*i^«o«ii4 i 









JO 



I 



a 
o 



o ? a 







• • 

• • 


ii : 


o : 


? : 


* • 1 

>< • 


^ 


. 


9 


2: ' 


> : 


» 


•< • 


** 




QQ . . 


a : 


J3 


o 


4-1 


♦* 


00 a 


^ : 


:: ^ 


S ji 



? 



^ 



:M|:i: 






00 e «>' 



00 




Eg ft« lo **■ ic 

•-» QQ ^ ^ PO — 



s 
^5 §1 fcs 




i|tl 

•-s K ►n 00 



3^^5 



O ^ 

4. O 

o < 






5ao 



5 S o 



It . 

« §3?|.g 

t: 6 >' -^ " 

^ O O O 4 






s 



? "3 






JS 



u 

•c 

&4 



o Q I «^' a 
^1 si § 



jC 
o 





to 

08 

JO 

o 

e 



422 



Report of State Civil Service Commission 





I 

o 

SB 




?; 



z 
o 



8 



S8 

88 



QO 



00 






1^ 



m 

9 



< 




S5 



M 

a 



00 00 



n 



PQ 



QQ 

:a 

I 
8 



S 

a 

5 > 



iiei 



£ 

c 
C 

V 

n 

o 

(0 

f. 

e 

< 



1 

t 



K 



a 

1 



1 

08 



1 



II 

s s 

<< 



88S 



M P4 




«4 a •^ 




c 



I 






M 
O 

K 

H 

QQ 

O 

H 

E 

3 

d 



s 

"i 

s 



o 
71 



0) 

1 

a 




g 

I 



d _ 

ja 2 t^ e* Ji 




I 



E 



U 5 



5 



•^« 



§1 

Qssn 



I 



Classified Civil List — State Institutions 



423 



S8S8888S88S888888888888S 



^is 



o 

2 



U 



S 



88S8888 






00 ^ 1^ 00 t^ 1^ t« 

^^ f^ v4 ^4 iM «i4 *i4 

O 9 9 O Ok O Ot 



000)»OiOiMX*CiO<^i^i-4i.H^^ 



«0 



r4ri«0^4v4iM^M«i4F^ 






•-» 00 C •-» 



t> ^ .^ ^ JO ^' ^ 



33 



i^t^GO>cecaoooaooot^<-i 
a»a>oafta»o>a)a>Okoa) 



OkOOtOtO^OftOiOftOOOO 






^^ ^^ w4 9^ t^ t* to 



333t o I 



00 1^ 1^ 00 t^ ^ ^ 

^^ (^ ^4 iM Vi4 *4 v4 

0& 9 O Oft 9 Oft Oft 

• ••**••* 

^4 ^H V<l *ii4 1^ «^ v4 



iililiiiiillliilliliiiii iiiiiil 




§ § S o 

III* 



I 



?^?s^ 




3z 







£ 






I 



§ § O § S Q 8 

;s :s 3 2 2 3 3 





424 Rbpobt of State Civil Sebvice Commissioit 






i 



o 



e 
c 

I 








S88888888SS88888 



e*5 iM 






^ 00 



I -2 



iliilillljri4ilsi 



1^ f^ iM 

S 8 S 



o 8 -2 

o Ob O) o> 



*ii4aO<-<i^v^*H^4«-t 



IS? 






o 

m 

I 




O 



J 



m! ^ ^ •>« ^ C9 

OB M QQ 03 ^ *^ 





•S 



.S 5 









liiil 
ilfli 




ChLASSIFIBD CiVIL LiST StaTB InSTITTJTIONB 



425 



888SS88888 
gi§§§g§g§§ 



88888888888 
§§§§§§S 



8 






^ « 



O. t* 



I 



n CO 1-* 



Jf<5ii5z 



• 
00 



83 s;-" 

III 



000090)90^0)9 



^ to I « « -^ fH 



eo t- •-• 



llllllllll Islllllllll 



eocootot^oooOMor^o 

0)0ftfl30)90)90ft90)0> 

^" S 2 *" 25 "'" i ^ i 2 '^' 

♦*S^bI •'•1^^ •♦*•♦*-: 

lllllllllis 

coeocp«ot^aoaoc<ot^O 

0>0ft90)0k0ft0t0ft90)0> 

-"" §5 2 ** S "'* 3 ^* S 2 '"" 




o OS S S 
B 



i 






•S 



3 2^.3 

p a i • 



||la-i 

S "* Urn 9 




b 



» ^ o 



i 

o 



II 



Inis 

^H H £ > 



• -^ 




a 



8 

o 

2: 



s 



CO 

d 



S 1 1 -S 



•§•? 



't *S "S 2 '^ § g '^ '^ g 




M O QQ 




o 



CO 



M 



O OQ 
09 



■ 

■3 



s 

o 

<0 







CO 



Q 

o 

CO 



: S 

ft* . 

illl- 




to 

a 

o 



126 Refobt of State Civn. Sebvicx Commissiok 



1-^ 



&l 



11 







o 

mm 
OQ 

2 



888®® 



o o 



88S8SS888S88S88SS8S8S 



un 



i 



n 9-4 t^ w* 



^^efC4M'4 ti4,.4ti4 



«o »o 1^ e>« «r 

^4 O *^ ^H «i4 

0> Q Oft 9 9 

^^ iM *H iM «i4 

» • • » » 

^4 914 ^^ fm wm 



Cft0ft0)0k0)0)0b0ft00b00b90b0k9flft0k909 



fHv4fH^4^^^H^4lO 






ma 



t» «« r^ N ^ 

o> o *^ ^^ ^^ 

00 $ Oft O) o> 

,M iM ^4 ^4 ^^ 

iM ^rt v4 1^ ^4 

»J aj • • • 



f* f* ^4 O w^ 



iM ei t-i 



^4smi2jrl^llllllllll 



«ot^r:«i->^ooo^t^co<0o^r««-«e3r«e422e2 
oftaftOftaftOftotoftoooftaftOftaftOftOftooftOftoftaDooao 



: : : : : :S : : i M J 







5 S 

S I -8 T -g rt "a 



I J I S £ 1 1 : 

I II i S f g X -si , 



i 






Classified Civil List — State IirsTiTUTioirs 



427 



S8SS88S88888888888888 



1^ 



88888888888 






O 1^ t« 1-1 9« t^ t« 

vi^ ^H ^4 iM r^ ^4 iM 

0> 9 O 9 Ok Ot 9 



CO 1-4 f4 



iM lO <D 00 «r 



CO iM lO « 
« 1-1 »i< 



^r«t>.vii4n«^e>Q«-4^^i^ 
1-4 iM CI »-i e* ^ 



a»t^r«aot«ooeoQO-«i^t« 

OOOOOkOiOtObOiOOkOkOO 









r«^«^^Mt^<D'4>*^tOiM^aQ(pot»i^i-ic«t»r« 

^HOOOi^*^«-4<-4^4iM^H*^vhQ*^'^*^i^*^*^'^ 

OOk90kOtOftOkOftCiCiO)0&0>90k000090) 



oog»o«-<»-<«-'i^^^'^30» 
oooooftOOkO&oAoaooo 



tO00«-i«-4<Pi^iO<D 

^ W^ « ^ 1M 



* * «B 



co«ri-ir«t^^oi-40BOiMfMei 



3lJ 11^ ^lllli Jill 1^^331 



OQ 






I 



«^ii 




i2 



CO 






i2 

CO 

I 



e«(So9nSSIgc«Hannn2Snn«onnn 







I 

•-» « i> 



Idii 



22%%%sz:2iz::z:sz:sz:^^^^ 




©5 S 3 > • 



>>^u3' S^ ^ 1^ ;i ^ 

' "* S S S S o 



.xa X JB 



■ XiJSJajSMjSMM 



I 

O 

z 



S 






is 



6 II 



3 
52: 



<4| OD 



W «4^ 



li 



< £ S £ tS 4 » »^ d^ o *? 








5 ® t. 5* 
29 « « 3 




428 Rbpobt of State Civil Sebvicb Commission 



s 

o 

Q 

m 

m 

a 

o 
o 

o 

S 

o 



3 

If 

a 



i 



^ 8 

«9 .2 •? 
® - > 

I 

8*8 




2 

o 



88S888S8S88S88S 





• 




m 

o 




• 




fH 




m 




^; 




• 












OQ 


H 


. to 




5?§ 


> 
« 
H 

O 
H ' 


Katonah 
52 West 


• 


37 West 
Bedford 
Mt. Kisc 
Bronxvil 



i s 

d 

•Ml 



OS 






S 

C 
eS 
3 
or 



as 

o 



"O 

u 



c >} 



c 

I 

J3 



u 

eg 






iS2 



o 



3 



c 

M 

« 
C 



O 

X 



o o6 »-« S M 
eg ^H ^H ^H ^H 



§§ 



8S 

O I* 



« O 1^ 

v^ ^^ ^H 

0> Ok Ok 
•i^ li^ li^ 


at 


00 lO 

e» o) 


Ok 


00 
Ok 


1 


00 r^ h. 

»H »M »H 
O) Ok Ok 

^H f^ v4 


00 r^ « 

>i^ «i4 rrt 

Ok Ok 9 

*4 (M «i4 


238 


t"^ 


• • 


v4 


»^ 


SO 


• • • 

»M t* ».H 


• • • 

o ^ c 


Aug. 
Aug. 
Jan. 


• 

1 


OQ 


^•1 


•c 

a 

< 


July 

Sept. 

July 


51^ 


CO O 1^ 

^ t-4 «H 

0> Ok Ok 

1.H V4 «H 


CO 

^^ 

Ok 


00 i-i 

Wt 1-% 

0> Ok 


1^ 
Ok 


(O 
Ok 


i 


CD r^ op 

*H ^^ Ok 
Ok Ok S 

^^ f^ f.4 


00 CO >ft 

r^ a r* 

Ok S o 

*4 «i4 fH 




• 


V t-J 


»H 


* 




• • • 

C3 1^ ^ 


28S 


June 
June 
Jan. 


1 


oo 


1 


ft) 

a 


• 


Mar. 
Sept. 
Sept. 


Oct. 

June 

Deo 







5 f- r". ■< I I a 



a 



2^ 






a 



:| 



5 8 = 



•o s .a .c •« 




•S.2 



•g SfeS 
.s -S § <s s S 



Classifibd Civil, List — Statb Ihbtittjtiows 



429 



8SS888S8§S8S8S§SS8SSS§8S888SS§§8SSSSS 

gg§IIS§i§giii§IIIIIS§§lllllll§§|§§ii§ 



<O<OOOh-h«r»OC*OOOt^OO(0 



c«^aor»r«h«i^acaoooh«»^aoot^roi^aoaor»r»»^»^ 






ci oc" 


• 
CO 


•c" 

04 


• 


00 00 


^4 


«" 




^H 


to — * 


^4 


• 


§5S 




* 


»M fM 


8 2 S 


• 
9^ 


ci 


©' 


* • • * 

^ ^ lO o 


• 


s 


"' - sf 


May 
Doo. 


• 
%m 

a! 


3 




ll 


ft/ 


3 


< •< 


3 








Am 






1 


t 

•n 


III! 


1 


i 

•n 


»-» "n *< 




O 

1-^ 




2 


1* ►• 


or 

•-4 
© 


^4 


© o 


oo 
© 


2 o 
© S 


r^ 


© 


OO o 

^-1 r-« 
© © 


© 


2 


«0 00 

© © 


« 00 1^ 

^H vM Fi4 

© © © 
*H r^ Fi4 


FM 

2 


00 
© 

V>4 


«0 

© 


t^ CO r* 00 

^4 ^H *H <i^ 

© © © 

^^ ^^ FM fi4 


00 

© 


1* 

fM 

© 


S !i «« 

Q ft ^ 
© « © 

p.4 fH ^^ 


s* 


rt 


8 


• 

e4 


oo 00 


^4 


« 




^ 


00* o* 


s' 


* 


8 2 




• 


• • 

8-^ 


Q «0 ^ 

e) <-) »< 




« 


© 


^' V lo 6 

P-4 fH vH 


Cf 


o 


a'sf- 


May 

Deo. 
Mar. 


3 


• 

a 

A 


il 


* 


3 


< < 




a a 


3 


• 

i 


1^ 


« 
c 

1 


1 






• 

o 


1 




1 




III 






o 
03 



^ 



i « "S J "8 ^ «' i J i J i -5 






15 



QQ 

o 



< 






» 




J J J J J 

^S ^^ "^ "3 "3 
»^ •»■ .^ *p^ fp^ 

— -^.— .,— .r-i— w.^.— .tZjCClJwW ■ ^m ^m ^m w^ tat 

^filll I llSlllllll gull's 

7^(!gpQaoPQonpQ:::pQn0n0nAonnnnn 



i? 



9 



■rt If w j5 
£js.sS 






•^ o 



•«* .i^ <« 9 



• o I g 

t 2 O 2 



■ fi 

2 I 2 C c J 

cc 5 .S C "C S 



fi» 



M 




s s s 






c 
o 



SsSSS^dSScaaaaaaecdddo 










^<< 



480 



Rbpobt or State Civil Skbviob Coioassioir 



o 



§ 



a 
a 



I 8 

g-8 



S - 



1^ 



I 



s 
i 






o 

H 

OD 

s 



I 



o 

■ 






o 



8S88S88888888SS 



S 

r* 



8 



i 






00 "N »-( 



•>4 r-i lO rH (D t^ 



W 



»^ 00 00 •H ^ 
•^ N •-< 






9. 3 ^ I tii 






^iit&i 



COOCO^fC OOOOOOOOOh*XI^OO^ 
Ok Oi Ok Ok Oi O Oft Ot Ok Ok Ok Ok Ok Ok Ok 



oo 



5l^^^»-itO»-«^Ok00««-">-*^ 



8 



ilili 






OS 



z 






tiS K K 



X 






00 ^ 

73 ^j -3 13 









I 



O 






OO 



oo 



Classified Civil List — State Institutions 



481 



888S S888SS888SS88S88S8888S88S888 



lO *-< •-' 



§o S S S S S S? 



§§§!!§§§§ 



8 



§§ 



N ^ 



CI 



h* <-• CO «-i 
•i^ O «^ •-' 
Ot Ok o> o> 



lO ^H t-4 t-4 



© S 3 ^ 

^ •H PO <-• 

So '^ ^^ 

Q 9 Ol 

•i^ v^ ff4 r^ 

* * * • 

lO _| VM ,.4 




aiaiOkato)oo>oiOko>OkOiokOkot 



aiak9aioka»aia»o»o»ak 



cc p to 
•N e« ^ 



to vM t-4 rH 






5 -? « s t» 4 <^ cS <5 »2 II 3 o Jb (2 a 4 z a 55 5 o ^ 3 fi 3 



toio<C'y)c<ioQr«Me«e4^h-r»eoi09t>r^2S'59S2^2 
o»a»oa9QOooako»a»a»o»o»Okoao«aoAAaD^aoakw 



(0pco^*oaoo*oio 
c% v4 ,M »-( — ■'" 



ei N *-• 



« 

I 



4 ^^^ "^ ^ o 






r^ *i4 ^^ ^ ^^ 

•n "n »-» "n O 






«i «* ki -J !>: >k »i* i 



I 



! 

O 

■ 
► 

& 

a 

6 



i 



d 

ja 
O 



1 3 



a 



'Sw 



5 

-< 



3 

•S vS p^ 



« 'i Q fc d 
*« fe ^ Z. S i 




9 

I 






a 
2 

1 

55 



I 

o 
d 

o 






liai 




i 1 1 1 



i 



I 



illlPiil 






^ _ J I _ _ 



O 





o o 



c3 S 
Mae 



,^l§§ll 




M O 00 QD £ 





483 



Il^>OBT OF Statb Civil Sxbtios Coioobsior 



a 

O 
H 



O 
CO 

o 



s 

•a 



•8 -3 



'J 
S § * 



g 



ll 



g-8 




S5 
O 

H 

QQ 

2 



SS8SSS8SS8888 888888888888 

iiiiiiiiiiiii iiiiiiiiiiii 




II 




•o 00 "8 t» 



(1< (L, 
CO ^ W CO CO 






• 
< 



M 

Sh 



5 3^00 W™^ OiS*S « 

^ooeo^^^'^Jj'-'rtoo 



> 



• § 
^'1 



||W|^ ?l fell 





.9 

|lill-i 



iilillll 



I 



h »4 ^ »* h 

mil 





Classified Civil List — State IiraTmiTiowfl 



433 



888888SS8888S88888S8SS8888S3o888888 



i§i§§ii§iiiii§i§i§i§iiii§§ii 



s 



sssssssissssssssiigsggsiisgsiiillll 






M — 






M id O. J O O « "8 






11 



« F-l 00 






^ »-» 




434 



Bkfobt of Stats Civil Sebtioe Cohmissior 



3 j 

s s 



Is 



(S|| 



1 1 1 

•a- & 



H 

CO 

O 

I 



« 
2 



2 
o 



888888888S8888S88888S 

8888 



8 

CI 



8 



I 



lO O lO 

888 



C4C<AOO«iO*^rOiO 



M '^ r^ t>4 *H ^^ <i^ 



a CO to *^ ^4 
ei ^ ^ 

• ^ 






^- 



O fe »5 



>>U >» 



^ «-3 • 



i-» 1^ S S 



8 



U3 t» 00 9 O 
9 Oi 0> Ok 



8 



« b> t^ CO 



O ^ Oi 



o 
o> 



O ^ eo ^ 

*H »^ f^ t-4 

O Ok O Ok 



aicocOf-i»>«ioai^io^«C4ro^cioo::2aoo^ao 



Hit 

S ^ -S S 



V kii 



5«? 



r9iM^p4Qe;IO;^0 

Hak«wQ5ao>^eoS 




»a5 




n ^ 8 9 



oooooooooooood 




o o o o o o 



S8 

•6 r* 



<d 00 

s <i 

5s 



I 



CuissiFiED Civil. List — State Institutions 485 



8 



8 8888888888888888 



3X 



g§ 



§ 




^ "S ja fe W 

«-» "^ * I* M 






iQ h- OO ^ CO O h- 

r^ wH f^ w^ 1-* w^ w4 

Ol Ok O Ok 0> O) Ol 



a' 



CI 

a 



^ 
S 






O 



•mm 



OkOkOkOkOkOkOkOk 






^ •-< 00 to CO 

^ ^ ei 



ss 



liiiiliiilililil 



to h«aoococD»^M)iOh«ao^r«iooooooo 

O) Ok O) O Ok Ok Ok A flk Ok Ok Ok Ok Ot Ok Ot Ot 

§i I; J: 8 §5 12 ^' -^ 8 1: s •*" 2S 2 a 2 §f 







I 

p 



a a a 



Pi a 

^ n n n lo !c 



III 




**wa^ 









486 



RxpoBT OF Statx Civil Sbbvicb Commission 






2 

o 

H 

00 



I 



888888888S88S888888S8S88888 
SSSSS88S8§8SiS8SS8888S8SS38 



o^••^iAleQooo<o^«<«•l-4lOlOu^e*«ooooooaoaoaox^«aooonN 



l5'^^S8'-2§38:2'^2S2§S§$:;"l5S22««>S8a 







CboookOkC>ooa30k9 



•ctoioMOOWooooooooooroaoaoeoN 



ts> «i< ^4 ^^ 

C4 C< 






Sa82«2S2§S^ 



oo 






00 «0 C4 C4 
M •-* •H 



CO 



^ 

-< 






? >» h 



• • » 






o 

s 

QQ 



a d 



»3 "S ® 

d 9 o X 



d 

s 



« 

I 

-a 

13 



C 
O O 

3 d 



-a 



W 



00 



g a a 



a £ . 
^ *«J TJ 



c a 






s 
S 




(0 



C4 







^ 3 "o 



= -d 



Stf-isS'Bflj«Jaa«b^ 








a 

■i 

.S 

e 
c 



M 
S 






3 3 3 3 S 9 9 



M2| 



Olassiited Civil List — State Institutions 



487 



S8SS88888S8888888 



issisiim 



00 



8S8SSS8S8SS888S8SS 

g||illl|g§gli 




?jCO*^COCO<^f-«<-i(0^<^*-io4r>i»4t»OI 



!^ 



cS 



|0«oeoocoQO»^-*^»oc«oo«ooi^o 
a90oo)9aBO)a»o»aoooc*>?>o»o 



•o ^ ^ CO CO a» <) 
^ ^ >» 



^ 






>^«=g 






OQ 



c o a 



a d 



II 



d 
o 



^ o o 

_ TJ "w "o 
9 9 3 9 



•§ a « - 



33»ss:::s^Saq 





1 '-S *S 



X S 33 




asaaccaaaaae 








1^ 


o 

0» 


CO 
0» 


oo 

Oft 


1903 
1917 


1917 
1918 


00 

Oft 


00 

Oft 


Oft 

^4 


00 
Oft 


f« 1^ 00 00 

r^ »^ rH vM 

Oft Cft Oft Oft 
^^ (M fM (^ 


Oft 


00 


00 


lO 


s 


*i4 


-* 00 


2« 




00 




^H 


»-< eo g »o 


00 


• 

3 

•-> 


li 


3 


1 


It 




• 

a 


• 

t 

O 


i 




"3 9 o o 


•n 


'I' 




o 


to 


30 

Oft 

1-^ 


S2 

Oft Oft 


Oft Oft 


00 
Oft 


oo 

Oft 


Oft 


00 
Oft 


!*• (D oo 00 

r^ r^ ,mt ,mt 

9 Oft Oft Oft 

fM fi4 ^H (M 


Oft 

9^ 


* 

00 


00 




• 


i-T 


''"a 


o — 




oo' 

1M 


Oft 

v4 


• 


-^^ss-^' 


00 


1 


■ 

1 


• 

2: 


1 


• 

1 




ii 


• 

1 




9 


till 


»-» 



s 

o 



g 9 9 9 9 9 9 




I 

a a a g ;§ 



I 



a d a 



8 

o 







d 
ua ua 
o o 






t 

3 



a 



W good's 







488 



RxpoBT OF Statx Civil Sebvios Commissioiv 



a 

o 

*i9 



a 

o 
O 



a 

« 



S.S 



I 



Is 
q5? 



g-8 







55 
O 



8888S 




r» h- t» t» r* 

rM r^ ^^ rM w^ 

Ok O) Ok Ok Ok 

^^ ^4 ii^ t-4 tiH 

4 >> 



o 

O 



nil 



ll|-S| 

fc "< "^ *< »-» 




^ K K £ K 



H 
O 

> 

PS 

H 

00 

Q 
M 






O 



S ;32 



I 




h b 



S S ^ i a -1 
s s s { ill 







^^ 



s 

6 

d 



& 






Q -8 



00 






I 



i I" 



Cu.S 






c 

s 

e 

o 

X 
k. 

18 

o 



Classified Civii. List — State Institutions 



489 



888 



w 



8888888888888888888888888888 



8 



S 



I* 



88SS 

A O CO K« 



Q 00 



^ c* ^ 



m 



00 


« 


t* 


^^ 




o 


o 


a» 


o> 


»H 


iM 


^^ 


»i^ 


« 


* 

CO 




•^ 


IH 


>> 


Feb. 
Nov. 


X 


N 


r* 


«^ 


^* 


o 


OS 


o 


a» 


v^ 


«^ 




»i^ 


* 


• 

CO 




iM 


t-t 


^ 


^ 


> 

n 


S£2 



GO 



> ► > 



;3 "S ^ 



2 8 £ 

d b « 

O a. 2 



:: c g 

•I el e* 

a'c.'a 






r»r»ooe«i*oooe40oococi^iOGpeoh-t^x^^eoh-aDiO«*oooe4 
akak9o>a»o>>a)AO>osaso>aiooso>OftOsokOkOkak990>oo9 



So a 









_ « 



•»< « 



40055 



Ic^ 



z:S4oaS^'<**sSQ 



t^^OOCSiOOONo^COK 
OkOkOOCtOkOCigjOOftO 



a»^c400h-ioc«t«aoioooioao 

oootookoiaowotoftaioftoiok 



oeot*©®-*,-.*^*® 






»-» •-» 






Q. 








I§2illil522l3llll222lll2l 



"S I ^ 6 1 



So 



. . 00 



JO ^ o 
'§ si's 

W S 4 H ^ 





a a a ti 

ml 




OF State Civil 



1 



I 



I 



hi 



m 



iUUUU&UUUSiiUii 



lillilllilliiiiiiiiiiiiiil 

-•-:-•■-■-••••-" = •■' S • a a" •■" s s s =■ a >■'"■=■• : 

lilllliisiiiiiiliiiiiiilil 

-•-=•-•••-•-■• - S- Ss" s" a" SSSS2S-" a-"; 

lliljllilllilllt^llllllill 



illllllllllllllllllllllilli 



iniiiiiiji 

<ii III jiiiiiiiii Uili 



flillllllllllllillllimi 
IIIIJIIJIIIIIIIIJIIIIIJII 

llilliiiifiilll) 



Classified Civil List — State Institutions 441 



8888S8888888S88S88888888888 88888888 
§§§§§§ 



0» 



t» 1^ to 















OD »-• OD S ^ 









OO S fa o 



Ml^l^ 



5Sl 



"->•-»•->►-» 






•» OT 



« 



a Q. Q. o „ 



o 

O 



aOOtQOaOw90lOtOtOtOkOk90>00)0> 






ll«5^alll 5 la^55 sill l^lll fill 







§ 



5 








442 



Rkpobt of State Civil Service Couuissioit 



as* 
6 aS 



8 • 



8 
II 



I 



I 

I 

ca 



I 



O 
H 

CO 

2 



8S888888888S8SS8S8888888 88S 



S 



8 



s 






f-«^^OC0cD<-4«'^ 



lllll^l 









§ 



^1 ^tJ| 



O Q -< -< 



3' 






t»e4e«h«h«h«roQOWooooQOooaoaoxoo»aDO(0^coqoo:« 



OkOkOtotOkOkOt9c&c&oft9o>ooe)aio>oioo9o 



9 9 









o o o r 




a 

8 



s 

£ 



SSSSM£SmSS£^£^££^'£Si£ 



3 2 3 



I 



Si 



00 







^i 






» £ O g fl j2 ^ T5 Q jj 2 S ^ fe O &* 

5i--§ aJfl ff-gS tt'S boI!« 5 



GO 



I 






•db 



O 






2 J?££SSHtJ:^ 




3 3 3 



3 



3 3 



•E-H 
33 



II 






>S66o66o6oooooooooooooooo6oo 



CuLSsiFiED Civil T-ist — State Institutions 443 



88SS 



S88S888888S8§888 



iO « r* 



GO 



e« ^ 



00 <o r« t; 

^^ »— »«« Q 

Ot O) Ok o 

r4 ^4 ^4 ^14 

•-« to o ^ 



I 



1&& 
■<ss 



GO a r* ^ 

»^ o *^ o 

O) GO Ok 0k 

^>i ^>i Vi4 ^>i 

• • • • 

•-• 1-4 O '^ 



I 



•< s s 



3 3 3 9 

a fl a S 



I 



d 



r^io^t^Gor^QOiQ^^iooaOGoeor^ 

OOOkOkObCiOflbOkOOkAObObOOk 
« I* 1^ ,-7 2' to* ^* ^ Ok ^ ^ ^' GO ^' ^ ^* 

^5 •• • •••••• 

^<00«<-<Oi80a8<2t^2:c2e3S'? 

iQiO^t^G0iC(OiO<->^iO<D«G0?0iO 
COOkOkOkOOOkOkOkOkOkOkOOkOon 

^ r^'^jS |*f**^Ok^^»H^,-I«-Joo 

S. & O^ ?& ft &« 1 & & « && ^ 



0) 

o 




444 



Rbpobt of State Civil Service Commission 



a 

i 

s 
6 



II 






a 



S 8 

g-0 




i 

m 
2 



o 



\ 
I 



8.S.8 8 S 8 S 8 S 



oeaoaor«oe«coiOe« 



'"'^82 



00 ^ ^ t^ <D 



at»> > ► ^ i > _ 



2?^ 



oer^oor^OQcoiOo 



^ W i-< 1-1 

• • • • • • *^ ^^ 



.g .g .9 .9 .9 



9 9 



o o o 

9 9 



.9 .9 
o o 

9 9 



■§•§ 

9 9 






« 

d 
«s 

Q 



a 
o 

S 

o 

"5 * 

2 6 



^1 

O ° 

5 a rt 
??>»&< 

* P5 iM 

ill 



I 



HSn'<££du 



9 5. 

^ b fi 

2 J 



«a 



e 

1 



f 



•a 

d 






iS <; £ {z: n s ^ o J 



3 $ g * 



888 



CO 






S O A 



CO r« « 

1^ O ^rf 
» Ok 0» 



•O ^ O 
f« ^ *^ 



o 



a 



flS k ^ 

••—^ Nv' ^i.' 

ace 

a a a 
111 



1 



888SS 
§§§§§ 

• • • • 
«0 i-i M ^ 



S2t:| 

S 0» O 9 



IQ ^4 ^ 



iQ 

H 
O 



o 






S S S 



« 







SS SS CO SS -4 







Classified Civil List — State Institutions 445 



S8888888888888S888SS888SSS8S 



S 



82 

•0 e« 



MCQcoeoeofOeoecraeoeocoeococoeoeoeo 



88 

C9 CO 



or««iOoetoe«iotoo 



S8 



S8 



M ^ to C9 e^ ■>$' n 

O f^ W^ W^ mi4 w^ w^ 

o Ob O Ok O) Ok ot 



•MCO^^^^iO^^Ok^^v'^N 



^ "^ "^ o 



9 

< 



a 



s^ss*^ 



N '^ « ^ •-« »^ ^ 









"2 ^ ♦i . ♦; 

2 s a t! ft 
ft ft o p s^ 



Q fa •< 



=g^ 



9 



oS<5 



-< o ^ ^ lo oo M 

O i>4 P^ *>4 ^4 «H Q 

OO A Ok Ok Ok Ot 9 



U 



Ok 

o» S 



flkOkOkOOkOkOkOkakOkOkOkOk 



^ CO oT ^ irf i-i" 



Ok o •'^ «^ 



PI M 



g g ^ « -. ^ « g 2 g -^ -" 2 2 



V kl «« 






&ii 



Z ^ »n -, ^ •-» 



9 3 « o- 








c 
o 



^ u 










5 IJl-^ ti* 
^ ^ tj - . S b ^5 









U3 









S-2 o 




0600000 



H'S'S'S'S'E'H'H'E'S 

3 3 i i § S § 3 i § 

000000000000 



Ok 



I 



to 

Ok 



11 



« 

? 



s 



446 



Repobt OF State Civil Sebvioe Cobcmissiok 



a 
o 
'9 



I 
5 






cf 



a 
« 



I 8 



2 
-X • *• 

g-8 






I 



1- i 






55 

o 

2 



888§888SSS8S88888 



o r* 



<0 (0 «0 
r* I* N 

SO 00 00 



<•• M «^ ^4 



§aoQOOcocir*oootor«r«r«aoKO 

•-• •- N M CI M « 

§(»©«oc«e«*ooooio«»^co«o©o 



|>« ^>i ^4 



f- IX O *fi ^ to ^ 

^ ^ c* c* 



CO CO CO ^ M iO 



^ CO CO 
w ^ -^ 



M 



n 






s J 



H 

n 

Q 



J 
o 

z 

L9 



d 

9 



GD 



2 



QQ 

o 
S 

Q 



4i 

00 

d 



1 

GO T 






en 

o 






OC 

J3 4< 



-is 

— d J3 -S 



«8 

CO 

.a 

o 

CO ^ 






!» 

c 



CO 



g 



I 



Si 

so 2 



« 
2 



o 

s o *: t S 



QQ 

d 
o 



i 





I 

d 

a 



d 

d 



s s. 

II 

2 .2 
QO < 



5 S. 



.24 



S. ex C 
oj d (9 



d 

I 



u o 




Classified Civil List — State Institutions 447 



§8§8 

cc 2 % S 
■^ ^ ^ c 



S§§8888S888888 
8S§^S88S8S8§88 



«• 


r^ 


r* 


QO 


§ 


ss 


^-1 
O 


v4 


•X 


>H 


m^ 


o 


*4 


« 


00 




t» 


r* 


r^ 


QO 


s 


O 


8 




«H 


^^ 


»^ 


V4 


oT 


Pi* 


«i4 


00 


N 






»H 


c 

•-> 




1 


• 

> 
o 



:?: * 

o 
JZ 
X - 

- 2 s is 

> s i s 

d u iJ z 



hi 
2 s ^ 
=s OQ j3 *^ 



a, < 



•e »S "S « 



I 



8 

a 

d 
es 



'g •? '5 6 
S S 8*3 

M H4 »i« OQ 



^» 


•o 


rj 


oo 


00 


00 


00 


00 


00 


r* 


t* 


!>• 


CO 


lO 


^^ 


^^ 


^H 


pi^ 


w^ 


>H 


vm 


.-< 


w^ 


>^ 


s 


.-< 


^4 


>H 


2 


OS 

^-1 


3J 


^4 


OS 


OS 


OS 


OS 


OS 




2 


Oft 


OS 


• 

9-4 


V4 


V 


§5 


»H 


^ 


>H 


• 


t^ 

rm 


• 
^4 


• 




w^ 




May 

Feb. 


d 

•-> 


Nov. 
Aug. 


July 
July 
July 


. 


1 


i 


1 


■ 

1 


i 


3 


•o 


^1 


oc 


22 


oc 


00 


30 


00 




i 

9-4 




^ 


M 

r^ 




OS 






» 






OS 

^4 


o 


0» 

^4 


0» 

*-4 


^^ 


OS 


w! 


w^ 


^ 


8 


t-* 


»H 


^4 


^4 




• 


00 


*-4 


Si 


00 



> M >. >» >» 



||S||333||i||| 



OS 



00 








O 

o 

o 
» 

o 
o 

H 
1^ 



CO 



O 



fit 

H 
00 

o 
■ 

M' 

3 

a 



O 

d 

I 



CO 

tS 

O 



i 

< 



1 

o 



o 



^ I 

« >iJ ^ 



> 

SI 
o 






I 
I 



i 
2 

S 






.1 



Ob ^ 



•3 

•H 

I 



448 



Repobt of State Civil Service Commission 



a 
o 

i 



-1^ 

o •» 
5 S 

4 2'^ 

p s ^ 

a 
« 



g-8 



8 •- 

-0 ^ g 



} 



1 






O 

2 



S88 



<N i-l 



CI 


^ 


e« 


^^ 


1^ 


v4 


c» 


c» 


» 


^rf 




^>i 


r* 


* 


• 


^i* 


w 


9^ 


• 

i3 


•c 




a> 


a 


o 


&<o 


a 


^ 


c« 


^4 




^i* 


a> 


a» 


0» 


^4 




^>i 




^ 


* 


t>- 


at 


m^ 


w^ 




9^ 


• 

Xi 


c 


^ 


9> 


a 


o 


fc < o 



QQ 

•5 

CO 

t — 

s : 

M . 



a e 



o 



QO 



CO ^ 

« 2 
2 'C ® 
^ ^ ^ 

4ko 



■0 

5 

aa 

a 



»4 



a 

V 

TS 

a 

c -S 
•C «^ 

GO S 9 



d " 

•8 -a 



SS8888S88SS 



GO 00 


GO 


r* 


to 


■* 


_ 


«^ 


r* 


r* 


00 


t^ »■« 


«i4 


w^ 


*-4 


*-4 


(^ 


^4 


^4 


»-t 


iH 


OS at 


0» 


at 


0» 


at 


9 


a» 


at 


o» 


at 


^H ^>i 


fi^ 


w^ 


m^ 


^>i 


^4 


*-4 


^4 


^ 


»4 


to «-« 


* 


• 
^4 


CI 




* 


iO 


• 

^4 


fi^ 


^4 


Aug. 
Nov. 
Nov. 


1 


1 


* 


• 

1 


1 

< 


t 

•^ 


• 

o 

O 


^ 

•n 


GO GO 


GO 


r* 


to 


^ 


r^ 


«^ 


« 


r^ 


00 


^-1 vm 


1^ 


^4 


*-4 


*-4 


1^ 


V4 


s 


r^ 


1^ 






at 


at 


at 


9 

^4 


^4 


^4 


« ^ 


^>i 




• 


* 

to 


»H 


•O* 


CO 


^ 


* 
^4 








CI 


c< 




t^ 


f-4 




^4 


• * * 


^ 

•^ 


3 


• 

£ 


April 
ApriJ 
Nov. 
Oct. 


1 



o 

H 

t 

& 

a. 



o 



111 

o ooo 





c 

, . a ^ -g ? 

H h t]4 5 •• 




888885 



CO t^ f* 00 I* • 

v^ Vi4 v4 Pi* *4 ff4 

at at ot o o 9 



lO (-4 9 •-« iH »4 

e« el M 

1^2-'! = 
Z "n ^ N, ^ ►, 



CO t^ r« ae t^ « 

w^ w^ w^ wm wm mi 

at at at o 9 9 



W) (-4 A f-l •i4 *H 

04 9i M 




s 



s 

SI 

o 



mill 




00 




Classified Civil List — State Institutions 449 

S888§SS8888 888388888 



CO CO v^ •-• >H 






Oi o^ o> o> Oi o> Oi Oi a 



\4 
O 
O 

« 

CO 

O 






g 



o 

•a 
? 

S 

Si 

Pk4 



as 
n 
n 

a 
m 

C 



a 
2 



iJ K 09 2 



o 
CO 



i 



o o <P 
>- >- Q 

12: z S 




e 

9 



•E 

I 
16 



^ 00 CO «-• 

• ■ 

S 08 a d ra 

5 S -« * ^ 



•>4 ^4 o o^ r>> 

PI 1-4 ^ 



dS 



•-»'-»•-» 



"» H •-» •-» 



if* • 









oOiOQoe«^Ma>>H$c4 



«i>«c4y9iooeao«ao 






o 




J4 J4 Jj 



9 QQObOi-^S'd'oO'O 

r^ M b b b h O ^ O b b b 





-? 

as 
o 

2: 



44 J4 44 ^ JM JM JM 

0Q to CQ CQ 0Q 0Q n 
X ^ X >k >t >t ^ 

K K K K ffi K K 




.0 

d 




460 



RxpoBT OF State Civil Serviob Coioassion 



I 

M 
O 

o 

n 



S3 
o 



I 



o 

g 

(» 
O 

H 



i 



1^ 



-x 



J« 



Hi 



8 « 

•111 
111 



I 



2: 



2 
o 

H 

OQ 

2 



888S8S88S8S8888888SS88888 



aoc«oeooaoaoaor«r*i-ie«r*co^ioaoooaoio<or*t^ooceao 
ooc«ooaooeooaor«r«i-4C«r*eo^iOaoaoaOiOtor*r*oeaoco 

S S 2 -< <! 2 2: 2 1 6 ^ ^>^ o £ :? -< JS ^ :z: S S S 



^ ^ .M ^ ^ .M Jri' .M ,M .M 



lllMlllllW 



I 



o 

2: 






8 



^ 



a 



fiJZJfc-*! 










^3of§Sl 



ll^jgllsllsl 



E a d § i a a I 

g g £ £ g g £ 

h (S| Pm h ^ h h 



liiiiiHIiiisI 

zzzzz?:;szzzzz2zzz 



Classified Civil List — State Institutions 451 



8S8SSSSS8SS8SSo88SSSS8SS 






3 



Hi 



^ M M 



<#<Doeooaooooe««««ooo^oeaoaoqpr«r«r*r«h>iOi-iio^ 



> *i •** ** 



u^ 



> 

o 



ctiCoZtttZi^OO 



o 



a 

9 



3 



o 

O 



JO 









m* m^ ^^ w* ^ tti to 

«-" « ^ 



<D ^ pirt 



t:S 



•a 



N »^ •i^ ^ ck 



miimmimiUmm 








_ ♦ 



J ^' ^ ^ 



Q B 



6 

00 



T 









ii 



^ 



a 



«8 






s 








c 

rs ' 

a • 

S g 

00 £ '" 



c c c a 

§ -i •§ I -s 

S^X .d ^ X 

X a o> o> o. 

d .«J ■*» «• '«J 

«» a e a a 

5 5 5 5 5 



ik 



^ ^ J< 



1 



•c 



Ik -5 -a 'S 's « « • "S -^ J< •K * ' * • 

• iiliiiiiiiii^ 

liiilllllllilllllhaii 



i 



p 

S (3 

u 



46S 



Rbpobt or Statb Civil Service Commisaion 



o 

i 

< 

O 

P 



o — 



^1 
il 



11 



111 



O 3 4) 

I* I 



m 



2 

O 



8888S8 88888888888888888SS 




h« <D 00 CO CO 00 

w^ w^ wm ^^ ^^ w^ 

Ok Ok O S> O 9 



^^ ^4 *H >rf ^ ^4 



8 



SIX CO 00 
^rf fi^ *-l 
o o> O 9 



•-• »^ TTl — • 



a3 s fe^ 



00 "^ •-» 





3 



o o 






00 


00 


00 


00 


00 


00 


00 


!>• 


r* 


00 


00 


00 


00 


00 


II 


00 e r> 


*^ 


^4 


•^ 


rM 


Pl^ 


v4 


«H 


*^ 


i-« 


f-4 


^< 


<ix4 


v4 


w^ 


*i4 


9* " 


0) 


0» 


o> 


a» 


0) 


0» 


o 


O 


o 


9 


o> 


o> 


O) 


G> 


O O 9 


•-« 


V4 


«i4 


>H 


^4 


r^ 


^4 


^>i 


*-4 


^4 


V4 


•-« 


Pl^ 


»H 


^•* r* 


i^ 


wm r» 


• 


a» 


fi^ 


^^ 


^4 


• 


>H 


>H 


• 

to 


8 


r* 


«-4 


* 


•o 


-^8 


* 


p- «- 




«i4 














*-4 


«^ 




« 


N 


*i4 




Sept. 
Feb. 


3 


Feb. 
Aug. 
Oct. 


< 


1 


•1 


O 


e 

3 

•-9 


o ?: o Q'< 


• 


il 


00 


oo 


^-1 


m 


00 


«i4 


!>. 


o 


^ 


in 


oc 


M 


» 


« 


•* o 


00 


a r* 


>H 


r^ 


r^ 


J? 


■>■« 


Pl^ 


s 


^i* 


•^ 


vm 


^4 


^1^ 


^4 


1-< 


8 8 


^4 




a» 


a 


oa 


* 


a» 


c» 


0» 


0» 


a 


o 


© 


05 


(51 


a 


S o 


^^ 


^i* 


>H 


>H 


m* 


»H 


^4 


w^ 


1.H 


vm 


>H 


•^ 


>H 


p^ 


^4 ^ 


^ 


•N K 


wm 


a» 


CO 


• 

CD 


f 


M3 


M 


• 

CO 


s' 


* 


00 


• 


«" 


• 


• * 


• 

X 


•N 1- 




v4 




»^ 


N 


>H 


C^ 


M 






CI 


(M 


CSI 


P4 




c. 


* 

£ 


April 
Nov. 
April 




o. 

< 


•n 


• 

a 

•• 


1" 




• 


Nov. 
Oct. 
Deo. 
July 




0^ 



V 0) « 

I E S 



U pSB'S'SisiiSgSSgggll 



a 
a 

o 
2; 






o 



c5 



I 8 



Ji 


















a 






61 



II 



3|lj| 



8 Si « a'g^i i ie| 



^ 



lU 



« 



Q? 



2::2:^2:S!:2:2:S52:5?::2:z2::2: 




Classified Civil List — State Institutions 



453 



S888888S88S888888888S8 



8<<r<^<<fS§S8S 












v^ ^ t>, pi^ ^4 ^4 



► >. >. C *c 

35 H, t-j ■< 



^III^psIi^I Hill lis 



oxQO>oiotoiooC3C^ao>4cicp«(oap'OaofOaoto 

• •■••■••■••■•■•••a* ■•• 

• •••••••■•••••••••■••• 

• •*•*••• ••••••••••■••• 

*■••*••'••••••■••■•••■ 

BBSaBBBBSBBBBBBBBBcBSB 





s a 




5 



S S a 8 -5 
Ui h o n a< 






^ 04 04 X X H 



e 

9 

:1 
C 

B 



I 



464 



Rkpobt of State Civii. Service Comuission 



III 



III 




2: 

o 

t 

CO 

2 



// 



8S8S 
S88 









GO •"• c« o 






to 

0» 



** 1- « O 

>% ■ . 

,) .^ 4« 4« 

5<S<S<5 



■ 



.9 

fc 

o 

5? 



2 
•g 



{^ S (2 £ s 

X 

M 
M 



P3 



I, 
Of >* 

o ^ iK 



£ 



> > > 



l£(2cS 



e 



«8 



ill 
Oil 



S88888S8SS8888S888 

§§iii§§ 



'••eoe^N^^t^^r-i^i* 



M i-i ^ 






iiii jiiliiilJimiJiii 






•- "O ^ «e 



9 <-• M 0» lO ^> pi< 



^ri f-4 v« M ^^ 









o 



ggga0eacCd^og0g-^ege 



S t t 

^ua >t >> >> 



H 

■1 



& 

3 



43 



Q f*« ^ 



J 



us 









a 
a 
« 



all 



« s a .§ ^ 



e| Si 




i "^ 1 1 1 

^ oQ n n 




Classified Civil List — Statb Institutions 465 



88SS88888888S888SS8S8S 

§ii§§§§g§§§§§i§i§§§§ii 



888888888 

^§§ii§ii 



e«c«^a^«i-ir*oc«cooee«io«Qor«r«r«r«r« 



^ Cf> 0m ta ^ 



M 



as 



l^lOp4Vi4^^M^^^r^p4«-4^ 



04 



iliiiiiiiiiijjiimiij 

e«M^a^ao^r*oe«cooeeoiooooO(pooeo«i^ 

iliiiiiiiiiiiiiiiiijli 








t^<OMqpQr*r«tooo 
^ ol « e« ^ w 

• •*••» _^ • • 
^ ^ ei e« ^ €« c« 

Ijjjillgl 

iiiiiiili 







s 



s s < S 



I 



s 



Hill, 



JiU 



^•il 



r OF State Civil 



!i 



I 



lil 



IT 



li§iliSSgSliiiil 



iiiiiiiiiliiiiii 

.• _- _- .• _• _• 5 2 J _- 5 g- _■ _• .• -■ 

iiiiiiiiiliiiiii 



:|l 



:i; 



jilii • iiiiiiiil ii 

Ilii'liiCilij 

!':fliil &m m 



M 



m 



a 



Classified Civil List — State Institutions 457 



S88S8g888SS8 



8888888888888888888888 

gf% ^f% ft^^ ^^H ft^B. ^?% ^^M ft^B, ^r% ^^M ^7% flv^ ^9% ^P^ ^V^ ^Vk ^Vk JVh 3r 



O 



ic to f) N> N> r« N> 

V.4 1.H <-! ^4 1.H f-4 *-4 

Ok 9 Ok 0) Ot Ok Ot 

vH 1.H ^>i V.4 ^4 f>4 *-4 


00 00 r« r« r« 

f-4 *>4 V4 ^4 ^4 

Ok Ok Ok Ok Ot 

W^ ^^ p^ w^ W^ 


Sept. 1, 
Sept. 1, 
Sept. 1, 
Sept. 1 
Sept. 1 
Sept. 1 
July 1, 


Jan. 12 
Sept. 1 
Sept. 1 
Oot. 8, 
Oot. 26 


iQ ic to r« r<« t^ CI 

w^ v' *H r^ «i4 r^ ^4 

Ok Ot 9 Ok Ok O Ok 


« 00 t- r* r* 

^4 *-l iX Q '^ 

Ok Ok Ok Ok Ok 




Sept. 1, 
Sept. 1 
Sept. 1, 
Sept. 1 
Sept. 1 
Sept. 1 
Oot. 7 


Jan. 12 
Sept. 1 
Sept. 1 
Aug. 15 
Oct. 26 



»ociaOQor««DeoQOi^^(Dr*ci(D(DXaooeooooM)M 

OOOAOk^OOOkOkOkOkOkOkOkOkOkOkOkOkOkOkOk 



<-< C*J »0 »H «^ »H iM 



cira ,mcI<-i 1-4 o C4C1 



o»»^r^oot^r^eo«t» 
t^ f^ w^ w^ w^ a ~ 

X O Ok Ok Ok 9 



.. «r«r«<Dco»i4(D<Daoaor«ooooioo 

000k99000k0k90k0k000k0k0k0k0k0k0k0k0k 

«oo«9»Hisr,-«tJ'^odcoi-4Krio 

^ d CI i-i C< C4 CI 



«-" CI ^ oi 



. — '.^ .-^ ^"^ w ^ v^ v^ 



I 



a o S* t & «3 




O S OO OD 00 S 





III d| (J S3 b 

ssslllls 



§ 
'C 

a 

«s 

e 

V Q 

1 

|1 

HA 



i 



d 



GO 

•go 

(3 

m 



X 

■*» 
■i-g 
J S 

? I 
OS « 

■§1 



i« I* 



•a 









J4 






ill ill 
liiiil 



o o 



SSS'^ 




468 



Bbpobt of Statx Onm. Sxbviok Coioassion 



I 





s 



« o « 



I 



I 



I 



z 
o 



88888888 

§ig§s§§§ 



^^iai^o^"^. 



z^ 



8 r * ^ o < 






888 
§§§ 

• ■> • 

'^i « m 




»« >e 

^ *4 «N 

01 o» o 



»-> (B 



I 



e »« o 

*4 *4 p4 

a» o» o 

^4 *4 P4 

* • » 
*i4 v^ 01 

III 



I 




s 




a a a 
' o 




' B S :s ^ a 

• S *» *» *> s 

IJJi 



I 

c 



S 




Ci.A8sinBD Civil. List — Statb Institutions 



459 



88888S88SSSSSS888S8 



8888888888888 

§g§gggg§§§i§§ 



oom«o<Daoe«aoi^c9aoaoaoaoaoaoooi^r«e« 



i«ioi«ooooooi^aoi«aoi^t«o» 



M ^ lO 

pm eo ^ 



iiiiiil^iii^jlliili 



ao«a«o<oaoe«aoi«c9aoooaoaoaoaoooi^r«>e« 



^ ^ J. 2 -^ - - a - •- - 2 S5 



lll lllljlllll 

«OiOi^ooooao<DaoiOaoi^t«ao 






iiiiiililiiiifliili i^liilliiiil: 








Hill** 



» 

;b4 



M 



« oQ 00 n a 




1 



:9 :3 :3 :3 :? j J J 3 J :9 :9 :3 



o 






1lii|-s 



I 



> 

3 

a: 



460 



Bbpobt of State Civil Sebvics Commission 






H 

< 

> 

e 

o 






a 

o 

a 

I 

o 
O 



a 

11? 


Date of 

entrauce iuto 

civil nervice 



i § « 




o 






8 8 8 S § 8 8 8 8 S 8 8 8 8 8 8 8 8 8 8 8 <?<?<? <?o 



S§8|g8S8S8 



§§ 









O>*^*^^4iOC0^4<^ 



N 



^ r^ »* «o »- 



2-8 



^QQ^,imCOI^C«'^^eC*^ 






»• "3 O O O 






ao»»iOioior«i^^r^e«i>.icaoeoic«e««oicach>ooaoat>accc 



g^n. ^4f»^4r«»4ri4^^4t«0<D«« 



M 



C4 



o <o «« Q r^ *Q 



«i«0»(OI^C4^«-4CO<-* 






I 



• S •»• •«< 'iq Ss '^ •*9 'Q ••' ••^ •>• ••• ••• •>« ••« ••" •*9 A *•" V •»« •«• •«■ 'M 'M ••" 




la S 










a 

a u 



c 



«t ii 8 

h fc h 



il 



d 

s 



a 



c 

£ 



e 

£ 



c c 

£ a 



a 
p 



§ 



B 
O 



c c 





E 



e 



g 



e 
c 
«» 

< 






Classified Civil List — State Institutions 



461 



88888888 888888 



8| 



8S 

o »« 



M *4 *4 vi4 r4 






§1 



88888 
8SSS§ 

S ^ r« 1^ lo 



< 

H 

CO 

> 



Q 

O 
hi 

Q 
Q 



Gu 

o 



CO 

O 









00 00 <o »-o 00 00 

w4 w4 w* ^* ^* tf^ 

O 0> Ok 9 0> O 

^4 ^4 ^4 ^H t-4 «^ 


July 1 
July 1 
April 1 
Dec. 1 
Jan. 1. 
July 1. 
Dec. 1, 
Mar. 5, 


Sept. 1 
Sept. 1 
Aug. 1, 
June 1 
Dec. 1 
Nov. 1 


Jan. 17.1911 
July 6. 1907 
April 1.1916 
Deo. 1. 1918 
May 24. 1909 
Jan. 1. 1907 
Deo. 1. 1901 
Sept. 1,1914 


00 00 (D CO 00 00 

^14 IM t^ ^4 ^4 Vi4 

9 9 

^4 ^4 IM v^ «H *4 

•»* ♦* ki > tJ > 



o 

J 






s 

OQ 



OQ 



5 



«8 



^^ISI!£ 






o 
8 



2 



& 

> 






> 






< 
I 



•« •• -v «» 4» ^^ 3 



^ ^ ^ > 

fill 



n s tn 






8 S 8 8 8 




d 
4W 






3 



09 

M 
C 

t 






9 



a 
o 

6 



Hi 

s <• 1? 

® « i« 
#S: A E£} 




5 

II 

mil 









o 



•^ 00 00 00 M 

^4 ^4 Vi4 ^4 9^4 

O O O O fli 

^ *4 ^4 ^4 *i4 

M •-• lO ^ ^ 



St; 

< o 






^ 00 00 C4 M 

^4 ^4 .-4 ^4 ^4 

o o o o o 

*i4 r4 *i4 .-4 ^4 

eg !-• MD ^ ^ 



!i ^ ^ ^ ^ 

^ ^ ** "^ 

S s S « « 

> > ► > ► 

£ £ tS B n 



a 



d 



■e o O c ^ 
:3 -^ r^ -« I 






if 



1^ 



e 

c 
hi 

0} 



d 
B 

3 
u 
'*« 

J 

d 



11 



u 
c 
d 
o 



c 



462 



RspoBT OT Statx Civil Sbrviox Comossioii 






I 



I 



If 




to 

i 

o 

Q 



O 




o 
o 

i 

CO 

O 
U 



S5 
O 



S888888SSS88S8S8 



^-aoaot«ooaor«•<OiOiO<4•ooaoaoaoao 



llllllllllllll^ 



9 

-< 



i«ooaoi^aoooi«<DiOiO«iiooooaoaoao 






iJlii 



iiliiii 






1^ 



gs|sss§ses§ssse 

c « « « « « «^jb1 Jj8 c c « 






I 

«? 

as 

o 

55 



£ 

o 

S 

sis 



1 



I 






■I* ■ 



•a'?|l&sijlijw«J| 



S o 



1 



2 



« 



i 



zzazzzzzziiZiczzz 



Olassifibd Oivn- List — Countxeb 



468 



CO 



O 

o 






I 




O 



o 



8 



S 



i 






I 

- i 3 

5 " (5 






or 



8SS 
§§§ 



CI 



ss 



iO Vi4 ^ 



I 



ill 



lO ^ Vi4 

III 



8 



I 

00 



1 



I 

i 

I 

3 



si 






ill 



S8888888S 

§§§ii§i§§ 



S8SSSS8S8 

a»9oia»c»oo»c»9 



fli O 01 9 01 Ok Ot Ol A Ok A 



i^iOeoA^v^oi^iO 



1^ MS CO ft 



llllllllj 









i 

o 

III 



I 





d a 



Hilt 



464 



Kbpost of Stats Civil Sxbviob Commibsion 



I 



•3-S 



S-S 



M| 



a 

9 



^ 8 



o ^ a 
Jl| 



S5 
O 



S888S 




S 
I 



S 8 
i I 



S 



888 



00 GC !«• 00 CO 

^^ ^H ^- ^^ ^- 

A O Oi OS 0> 

*H «^ ^^ «^ *« 

»o 1-* t— ^ r* 

00 00 fo 00 fO 

«i4 ^4 vrt ^4 vrf 

O) A O O O) 

^4 vM vrt «i4 vrt 

lO PN »* iM hJ 






a 



155 






I 







a 



a 
« 
Xi 



■3 

1 

O 

Q 

s 






a 
4? 






a 



H 



o 






09 



3 
o 

9 



03 
O 

o 
p^ 

o 

03 

3 

o 



e - 
? i 

s J 



00 



9 



00 



9 
•-» 

a 
« 
jo 



5 

•X3 

a 
4 



a 



O iO QC 

t>4 O ^« 

Ob O Oi 

»^ ^i^ »^ 

•- ,-* o 



Cb oS c 



O O 00 

t^ o »* 
o» S a 

• » • 

^ ^ c 



d 



el 



•J 

u 






us 



J 



o 
B 

8 iM 

03 5 
H 

g 

O 



g 

o 



O 
I 



« tf « 



o o 




0) 

e 
o 

.3 

B 



c 
S 
.9 

J 





8 

a 



& 


OQ 




Classified Civii- List — Counties 



465 



8S888 



I 



8 

CI 



I 



ooddbooSoo V « 9 

8 8 Oi S hi t; b 
& & & 



o 
o 



o 



(D <D «0 
^< « N 



§ 



S 



00 


00 


o 


lO 


•o 


^■4 


w^ 


*4 


9^ 


o 


a» 


a 


o» 


9 


Oft 


•>« 


•H 


*4 


»^ 


1-4 


to 


«i4 


• 


l; 


• 
Vi4 


d 


>l 


• 


o 
a 


-** 

a 


•-a 


3 


:? 


9 


£ 


00 


00 


(D 


lO 


•O 


r^ 


»ii< 


«M 


*4 


o 


o: 


o 


e» 


a» 


d» 


»^ 


^4 


^•4 


*H 


*i4 




^4 


^ 


• 


^ 








N 




e 


>» 

"" 


i 


o 
a 


• 


eS 




i 


3 

•-> 


s 



e 
<s 









i 



11 



« 3-S 






a 






a 
m 



d 



<D 


00 


lO 


00 


M 


» 


«« 


■O 


^i* 


«rt* 


<M 


lO 


«o 


O 


^4 




^4 

^4 


O 


88 




8 




Ci 


*4 
o 

^4 




• 

•0 




• 

Vi4 


lO 


• 
^4 


(D 


* 

«i4 


^ 


mi 


^4 


^4 


00 


• 

•-4 


w^ 


vH 








«4 












•-4 




• 

1 




May 

Deo. 


• 


o 


3 


d 


1 


e 

o 


d 


d 


< 




00 


^ 


00 

«i4 


n 


■mm 
O 




s 


■mm 

s 


•f 
o 




«i4 




00 






OS 




9 

v4 








OS 


•-4 


1^ 


* 

9^ 


• 

^4 


• 


•o 


^4 


• 


-" 


wi 




^4 


wi 


00 

^4 


m 
^4 




^ 

3 

•^ 




a 

c* 


a 

-< 




6 
el 


Dm. 
Oct. 


■ 

a 
a 


s 


< 



on 

8 



9 



00 






to 

00 



s 



^o 



8 C4 « 



IT 

a 

g c ^ oo a 
•€ I &=*' < I 
sKgOS 




s 







1 i 



3 




o 

a- 








5tl 



466 



RiFOBT o? Statb Civil Sebvicb Coioassion 



I 



9$ 

* 8 * 



^1 



y^ i 
i|.g 



I 



91; 
o 



2 



8 



s 



s 



IJ 



I 



I 

i 

O 



o 
o 



I 

N 



§ 



I 



8 w flD w 



^ 10 00 <D 
w4 w^ m^ r"^ 

c» 01 c» c» 



• * * * 

9^99 

•^ »^ "^ "^ 

^ 10 00 o 

^ vH *^ *4 

01 01 a» c» 



•^ "^ "^ "^ 



I 

OQ 

I 

H 

SI 









i 



Is 



Im (k( fa fa O 



8 



<D K <D Md ^ 

^4 ^ «i^ *4 ^4 

01 Ok Ok Ok Ck 



• • • • ff 

9 8 S Sd 



<0 K <0 U3 ^ 

,i^ «4 VN vN Vi4 

Ot Oi Ok Ok Ok 



99988 

•^ •n •-> "n •-» 



i 

5 






i| 



^ 



§ ^ 

s ■ 

o : 



I 

5 



j^^ 



vH 00 



OD a 

eg 



-Ed 



-I III 



1 



a a Q a 
•3 •§ -8 S 

11 SI 

• • • • 

J 6 b fc 

9 s @ a 



888 
§§§ 

• • • 

CO M P4 



J 



O M 10 

1*4 p4 O 

» o» 8 

1*4 *i4 *4 



Ok o» Ok 8 

^4 ^4 v4 ^4 



J 






S8- 

Hi 



III 



til Jl^^ 

^ a »^ H 5" to ^ 



a 



o s 







Clabsivibd Civn. List — Coinmxs 



407 



88 



8S88 888 



8 



888 



8888888 
§§§§§ 



i 



SI 

• * 

9.A 



m • 



II 

5 Sg 



a ^8 



5 



ft 



o 



I 



*^ Ok Ok 06 

Vi4 v4 ^ *4 

9 Ok Ot Ok 



9 a a a 
< >n •-» •-> 



^ Ok o> oa 

^< 1-4 ^^ »-« 

fli Ok O Ok 

9^ ¥^ W^ m^ 

* » • » 

e vH Vi4 vi4 



[» 







^ft £4 



2 2 2 

J .a .s 

B 6 S 

^ a I a 
6666 



a 

M 



^ e« iO 

9^ w^ w* 

O Ok Ok 

W *4 ^4 



i 



H 



^ M U) 



III 



H 



I 



^ 







5 
5 



tZ3 



J 



a ^ 

Id 



Ok 

Vi4 
Ok 



s 



Ok 

Vi4 

Ok 



I 



a 

o 



00 i 



D 



III 1 



a 



o 
a 






lO g c» 

s s s 

*i4 Vi4 tM 



ii 



a 



• • " 



J 2 1 



-8 
S 






i 

I 



"8 S-5 

l-s 






du 6 

«£ •S .3 

m 



il-iiiii 



m^ w* ^^ r^ ^^ m^ p^ m^ r^ w^ 



J- 

111 











ilfiii 

ttiiiii 



468 



Repoet of State Civil Seevice Couhibbion 



Date of 

entrance into 

present position 


Date of 

entrance into 

civil service 



"«5 

s 

e 

T 

H 

t) 
O 

o 

< 





z; 
o 



888888888888888 



8888 



M e4 



w 



04 O 



8§^ 



c« ou <o 






3iQr^aicic«OGDr«r«o^oo 



s- 



o *-» 



« N e» i-« «-^ 

(go *S ^ < * 



§• 5. § 111 



8 



8-^ 
oS 



O050>O0k9C:0)0k0>a00kCi 



Illlllll^5.ga2 







a9 

O fc _ 

a s-s 



§ 

at 



• »: 3 • r^ ^ is S • 

a I ^ S :S ^ 1 ;§ : 

rt « s ^: ^, ^ 1 - ^ 



s 

o 



1 ? i 1 1 e s 8 s 



•JT 3 O C 

^ -< eel fo 



3 

o 

eS 

a 



a 
a 

3 

Q 

« 

^^ 



c 




8 8 8 8 8 <?o° 



e» ro o o c< r« « 

rH a^ Vi4 -H WH «i4 ffri 

O O Ok Ok Oft Ok O) 

f^ f^ Vi4 ^4 1^ *4 »irf 

^4 v« *ii4 iO (^ *o v^ 



e 
ee 



c -S -a 

•^ &< "^ 



S Oh 



^ ,F^ fit w-t ^^ r^ ^-4 m^ 

A OftOkOOkOkOOk 



e 



d ^ 



3 



SoiS 



M 

fc 2 

B CO 

s - 






1 

3 



« 
o 



il 
<< 

a . 

St; 



i'S 



o 

2 



e 

■ 

g 

00 

s 

■ 

§ 

a 



o 

is 



us 
l-al 

*0 fi o 



. c • "S 

|as s 

is a c X 

r3 J3 X .S 
;> o o Ng 
»> -» "^ i« 



I 









a a 



II 



tijujU:uizzSSS 




e 

E 

>» 

*» 

•A 

9 



^ -at 
«5 



s 



li^'lfj 



CI.AS8IFIXD Civil List — Countieb 



888 



88 



§8888 
8888S 



8 



88 



469 

888 



eo •^ »H 



fl^^w* 



w ^ 



CM rH iM 



»0 CO 



or X 

o c 



o r« 00 o 
c c ^ -< 
a a» aa o 









•O CD >0 
O f-i »* 
0)0 



"^ O 00 



ceo, 
rt d a» 



ci cj 



M O *^ ^^ *^ 



OS c a a a 

*:; ei « 4 at 



e 



0fi Q 



^< I*. 1-* 



*^ 2 o 



OC iO x> 
r^ C »^ 
e» o o 



•^ O 00 



or X 

« CO 



SI": r^ « r- 

.. c: (^ -H "^ 

c s. o 9 a 

•-■ f—f ^4 fM fM 



a a a e s 
•^ c: «s c0 fls 
••ft »-> *^ •-> •-> 



A 



* 

s 



o S 



& 



?l III 



•C CO CO 

§ o S 

•-• ^* »N 

^ ^ cS 



i 



« s -< 



M t 




a 
1 



if 
> 



.2 

91 

K 
H 



^ a 

S N 



.2 



c 



o 

C 3 

C no 

01 ^ 

^ s 





>. 

c 

ea 




I 



1 1. 



s 



s 



^ CQ 

.2 8 
e »^ 

C) es 

CO 



QQ 



If 



•2 






J4 

b 

a 



III 



66 



a § 5 
cr. Tii V* 



470 



RxpoBT OF State Civil Sxbyios Commission 



a 

el 



g-8 



8 



S8 8 



8 



88 



00 



00 

a* 



I 



8 ^ 

S|.s 






2: 

o 

OQ 



8 

s s 



fe 
p 



CO M 



s s 

11 



S o 

11 



\ 



I 



^1 



^ CO 

O g "5 

a 

•so 

°s & 



s. 



J 

e 
at 



a3 






J3 



I" 

£ 






s 



i 

:5 






o 



S9 



>4 



< 

M 

is 



X 
D 



O 



& 



i 



O 



I I 



a 

(a 

a 



o 
a 
o 

s 

§ 

B 
6 



eo e» 



CO CO 



CO CO 

at a» 

II 



do 

is: 

ill 
g l5 



-r w 



d 

o 



I 



n 






'I 



ci ci ^ 



^ CO <« 

9^ W^ '^ 

0)0 



^ 



c 



■o oo lO 



si 



•4 r-* 



o 

n 



< 

a 

o 






8^ 



id 



I 5 s 

5 « *• 



II 

I 






Classified Oivii* List — Oouisties 



471 



8888 
SS8S 



8 88 888:S;i;S 

• • • • • * ^^ ^L ^L 

s s s 

III 

IQ lO lO 



s 



88S8888 



eo CO 00 M CI M 



-* 


CO 


CO 


^ 


*i4 


Vi4 


w* 


•^ 


c» 


o 


a* 


Ol 


«^ 


Vi4 


w^ 




^ 




«r 


• 






w^ 


w^ 


|s 


i 


• 


^ 


to 


CO 


^ 


w^ 




Vi4 

Ok 


a 



0» •^* <tf M 

mi 



i 



"8 









a 8 8 € 

5 -s S -5 

• o o 2 

• a e c 

t "n t^ i^ 



00 



! 



00 00 

si Si 

00 00 



00 00 00 00 00 00 

*M *4 r4 *M *« ^4 

0> 06 Ok Ok o> 0> 

Vi4 Vi4 Vi4 ^4 ^4 IM 

lO (D <0 h^ h^ h^ 

^4 vH ^4 

^ 00 00 00 00 00 

w^ wM m^ r^ f^ w^ 

Ok 06 Ok Ok Ok Ok 



IQ <D <D K K K 



7m ***** 




^ d g : 

•ij -2 J -^ es • 
o C V .d C r 

o a H (8q S 



6 

a 




4) 

C 



s s s 

8 8 8 

5S5 



9 «< 
p. & 

9 
OQ 



£ 







00 

06 



I 



I 



I" 

00 ^ 

e 






I 



I 



•S 



6 



00 00 ^ 

Vi4 »i4 *i4 

Ok Ok Ck 



^ ^ 00 CO 

9^ w^ r^ r^ 

Ok Ok Ok Ok 



« CD •- »-< ^ •-• O 

00 00 ^ ^ ^ 00 CO 

Ok Ok Ok 06 Ok 06 06 

n CO ^ *^ ^ »^ e 



mi 






3 

t: 






472 



RspoBT OF State Civil Sebvice Commission 



O 

g 

o 
n 



S. 
s 

o 
O 



a 
o e 

••it: 



d 



I s 

III 

d '8 




2:: 



o 

CO 

2 



§§8 83S8SS§8S§S8SS888888 



O M M 



1^ oo oo 

w^ w^ ^^ 

o o o 



«0 ic c: 

c -5 c 

08 « a« 

•-: C«« "-» 



h. « 00 

*^ T^ ^4 

oa o o 



«D lo aa 






c 






•5 



GO 
CO 



M 

C 

£ 

OQ 

> 
< 



M 

C 

£ 

09 



CO 



I 3 M K H 



CO o> 






O 



=* OS 



fc ^ 



at 
Ir 












g o o o g g 
CO to o lo r« v^ 






CO M 



M 



M 



^ ^-.i ic>o<-*^« «c«d»-«^«^ •-<"o»c>»-' «oie^»^»^ 

— — CO — w i« ei 

V«-4^ Q<-^c>f»-4tc<-7co<-^o^*-«orioV<-<<^o* 

c ^ jD 1 ^- > ^ > .d if » i § ^' ^* c ^ a * i 
^fe(i4c^O<Sb.;z;^S-<S^££4£aBS(i 

«^55^. :^.^ ^g J^^ rJai2^Jg^• 
-c^||^i|l|:slf!j|1§il 

aP^OeC0^OQi0»0C0OC0S<4<-4l0M3C 

ci9CQ"r«*^iMtMcpcoa>u3(Qeo*4<^ioie*«^ 




flS 



i 



d 
o 



•2 



hi 



a 



■s 

d 
t 



ft* 

jd ^ "o .« 

"^ "^ -c J: 



^ ^ ^ 

b k b 

Jg ^ JU 

"0*00 






^j.»:^.g: d"2 « 

55 S S c 
D Q O O 



g fi g 

0; 0) « 

d d d 

«) V «) 

000 



S Si 



"S 

•2 fe 

J " 
.9 ^ 

d 
d 



^J 



_ .5 d -5 w I 6 



Classified Civil List — Counties 



473 



§8 88S8 8888^<S'o® 



SS 



8 

CO 



s 



8 



o o o 

00 00 ob 



8 



§ 


8888888888 




||S|||S8SS 


en 


*H70C4*HM.H*H*H.HM 



co«Daoao-fco^io<o«oooooao 



^ C4 CO « CI M '^ 



III 



o e 00 ^ 

^^ »iN ^H ^i^ 

Ok 06 Oi o 



^^iO(D«OQ0000O 

a>eio»ooa>oo 









<li 



a. 






0) 

a 
a 




*^ c 

II 







^ 






1 



a 



a 







s 



B 5 8 
Wag 

c si 



8 i 



5 

X 

6 



.9 
9 



CO 



00 






M 

a 

< 

6 CO 

a 

M 






JO 

8 

c8 



•a 

3 



I 






^'••i«oO"i«^r»ooo^ 

0>000)0)00b00)0> 
OiOkOkObAOOtOtStOk 

• • a • • * ' 

b >; >-> ^ ^. >: 

>i ^- 2i 55 >*' S^^ 55 

^ _• ;S -ti ^ S ;S 

. S °° « - 5 « 

^ j3 S2 « ^ •« 5 
fl ra '^ "^ a 9- '^ 
« C ^ ^ o S- «• 

p « a w 3 !: ^ 

ees •■ f^i ^ MA «^ iw 



?« 



^ 



« o r» 

St* lO 




"■N •— ^ M 



.a 
>* 

a. 



I 



1 



u 

« 

jca 

a 

OS 






^. 



^^^ 



4 49 13 



G e 
^ SS H S S S-^ 

« OS CS «l «0 .S >^ 






474 Report of State Civil SBRyiOB CoMiassioir 






i 



2 
o 



8 



i 



3 



s 






888888S 



•O lO ^ ^ CO CO CO 



8888888S88888S 



e« eo eo M 



Jan. 1. 1914 
Jan. 1, 1914 
May 13. 1918 
May 15. 1918 
Nov. 25, 1918 
May 15. 1918 
May 16. 1918 


Jan. 1. 1919 
Jan. 18.1916 
Jan. 1. 1914 
Jan. 1. 1916 
Jan. 1. 1914 
Feb. 13. 1918 
June 15. 1914 
May 20. 1918 
Jan. 1. 1914 
Sept. 10. 1915 
Feb. 9. 1916 
Jan. 1. 1917 
Feb. 0. 1018 
Feb. 2. 1014 



^ »•• 00 ^ 00 1^ ^ 

vM r>4 ^4 *H v^ rH ^^ 

9 Oft Oft Oft Oft O) Oft 



«i4 kh eo »4 tfi kh Oft 



eo ^ to 

•H ^ c5 



s 



i ^ 0b u* 



o c^ 



S £ :g ^ -* 




aft«ii^io^ao^ao«««r^oc^ 
Oft^oftOftOftOftOftOftOftaftoaooa 



^ ,H ^ f^ i% ^ 



O M 



MC «-^ 






&^ >? b tb 






666 







P 96 § (^ fi ^ 



ja 






c35 6 



I|r3i 






a 



3-^ 






^slaiese 




a> 

c 









Olassifixd Civil List — CounnxB 



475 



S8888|S88S8 

* • • * • ^* ■ • • * * 

e 



SSSS8 
§§§ 



s 

h- 



S 



888S88S8S 

5 S m t« 



^eosoMMMMei^ 



1916 
1916 


00 <« <D -^ -^i 00 ^ 

S o» Ol tt o» fl» c» 




|3 


Feb. 9 
Jan. 33, 
Jan. 7, 
Jan. 15, 
Jan. 1, 
Feb. 9 
Jttne 15, 


Jan. 18 
April 6, 


.1916 
.1916 


«•• <« CO -^i «fi 00 « 
0» Ol Ol O Ok c» S 


.1916 
.1914 



a»e)(oco^-lO•HC»•ooe 
f^ ^4 M d <^ v4 (M 





4* t 



5 'S o 

2 8o 



1^ 



^ AuiAA^ao^ 





QO -^ »* »•• * 

«4 «4 .^ (M w4 

A 9 Ck Ok Ok 



O Ok •-• -H CO 

•-I eo 1^ 



m 






« -* »* 

*H ^4 *H 

oi o> Ok 



CO O ^ ^ so 
^ -< CO el 



oo 





3 



m 

z 

t 

< 

8 I 

ac h 

M < 

In 

M 

s 

:! 

o 

X 



£ 



S 



90kOkOkOkOkOkOkOk 
•MMpH*^coe4«^.iiro 



*i4 



^00«00<4it«^^<D 
OkOkOkOOkOkOOkOk 

3|agi|as| 




g g '^ o -H 



3** «• .a n 

ills 











476 



Kepobt of State Civil Sebvice Commission 



O 
o 



O 
Pi 



a 
o 

• mm 

i 

I 

6 



o 


§ 




•5 


o "2 


C 


s 5 


c. 


eS 5 


■4» 


a 


a 


• 


^ 




a 




s 


•o- 


•s: 


Date 
trance 


8 


B 


c 


• 





8S8SSSS8S88885388888888S 



•8 s I 
55 1 -2 




s 

o 

M 
> 



o>o>9ooakao9at900>o>oooaftoaiokotokOO 

d d d ^ ^ g4 d^ i a d ^±>^'d'«J^l l^^^SIf 
U •• .-. Q^ . , . • 

S r :S,- ^ r 2i 25 ^.^ >: 55 ^ 2i : SS . ^ ^^ »! 2:> ^ 2 
— CM — t««»5fi''5©:iS5o««^c<?5fSSS55S 




d 

« 

6 



II 



c 5 

g ; ^ H « ^^ 



6 

^ 



II 



ft 



c 



1§J 

-^ a! O 



III 






SO 



d 



as 

M 

« 

s 



•S 8 



^ C «M «M •*. 

1. s « O & 



•^ S) 

s s 

a* mm 









66 



a J. 

" o 

S ^ 

el o 



'3 Ti 



;m S "^ •i' -M 
§ I & b & 



M M 



CO 



aa 



- - It*- 



ccec 



Classxitied Civil List — Couktiss 



477 



o o o o o o o 
^i«i^^^^eoel^*^'^^eonc09 S Z S S E S So 



lO 



5 5 5 3^5 

d d d g a d 

8 8 8 8 S S 

lO >0 lO >0 >0 lO 



888 



8 






00 

o 



•H V4 vH vH Oi iA C4 



;o«D«o^fH«eo^^^«-ici<-'e>i'^coo 






•gil 

b S •< 



^ 

s 



OOIOOCSOO>0}0>00>Q&C> 



o> « 



^ »* 



li-t 

•^ •-• •-» 



0000900) OOO 



s 

00 

o» 



•-« 00 -H K^ 



a>iAc>4oe(Oco>HOco 



M CO »-• «-• 



to o 






^ *4 






•H »* 



•^9 9 



s 




-S! 

s ^ t^ ^4 ^ 




•8 
n 

o 



S 

M 
O 

d 

& 

C «l 



> 



MMMMMMM^JitAt 



ooddoQcdoSOooooo 




Q 






-I 



9 
CQ 



an 
b 

s 






478 



RsFOBT or Statb Civil Seuvice Comuissiox 





8S88S8 



M e« 



00 « o « ^ ^ 

r.4 ^i« v« ^4 *H firt 

Ck Ol Ck Ot Ok Ot 

*H ^4 ^4 ^4 ^4 ^4 

«H M fM Ok 0» Ol 



8 «. 



I 

3 



2 

O 



Jan. 
Jan. 


Jan. 
Nov. 
Nov 
iVov 


1918 
1914 


o» ^ ^ -* 

W^ ^^ f^ ^^ 

o» c» c» e» 

^4 V« ^4 *M 


^•« 


« * * » 

•-4 c» e» e» 


Jan. 
Jan. 


Jan. 
Nov. 
Nov. 
Nov. 


• ■ 


: :o : 



• • 

OQ 00 
IS 



^' r^ ^ ^ 
:SK5 . 







a -o 



fill 



88888888888888888 
!§§§§§§§§§§ 



lOMMe^MMMeiMMM 



M 



aoao«ao«^^^^^ao<D<Daoao«^ 

3 sill J J JH3|^li3 J 

z 

o 

jl ^^ ^ ^ ^ ^ ^ « ,M .M ^ ,^^ ^^ ^ ^^ ^ -^ - 
2 t-I«>4«>4ec»Hote«e«e«coeoo»akO»«}<-«e< 

8 3sl||S^^d8S|||lsS 

► 

n .J >< ^- • ••«• ^ 525 ►••►»• S'S ^- ^ • SS »• ^• 

5 55 ^* «5 J J w . S 4i *i ^ ♦; .«;►♦« J 
o5 ±» > '< ji jc -a ^ a»'^'^Si-'iZ^£-oji 




s 

S 



: : : : I I III • 

' T3 ia T3 'V "^ M 

m >* 8 8 S 8 8 « 



OB 



>> ^ ^ ^ ^ ^ ^ 

aac.cxaaiiaii^pba*s 



s 



Classitibd Cini. List — Conunaf 



:S8S3SS333S3S888888S8SS8SSS888S88SSS 






iasss 


SS3S3SS333SS5.53 


222£2SS2SSSSS33 


IllJs 


JislllillK-IIJsl 


lilllllllllllll 




,j|.g.. ...„,... ................ 


2SSSSSS22SS2222S 


3:li;i3:§l3:3l> 



iilj^iislll4ii}llli3JlllilliJ^llliJI 






1«'i«**'=!iSs's!i'ii 






'M ill iiin !! , iiyj 

illll iljl ililii II I Hill 



UIH 



^iJll 



lliiiiiiiiii 



iiiiiii 



480 



Hkport of State Civil Sehvice Commission 



I 



I 

O 
o 

g 

o 
Pi 



a 
o 

s 

s 

o 
O 



S "^ 



If 



a 

9 



1 

a 
I 



I 8 



ill 



i § ° 



55 

O 



88 
88 



a 
a 
o 



H 
CO 



t 

la 

s 
o s 



gs 

o 
a; 

K 



6 

H 

S 

c/:i 

8 

2 

H 

s 

a 



1 so 









s? 



^2 
S4 



• • 

GO 00 

lA ** 

O CO 

•-• ^H 

a a 



So 



a 



5 

S 



a 

Is 



a 



4 




b 

o 



\ 



a 

H 
K 



888888^ 



^ w N eo ^ ^ »N 



••« 


••« 


r* 


^ 


-r 


00 


^ 


^4 


^•* 


»^ 


t^ 


v^ 


*H 


*H 


fl» 


Ob 


Ok 


a» 


a» 


a» 


a» 


•irt 


»-• 


tH 


ff^ 


^4 


^^ 


w^ 


^4 








* 

v4 




o» 


• 

9 




d 


d 


c 

eS 


1 


• 

s 


^ 


•n 


•-» 


^ 


^ 


•-» 



* ^ t* "^ '^i 00 '^ 

•i^ w v^ v^ ^4 vH t»« 

9 Ok 0> Ok 9 0> Ok 

^ Vi4 *>4 ^4 Vi4 ^4 *H 

^ ^ kti -^ rS n aS 

d d B d d a d 

eS c8 <l eS «8 o <l 

-»-»'-»'-»'-» do "^ 

'J .j^w . :o 

V ^. J >-■ ^ o >; 

•2 ^ I S o < g 

S(0 *^ t^ «^ CO o 

Q p a» «^ CO 1^ 

C4 OO C4 00 C9 O) ^ 



6 

a 

OS 



a 

a 
hi 



55 






Q 3 5 

© i>: o t»* 
a3£(gSp 



^1 



• •4 

GO 




o 

a, 



8888S 



CO n M M - 



^ ^ « ^ c 

•^ »i< W^ ■* "• 

Oft a> o o c 

v^ Virf *4 P4 •• 

•-^ c» « 0» - 

a B 2 c s 

•-» <-» ^ "n "^ 

X -• 10 ^ «c 

on «^ ^rf •> •■ 

ao s o» a s 

^H f^ »^ •^ •< 

•^ of « 0» - 

^ d a d"? 



>^*>; >'^ 

Ma's! 

r» Q * « © 
5 SB m « N 

2 oi 40 2 <-* 
w CO oi -^ »* 






d 5 



?5 
> « o 81 

£ Set b 



§3ja66 




Olabbifikd Cim. List — Cochctb 



481 



888888 

§§ii§§ 

w * «k * • 

«■« «■< rM ^m c% 



8 



e« 



8 

CO 



S8888888SS8 



SgSS 

•^ o *^ 



gg 



88 



« ^ 00 00 ^ ■« 

w4 w^ mt r^ ^^ w* 

Ol O) Ck O) Oft o 

»J *^ CC *^ •J "H 

^ ^ lo 00 00 « 

<^ iH g "^ ft "H 

Ok Ok 9 O* OD Ck 

vJ v4 O ^^ ^ '^ 

^4 ^4 *4 

• ^^ • • • • 

• • • • a 

, . • • . ^>^ 

^ ^ W . 00 ♦{ 

-3 i ^ S ^ -3 




* J '^ -3 ^ 



& 



£ O pk< foOtU 



J4 J4 JM • • 

llli; 




o» 



9 

o» 

0» 



Ott 

o 



a 



O) 
oa 






8 

OS 
H 
QQ 






It 






I 



a 



'I 

c 8 



^1 



»-• -H »M «H e) CI ^ 

iQ^r«e«oQ^aocoe«o 
oOOkOOkflbOkOkOkOkftft 








£h 



w d ^ 5 1 

9 Q 'O V P 3 9 

O «» » QUA 



2 o 





16 



III 



IS 



ii 






^d 





482 



RxpoBT OF Stats Civn* Serviob OoKinssioF 



o 

I 



1^ 
III 

8 



,1 
I i 

8" 






2: 

Q 



V 



s 

t. 



ss 

«4 fM 

U 

^1 



1 



I 

H 9 

O 
U 



ll 

n w 



I 



s 



d 



g 



It 
i 

OQ 



^ 8- 






OQ 
GO* 



^ 






88 



d §^ 



I 

^ O 

•31 



H 



& 






S 



8 



88 



8 8 
8 

10 



00 ^ 


00 


00 00 


i 


Ott Ol 


Ott 


Ol Ott 


•H fM 


W4 


«M r^ 


^ 


• • 


VH 


^ ^ 


• 


June 
Jan. 


1 


ll 


1 


oc ^ 


00 


00 00 


: 



s 



1^ 



I 



i 



i^ 



8 



00 



*t I «• «* 






09 



I 

a 

o 



3 1 

; 

I 

I 

a 



I I 



I 






n 



I 



S 



8 



O 



I t 



£ 









Classifibd Civil List — CoDMTtas 



488 



8 



88 






8 



8S88 



8 8 



CO 



8888 
§g§l 



OQ 



1 



"I 

a 

I 






C» Ok 

ii 
ii 



^ -H ^ ^ a <D 00 

S O) S o» Oft e» c» 



Ol ■« 00 «H 



jd ^ 






III 



So S Oft S oi c» 



Oft vH 00 •-• 



II I III! 







00 

Oft 



00 

Oft 



Ii! 









1 

o 
d 



I 



^ 



e< 



I 

i 



S9SS 

Oft Oft « Oft 

VH fM VH VH 

• ^^ • • 
vH M p4 vH 

yji 

O M « Oft 

^4 fM A ^4 

Oft Oft « Oft 
vH vH vH r4 

* -^ * * 
v4 M vH vH 

iSii 



i 



^ 



fj 



i 



I 



i 



a 



^ 



I 

I 




a 




484 



'Rbpobt of Statb Civil. Sxbtiob Cohmibsioh 






I 



Q 



§ 



S 



88S8S 



S 






CO 

Ob 



9 

9 



00 


00 


00 


1- 


00 


^^ 


^^ 


*^ 


»H 


*H 


a» 


o 


a» 


a> 


a» 


^^ 


^4 


^H 


«4 


•H 


^4 


1^ 


2^ 






• 


• 


-9 -A 


1 


O O Em C£i >< 



h* 00 00 1^ 00 

»H ^H »i- ^H 1^ 

9 O Oft O Oft 



M t« tf) «H 1-4 

M 

lis-* * 



Em >< 



•■a • o 

.* ^ •a 



00 



< 



IB ® £ 





s e 



§§ 

S I s a i 



Ob 



2: 



Ob 



> 



o 

I 

ca 



5 

a 

H 
H 



1 






88SS88S888 

4e«e«eieie«elo9o 



SSooSSSSSSS 

.^ Em < |3m£ *^<6hh 
aOaooo95958o 



I I I I 



n t* f^ -* 



I- 



4 a •< •< s •< ■? £ << 



I 

s 

o 
9 



. O • • • 

illii 



• o 

•23 



5S5S 







I 

I 



•• fa 






Classified Civil List — Counties 



485 



SS88SS88S8888S888SS8S8 



§§ 



e 



8 

o 



If 



w <P <0 O 
lO w5 M M 



88 



o 
o 



8888888 
S888 



I 



«« f* CO CO <-4 



^^o•Hf^e<^-^.e«<Doe>la«o«oooet«ooao^. 



»^CO*HCOCO»^«^»H*Hr^ 



I I ^^^ I 



CO .-I 



04 00 «0 01 



iilllliiijiiiiJlijiiii 

2jP^^eo^iNi^coogg^^«OQOMh-oocor« 

9OkOi9O)Ck59OkO&wOoS5SoOOOOtO)0kO&O^O 



'^'^"gf2s2«'^"«- r f s r r r 



«o a» 



a«2S 











eo •^ ^ 



<0 00 

S8 









►» •-» 



lllllllll 



i 




s 



Hills 




^ 



ti 



lA <« « ^ ^ ^ t« 
O) Ol Ol O O Ck O) 



O "n •-» *^ '-»'-» •-» 

lo « « ^ «•• « r« 

oi oi oi oa oi oi o> 

lO v^ ^ 00 f-T ^ •J' 



O i-» •-• *5 •-» «-! «-» 



§ 

OQ 



8f 

< 

a 

s 

a 

e 

H 

00 

5 






O K 



H 





^a.-S«j'^" 





I 



<3 







486 



HspoBT OF Statk Civil Servicb Comhissior 





1 

•I 

I 



III 



o 



It 
2 



o 



888888||| 

CO CO 



11 . . - 

M 1-7 e^ -H ^ 



sss 






f-i <0 « «D C» ^ r! 

^ o e>« vH e« 









1414 









>-» "n 



•^1 






HU 




J5 o o o 
ossa 



8SSSSSSS 



i 



§g 



888S 

M 1-1 CI ei 






8 •- 15 '^8^2'" 



SCO ^4 00 

^ vN p4 

o» » o a 

^4 ^ p4 114 

«H ^ «N a 



jgl-i»>^^^ 



S 8 & ^ 3 



i'4 

^ *» * 






oao«Dh>coooaooo 

§ »-* S -^^ 8 -^^ 2 --" 



CO eo •« » 

^4 ^ r4 «4 

c» » o a» 

^4 V4 ^ ^ 

" • • • 

r4 iM *4 a 



a 






&3 



>» a. ^ 

2l:S 






i 

l-» •-> « fc 



o 

3 

lea 



O 



n 



o 

-a 

ID 

9 

a 

r 

I 

o 

a 



I 

: "3 .« .«• O 



S 0Q 04 PQ 



-a o 

Si 

a 

2 

a 
o 



to 

9 



W 



III- 



• • • ^ 



fa 



1 



i-il^ 



•SI 



a a 



«8 fc f^ ^ fi 



i 






15 

HO 




a 

I 



3 ii c8 

«5 (M «M *o 

g 8 8 8 1 1 

^ S I ? i I § 2 




Classifixd Civil List — Countibb 



487 



88SSS88S8 8|||||||8SS8S8SS888S8 8 8 88 

g§2l§ligiiHa&aai§§ii§i8§§Si§ sSi5 

^^^^M 8888888 

« lO lO lO « ^ ■« 



iiiii^jjliililiiijiljiliiiiiij iiij 

otto>o»SS8a»e)aio>oaafta»o»oabo>oSekCkCkCkCkCkCkObabOttaft CkCkOiCk 




1 

CD 



I 






> 
< 



|2« 



OQ 









®fi 



5 o 



;:: n n 2 



2S« 



9 



32 J J 

PQ A n n 



• 



V ^ Q 5 en . «• 

i 1 M 1 





b »• h 

s S s 

^ a G r 

irv. 

C « 0) c 
M «* «a ■*« 

fl c3 a e 







>> >» >» >> >k >» 



>»>»>.>» 

fc'S'B'i'E'E'S'fe J feS 



i 
I 

i 

o 






00 






488 Rbpost of State Civil Sbhvics Commission 



I 



1^ 

sis 

n 



^11 
11 

g-8 




i 

2 



o 



S8888888 
S§gS8S88 



888888888 
8888888^8 



e« ^ iM f^ 



<oo»ooaooooOQeao 



& 



« « « 



tDCOOOOOOOOOOOQO 
Ot Ot Ot 0k Ot Ot 0k Oft 

• ^ <»> ^' M S S & 

8 s.l| 9 9 3 9 



OOft0>OOftOOftOftO 



fM <D 00 *H ^ *H 



►^ »^ In ^ *^ 



ml 






S ^ ^ o ^ A ^ 
cS (Q (Q (Q (Q (Q PQ 



H 








g .§ S 8 SJ o - 



fe 



(a 



•J 

§ 



8 

I 



« • • « 



lllll 

c Q g a S 

• mm •«■ VM sp^ ^*|* 

mil 




88 



00 00 

01 » 






00 oc 

01 o 



c d 

9 3 



s 

"in 










I 



21 



I 



ss 



Clasbifisd Civil List — Countixs 



489 



888888 |8 8888SS888888888SSS8888888| 
§§§§§§ di§§§§§§^iSi§i^S§SS§SS8S88s1 



S8 



8 






iiiiiiiiiiiiiiiiiiiiiiiimiiiii 







do ® 

S n S 03 



o 

•S2 



ao 



o 

I 



J 
» 



i 



£ a J s J ,.• -s ei . ,,• 5 -^ t3 



ds«^-wa':'E*? 








M H H (:< H 




S S S J 
M M M « 



•s 




& III 11 « 



490 



Rbpobt ov Statb Ciyn. Smtvio CoKicissioir 



I 



o 

g 





I - 

111 



I 



•& 



I 



2 

o 



"O "O T9 "9 "w 

SS888 

« lO ^ ^ ^ 



§sss 

w w OD QD 



S888888888SSSS8 
§§§§§§§§§§§§§§1 



CO 



1904 
1912 
1911 
1911 
1906 


oo 00 so 00 

«H ^4 pH v4 

Oft Oft 9 O 

pH ^4 fM pH 


«> »0 ^ « <D 

^ ^ ^ ^ 


» * • * 

pH »4 «H ^4 


Aug. 
April 
Not. 
Not. 
Not. 


July 
Oct. 
Oet. 
Oct. 



^ C4 fH p4 <p 

Q >^ ^4 p4 e 

9 Oi Oft Oft Ok 

^4 pH pH ^4 ri4 

«0 lO to i«> tD 

*H ^4 «^ »4 

■<-?2Z2 



I . 



o 

-a 



1 



1 1 



^■k ^^ tfiK ^'^ 








lllll 




00 OO 00 OO 

^4 v4 «ii4 ^4 

Oft Oft O Oft 



^ ^ «* .«* 

»nOOO 



oftOftS88Seft8S8ofto»So2 

^«Hi-4*^^iO0ft"4 ao^^Of^^S 

«H<-4«^0|apHv4OwO'4'^^''- 

a»a»OftaooDOfteftaft9aftOftOiok92 
«H*4^*4«H^4iooft^*o^^o^cn 

iii^iiiiiiiliii 




s 



S 

^-^ a . 
^ a 

(3 

•E 






III 

1 8 





« 4) O • 

e I e e 

5 5 s 5 

a a a a 

• mm '^ •pm mm* 

• M .^ mi-a .^a 




I 



I 



liliii! 

M 

OH 




Classified Civil List — Couhtibb 



491 



§ 



8 8 



CO 



8 8S8888 



CI O 



M 01 ^ <H pH r4 



888888888888 



00 

Oft 



I 

00 

0» 






a 

Q 



I 



I 

n 







8 

I 

8 

I 



<0 

Oft 



i 






j 



H 

06 o 

1 



QQ 



5 S 

I 



o 

P 



1 

o 



I 



t 



I a 



J4 

•3 



O 



<D t^ t<> <0 00 <D 
Oft Oft Oft Oft Oft Ok 

^4 ^4 v^ *^ ^4 ^4 

• •••»• 

«H ^4 ••^ pH lO ^4 

alls-Is 

►^ < < •-» "-t "^ 

O »^ l« ^ 00 « 

^4 v^ ^4 Q v4 pH 

Oft Oi O) O O Oft 

^4 tM ^4 ^ «H r4 

pH «H wi mi uS ^ 

alld-la 




a 9 



§ I S • S 

2 3 ?» lis *" "* 

III? 




^o«r«»^»^eoi«oo««^aD 

SoO^O^OftOOftOftwODOftw 

Oft vH ^ lO ^ ^ 

:2 -^ >» 



fM «H pH v4 ^4 O 

^cir^»^r«eo<ot^«W9S 
SootoftOOOftOooooSooo 

p4i>4«H^4^4v^pHv4v4r4^4^4 
f^*^v4v4^40»4^4^Wdp4^4 

• » ^ ^ ^ •? • hi • V » • 




llll 









u ^ O B ^ v^ <D 

** '^ M ® 2 '^ 
v4 «H W •-• A 1^ 




sisi 




^ >l ^ J4 ^ 44 • 

mill ; 

>>>*>* b b h • 

tllllllllll 



J4 .M J4 












49S 



Rbpobt of Statb Civil Sebviob Commibbioit 



8 



o 
o 




g-8 



.§.2 
-1 






i 



2 
o 



888888888S8§S88§SS88S8l^l 



ii 






88 






22 2 2222222222222222222222 
^ •"' a 2 '^" §5 S '"^ gf -"" g S" '^^ '^' '^* -^ '^ '^ \ ^ 2 ^ " 2 






^ 00 (D « 
OD 00 S o 



«^C|MBO)^i^^i^>-4 — 









c ^ ^ 



I •-• 00 O ^ M 

I w* w^ w* 



C ft 



o a 



t^^tti^a. 



►^ •^ •^ 









'<-<44*<-<-<^^4s jssa 






I 

M 
« 
M 

U 



P 
O 

u 





-2 S-S 

J& JH ^ ^M J^ M M 



« ^ a a .? 
V o s V g 

5 8 S S 
•« -8 •g -^ 

9 9 

1-4 »-« ^ 



CuussiFiED Civil List — Couittieb 



493 



eeoooo02aaa:aau3U3:a:sr3:a:a:S:a:S:3:a b t: b ii *i ** ^ *• ^ ^ »s 

i§i§§§§§ii§§§§ll|SHi§§§§ni 



S§5222222SS5§8§222i2S2SSSSSgSSSSSSSS 






Nil 



« lO lO 



5 










i>^.£ 3 3,?^^^ aaaaaaaS s a S S 



00 Oft 



CO C< CI 00 M C< 00 

85 00 Oft Oft 00 So S 



M 



00 



8S^ 



22222225S5«»»»»o»o»o»ofc 



^o«eo^afti-4«Hcoi-^c«b^ 



- - " « 8 2" S «■ S = = 2 = = S S 3 S - -• - « - 

§ll|8^|sUs||ig|li|iM Singulis gaa a 




JllJlliiaiiiiimimiillllllli 



494 



Sepobt of State Civil Service Commission 



o 






i 



2 
O 



8 



i 



I 



-J 



ss 



CO ^ 



00 ^ 






00 ^- 

m 

** A 

00 -» 



I 

§1 
II 

II 

&6 



s 



I 



9 



o 



I 

3 






8888888888S 
as i2S lo c s s 






^*^«Hp4tDl-l«M*^'^*^^4 



tf S a 
^ "n ►^ »^ 



OQ •-» 



*? a 



< •? < < 



<DO»^ror^aoiOQoar^ae 






•c c 

< < 




115 ilsj xi 












^ 




oovvoooo 



C C C C C C C C 

qgaaQaafiBCC 



I mnm 




Clabsifibd Civil List — Couhties 



49S 



SS8888§8SSS 
8SS88S83S88 



CO 



c« 



M 



C4 ^ 



SS88 

• « • * 

CO CO 1-4 1-4 



888888 



8 






i 



CQ »^ ■< 






a 



. « 



2 fi« 



00 



CI C< O «0 l« A M 

1-4 t-4 Q *H tH S v4 

O Oi Ob Oft O A o 



t-4 CI CO 01 ^ 

^ S S S ^ e ' 



lltllllllll 




o 






w - • M " ■— -^ • ■ OS 




I 



• -e 



& 



•♦^ <«* 



O «> h Ik 



^sl 

Hal 5 5 9^ 




O -^ •^ 00 
■M «4 «4 r^ 

Oft Oft Oft Oft 



III! 

o ^ e lo 

pH pH ^4 tH 

Oft 9 0> Oft 






S<-<^ 



c3 a 



(D OO fM 1^ *H ^4 

O *^ *H 1-4 ph ph 
Oft 9 Oft Oft Oft Oft 

^4 v4 ^4 ^« v4 ^4 
O ^ ^ >0 vH ^ 

ijiiii 

^ 00 1-1 •- »-• ^ 

Q ^4 v^ *i4 ^4 ^4 

Oft O Oft 9 Oft Oft 



t* r^ wt *n W* ^^ 



tti tma 



o 

(a 



o o 



o 

-a 




ttffl**! 



00 1? 

^ * S 

•S 2 r* o 

^ OS w f-« 

A ^ « «o 



o 

I 

pa 

d 
I 

O 

lO 
04 








I 



I 



e 

I 

9 



3| 



^ § 



3 

ja 

09 



5 



406 



Hepobt of State Civil Sbbvioe Cokmibsioit 






i 

2; 



2: 
o 



8S88888S88S8888 
S8888SS88888888 

g «- -.- «• «- «- ^- „■ -• - -■ «- - -- 



8 



S 






4333$ 







*s 



a 



^^ 



4^ -< < »?o 






a3 Ob's 



• • ^ "3 "C 5 • 

3 s s s-t ^ ^ 9:1 




Mill i Mil III 

5 S i <2 S »S s « ^ 6 5 s K 



s 

(a 

o 



8 J 

'§•1 
§ a 

11 



fllllf If 



a 

o 



a a 



a m M JB M M 

a a a a 




o. a a a 



tUi •* U Ui 

IJJJJI^ 



a 

CC CO CO 



I* 



t3 



I 



01 



01 



i 




31 

"I 






o 



Olassifixd Civil. List — Couittixs 



497 



SS888 
§88S§ 

Ci p^ ^ ok C9 



t^ 00 OO 00 00 

^4 w^ w^ w^ *^ 

O Oft o> Ot o 



^ 



00 00 v^ M 






t^ 00 flO 00 _^ 

vM pi^ 1^ V4 oo 

o» a» a» Oft ^ 

VM v^ ^4 ^4 0> 



00 00 '^ 



04 



•c 



>> b 



^IIS 






o o 



4 fM t« 



us 



^ 6 6 : : 




8 



8 



00 



00 

Oft 



00 

0» 



00 

0» 



I 

n 

as' 

.9 

» 
8 



O 
J5 



a 
x 

QQ 

o 

1 



6 

n 






^ 



1 

n 



0D OQ OD OD QQ 



S 



Iflflllll 
8SSSS 

le lO id lO ^ 
roe^aoie^oo*^^ 

OOftwO>OOOftO«90ft 



88S8SS888 



•SI s 



S "n S "^ 



8 fl 



ca o <D >o <p 00 _ 

Oft 00 O) w 9 Oft A O) 



jr. 

O 



O0ft000)w90ftA0ft S 00>OtO)OtO>OiO)0> 



pHr4«HpH ^4«H^4lO 



J llll llll 



o 

''I 



e 
3 









o o 



(a 



A 



CD ■< •*' r r 



lO ^ ^ 

* CO e* 



T 3 00 



•COOQ 



llll 



to 



OQ 



CO (<5 00 





91 






s 




• 


* * 


^4 


1M 




n 


1 


1 










00 

1-4 

v4 


1918 
1918 


00 

Oft 


1918 
1918 


00 


00 


00 


* 


• • 


* 


• * 


* 
p4 


* 

V-4 


w^ 


• 

1 


• • 


• 

1 


• • 


• 

s 


• 

1 


• 

d 


00 


1918 
1918 


00 


1918 
1918 


00 

o» 


00 

v4 


oo 

v4 


* 








1-4 


• 


* 


• 

d 


aa||a 


• 

1 


• • 

II 



.a 



M <o ^^ o 
00 M «o ^ 



V c 



n 









»>£^ 






>» >» 



9 



498 



Rbpoht of State Civil Servicb Commission 





8 ^ 

111 



I 



2 

o 



S88S8888S8888S888888S8 ^^^^^ 
888S8S8S8SS?SSSSSSSSS88 b kkbsi 



lO 10 10 « 



o 

s 

s 
6 



00 

Oft 


^4 


2 

* 

r4 


00 


00 

r4 


00 


OO 

•-4 


00 00 

• * 


00 00 00 00 00 OO 

,.4 v4 «^ *H v4 v4 

Oft O) Ot O 9 Oft 
^4 v4 v4 «^ v4 «^ 


00 00 00 
v4 *H v4 

O) Oft 

fiii^ ^4 «^ 

• • • 

«4 «^ ^4 


00 

Oft 

p4 

• 
^4 


00 00 

22 


00 00 00 00 ae X 

^4 *^ vH ^ fi4 >« 

Oft Oft Oft 00 

w^ r^ 9^ wm P4 r* 


1 


• 

a 
4 


• 

9 


• 

1 


1 


• 

1 


v4 

• 

1 


99899999 


gg|gg| 


• 

1 


a i998 


00 

•-4 
• 


Oft 


OO 

2 

•> 


00 

* 

9^ 


00 

a 

* 


00 


00 


00 00 

^ P4 


00 00 00 00 00 00 

»H <>< V^ ^« 1-4 «i4 

a» 9 Oft Oft 0» 9 

VH v^ v4 ^4 v4 v4 


00 00 00 

^4 v^ ^4 

Oft a» 

f-4 iM V4 

* • » 
^4 fH pH 


00 

Oft 

» 

v4 


00 00 

Oft Oft 

^4 ^4 


00 

Oft 

* 

v4 


00 00 00 00 30 

Oft Oft 01 


> 

o 


• 

a 


• 

9 


• 

« 


II 


v4 

• 


• • 


|g 9499991 


1 


• • 

II 


• 

1 


9d9J3 




OQ 



S 

as 

a 

M 

s 

cu 



>» >t >> X >i 

«'«««''«-» 'tis 

3 3 d d d 

a Q. a a a 



(SSo 



9 3 

& a 



>»>»>> 



3 



9 9 9 



999999999990^ 



lllimilllllll 




Ci.A88inxi> Civil List — Cotthtibs 



4B9 



iinnnnininnnniini 

888888S888S8§88S8§S8SS8SSSS 

lOlOiOWdiOiOiOiOiOiOiOiOWdtOiOiOiOiOiOiOiOiOiOiOiOioiO 



8 



888 

^ s s 

C« 1-4 



aOQ000Q0Q0Q00000Q0Q0aO00Q000Q0aOa000a0Q0a0h*Q0Q0Q0>OC4 

9SSS||899 998S9S9993SS9Sd9d| 

ooooQOooooaOaoaoooaoaoaOaoaoaOQOaoaoaooooot*aOQOaoioe4 

999 9| ll 99999999999999 99H^| 




I 

A 



< 



9 
O 

S 



^ I ^' g I 





0» 









I 



O 00 <D 

•H ^4 pH 

» 0» O) 

^4 ^4 pH 

« * • 

0» ^ ^ 

1^9 

•^ •-» •-» 



O 00 <D 

pH ^4 ^4 

a» o» a» 



^99 

•n •-» "^ 



8 



•r * M 



?4S 



liiiummmmhm " " 



9 9 9 

III 



.3 
1 




500 



Rbfobt or Statb Civii. Sbbvio Cokuission 



m — % 

1 



o 
o 



H 



si 



ts .a '^ 
® r 

1 1 

8" 



o 

h 






I 



I 



2 
O 



I 



S8S8 

•S 1^ e 

• • • 



8 



8 8 



« <o 00 m 
*-i ^ a e 
o» o» 5 Ok 

^ ^ v4 ^4 

» • • * 
^ ^ ^ »^ 

998l 

»n »^ "^ » 

<D « « CO 
^4 r4 O O 

o» o» a 9 

^ ^4 v4 ^4 

•n »-» ^ 2 






Ok 






% 

s 



I 

CO 

O 

CO 

H 

e 

CO 



'I 

CO W 









S 



O 




g 9 S 






\..jt 



1 






1 



§ 



1 

a 

s 

o 



Ills 



s 






I 



888888888 
§§§§§§§!§ 



aDake»oiSoio»oio 



«-• et •© "^ ^ 



o s; •-• et w 



8 



Se«r«<paoMioie2 



•H i-i « <-i d ■<» 



*4 CI M) ^ ^ 







^ V^; «- ^ 

• I in s|| 1^ 



illiiiiii 

.S3 : :::;; 
6| : i : i ;; 

1 •i^ •)! •t' 4 -S { 




I 



OLAflsmsD Civil List — Couittieb 



601 



S 



S8Sg 

• • B • 

CO CI CI i-i 



SS8S888888SS 

i§§§§§§i§§§ 



e%^^c9'^^^^^w^w*^^w*w^^^ 



8 



88 



CO c« 



a* 

0» 



8 

t 
i 



3 






e 

I 

B 

< 
CD 



i 

& 



Ok 0» CO »« 

w* w* w^ P-4 

Oft Oft Oft Oft 



99oSQOftoftOftOftOftOfta»oft 

2S52!:: ^jjpjpoococo^cor^^aooo 

3S22 o9«8»oft90ftOftO»a»Oft 




'^SS 



8J 



It3 

O 




a 

6 





111' 
Ml 




J||||l|||3 



Oft 



lO lO 
Oft Oft 






lO 
Oft 



lO lO 
Oft Oft 

* • 



^ -1^ 






M 



pa A 

'I 



^^ 



Sg 



I 

•J 

1 



& 




&02 



RxpoBT ov Statb Civil Sbbviob Cokkission 



si 

"8-31 

8 



III 



8 -8 



8 

8-8 



I 






z 

o 

H 



I 

i 



o 



888S888SSS88S8S8888 
§§§JJ.§§§§§§§§§§i§§§ 

2* M ^ ^ ^ ^ i-i ^ ^ ^ ^ ^ ^ ^ ,M ^ (I <-i 



8 



SSssSSSSSSSSSS 



oo c« ^ « oo 
a» 5 e» S o» 



4 00 00 le lo ^ 
h < 2 Z 2 



w QD w OD w O 
•H V ^ go « V 

<D O *< •n •-» »^ 



00 ^ 1-4 ^ 00 
9 9 9 Oft Oft 



ODSOftSwODOftOft 
«i-iiO^^0ft^M)000000f-if-i 







1 J«i 2 

o /^ o n ffc /^ 
•-> H •-» o ^ o 







<^^ 




szS^ufS^S 



f 

1 

i; 



I 



IIH 



*.IJ.8.||||8 8 



-3 a 
o o 
d 



•3 

o 



a 



^Saiaaaiiiiiiiiii 






OS 



I 

I 



d 

! 

01 

i i 

Sl4 



O 



P 



d 



1 



CuissiFiED Civil List — Counties 



508 



8888 



^ CO eo c« 



8888888888888888888888888888 



e«e<e«e>ie«e«c«e< 



00 00 00 t<> 

*4 ^^ ^4 ^4 

Oft O Ok Ok 

r-4 r^ w^ w^ 

* » • » 

eo eo CO •-• 

. . . o 

399 9 



CO 00 00 t^ 

^4 ^^ ^4 ^^ 

Oft Ok O) Ok 

^4 ^^ ^4 ^^ 

• * » • 

•-• CO CO «-• 



a . . . 





e«tte«c«e«e4co^e«Mooe4C4C4Me4e>icic<esiesie4Me«e>ie«c« 

OODOftOyOftOiOkOkOkOiQDQDOO*OftOftO*OkOkOka>OkO)OftO*0*OOft 



•<S0000S5aB 



!-• lO 



a3^i4^4^4^^4ri4»4«H^4^4*4»4 



o 

O 



illlllllJilJ^illllJ 



w w w S w w 



89 g 2 ^ 
00 9 00 Ok 



«0 «D «D to 



<DOroM(0<Dt0O<<|i-iroi-4i-i(D<0<0«9e«<0«-i<DC0 



«D ^ 



9^91 iiiH^^i^^ii^lliii 



•-9 ►-» "^ ^ 



•^ 1^ "^ "^ CD 








504 



Ebpobt op State Civil Sebvice Commission 



8 

T 

H 

p 

O 
O 

O 

5 



o "^ 

I 

s 



5 8 
•5 -ii 



1 

a 



^ 8 

5 1 



8 



6 *»< E> 



1 



I - 



o 



00 
o 

04 



8SS888888SS888S8888S 



8 



I 



I 

0) 

g 

O 

a 

O 



e ' 



9 

o 
o 






o ic 10 









SSS8 



eo 



CQ CQ 






00 (D •-« of (D 10 kT 



C4 



llllllllllllllllllll 

0>flk00O00000iOflk0«OC>0iC>aD0k0kflD0>0i 
f-rcOf-4«DiOh^fMr^<O«O0000«Df-400«>iOtOf-4C4 



1 








^ r 

39 



11 

II 



a 
3 



(a 

e 

18 
c 

00 



I 



00 



r p 

GO •-» 

us ^ 

8 is 

2 o 



c» e <D 

v-a ^4 |<» 



09 n J 

• * 00 

I- "< •« 



• . • . 

.ea - • 






a5« 5 _: 






|i 

■^ CO 
5 

W 00 
<» op 




S3 fc te fe fe fc S S fc g^ 




• « « • 

sllll 

a ^ ^ i3 ^ 

g ^ .M .itf ^ 

§ 8 8 S 8 
h n n (c 0Q 







9 

01 



9 



e 

I 

a 



c 

a 



o 
p 



CuusBiFiED Civil List — Oountobs 



505 



8SS8 888 8888888888888888888888888 



lO CO e^ fH 



S €4 

00 00 



CO ei M 



s 



I 



niMfHfHfHMmMMMMMMm 



00 <D 00 00 

v4 (H fM ri4 

Oft Oft a» oi 

• • * * 

ro ^ <D Oft 

• • ^^ 

S S & A 

00 to 00 00 

t-4 fH ri4 1-4 

O O* Oft o* 

*4 ^14 ri4 »4 

r« ^ Oft Oft 



000000 r<-coeoco^Mee4r<.floeoaMr«r<.r«i-i^«o^^^r«^ao 

AfHiH ri4^4^4^4ri4Q*~'QQ0*-4QOt-4^^«-4«>4^4t-4t-4^4«Hf>4ri4O 

oooftO) oftOftaftOftOftOftooftOftOkOftaftaftOftOtaftOftOftatoftOftOftOkOftOft 



«-4 00 <0 



i 



~ « • 
1^ "^ Psi 



00 00 «-i 
a <-i <-i 

00 Oft O) 



i-l 00 CQ 



-» "^ ►^ 



M to «0 



I 




ri4^4fMri4^4f>4C<«^4ri4^^4«>4aft«-4iO<^'4IOIOv4«H«>4 

OftOftOftOftOftOftOftOftOftOOOftaOOftOOftOftOftOftOtOftOftOft 



to ^ 



7 a a 



•-• CO « «p esi ^ 00 

^4 ^4 ^4 O «-4 ^4 O 

9 Oft Oft 9 Oft Oft Oft 



ooeo «-i«H«-i«p^«.4i-ifHQn^iaftr««-i<o«-ito<-ic<oftcoci«-4<-i 

<-4^ MM MM»m|^ ^^,.4<-4i-4 



sl|l i all a tt^l-l si si t|| sit 



a 

09 




g mK 

•^ 5 i( _ 

3M t- *^ M 
•-• M •-• O 
ri lo CO ^ «-4 



I 



"-38 








CD * « 



o 
O 



aS«?&9fioS'?o ?S'Sa^fi'&^d^&^ 





I 



J4 J4 ^' J4 -M ^ ^ ^ 



iJiiiiiiiiii 

3" 3 a .^ ■•^ -^ ■^ * — 



•8 



i 



d 

3 



o 

as 




506 



Report of State Civil Service Commission 






«8 
2 



2 

o 

2 



dooooooS6oo8;s::3;=i;s 
_ o o o o 

gSSSfifiSSfifiSS 
^^K ^^^ ^^^ ^EC ^k^h ^^^r ^^C ^^K ^^K ^^K ^^K v4 V^ V4 ^v 
^-*S-^-^- 2 5555!; 5 SI 8. 8. 1 

i § § § 

lO lO to lO 






S8S88 



« M C« OO 

fM ^ t-4 fH »4 






11^ sis 



•< CSS 






s 

Oft 



Oft 



O 9 O to «0 
*4 Oft ^^ ^^ »4 

O 00 O) 9 Oft 






^ 


e 


00 


01 01 


s 


v4 


fH 


V4 


p4 


Oft 


Oft 


Oft » 


•H 


^4 


*^ 


fH 


tH 


• 


* 




* 


• 


• 

9 


8^ 


• 

d 

«8 


• 

s 


•-» 


•-» 


ikt 


•^ •^ 


r* 


<D 


00 


Oft 01 


s 


v4 


«i« 


V4 


V4 


Oft 


Oft 


Oft 


01 


v4 


v4 


«i« 


*H 


fH 


^i* 


«^ 


• 
»4 


V4 




• 

a 

«s 


• 

a 
«s 


• 

1 


• 

s 


• 

d 

m 


•-» 


^ 


u« 


•^ "7 




5||0| 



2 

111 

:3 9 p 

^^ S S 6 

fe fe g § i-g*'^" ° 

c. a 5 5 o o "S. "SL *SL 







C 4* 



"S-S-g 




9 



iiii 



3 9 



>k >k >k >. X 
«» «« ^ «« «; 

3 S3S| 
66665 



Classified Civil List — Counties 



607 



88S8888 88888888838888888888888888 



§S S S 95 95 lO 
o »* »* t* t* »* 

iCiO e« M M M M* 



00 



8888 
►• t* 1^ ►• 



^^•^icoeQcoeQeQeocococvMMMM 






flk 00 O Oft 
r-^ 9^ 9^ w^ 

0> OI Ok Oft 



SCO 00 

Oft S S 



»^ f-» Fi^ O '^ »^ «-^ 



_ «B a «8 ,5> «8 *d 

•-» *^ ^ "^ » 1^ « 



ciioooco^io^io«Daot«o*^eoioooioie<D 

OftOftOftOftOftAOftOftCftOIOlOftCkOtOftOftOftOftOft 



^4^4^4^4^i«l0^^v4l0^4^4virtri4ri4^4^4^i« 



15- 



r^ »^ «o »H iH i«J ^ 



CD CO 

a» OI 



Oft 00 Oft Oft 

t-4 fH «>4 v4 

Oft Oft Oft Oft 



^14 *4 vrf O '^ •H f>4 

d a d d •£ d il 

«-» "^ "^ •-> fe "^ ^ 



oent^<pi^aooooAooc»oft(*eoD^ roO>^coio^OfiS 
oooooOQboooooooooionoftSSokOk^vHOftOftOiGOftflftOftOftoo 

^4virt^4^4rM«-4^4^4«i«*Hr4^4r4^4^4«^0ft'4^^*^*^'4^4ri4^4virt 




-''HuUtimimmm 



a 
o 



o 

g 



*1 



5 S 



8 



II 



•a 

s all 



S 8 

•a -a _ 

^ ►^ ^ 

2 32 

III 

d d d 
« « o 

•g "S "o 

666 







M M M ja M M M j-e 
aaaaaaaS 3 

ocdoadd|.^ 

CD Tfi % d^ TSl Ql XSV^ "- 



508 



RiPOET OF Stat£ Civil Ssbyios Commission 



o 

o 





8 
§•3 



1 
} 



«s 



z 
o 



8888888888888S8888S88SS8S8 






aOiO<MAiOiOiOiOiOM>iOiO«^i-4«4 



liSl 






3 :? 5 5 5 5 



•1^9 ^9 9 g gill 









1 1 ■^■^<^ 1 1 1 1 111 i i i •! ^ 9 9 1 1 8 gill 








939 

w •g "O -a TJ 




Ci.A88inxD CiTiL List — CoDimas 



609 



e8S888S8888 
§§§§!§§§§§§ 



8 88S8888S88888888S8S 



i«»*t^«ieio«io^^^eQcoe«e>ie«ioc««-4 



SSSSSgSSt:88 



i 



fi^'^""Jj;i««« 



1 



I 



<«•< 



I 



UjUH 



n?l« ail 9^ 



8 3 




■< 



s 



P 



H 











SJISl^o 






•8 






I 



I-- 



42 ■«• 4* ^ 

llll 
lllj 



tS ■ ■ s • s • 

29 *9 2S 19 !S *B *H 

•e -d -d tj Tj I I 



a a 



II 



UUiiim 



610 



Rbpobt of Statb Civil Sebvio£ CoMiassioN 



o 

O 



.1 
III 



I 






I ^ 



I 



! 



z 

o 



2 



88888S88 
§§§§§§§§ 












;iS'M 



§§!§3§SI 




a a a 



**4 *fV *P 



II 



I 



§ 



00 



1 1 1 ^ 



88888S8S8888888 

§§§§§§g§§§§§g§i 



SS2SSSSSSSSS8S2 

»2S::;:2S2SSSS8SS 

2 2 2 2 2 2 2 2 2 2 S 2 2 2 2 



S,6 

1 













5.1 



■a 

I 









lllll 



>:j^ 



I 



llll 



n <-• »«M 



lilllll 



M J^ M ^ ^ a 

assail 




Classified Civil List — Countibs 



511 



888888888S8S8S8 

§§§§l§§§§§ii 



888 



^ « "M 



8 , 88 



CO C4 



sss 

f ^s 

OS -♦ o 



a»oftAa»a»a»oftOfta»a»a»a»akA9 2233 

fj jp »-J »-4 »^ pj 

ililii 



i-i«M««-i«Ot*»M«-ii-^ 



IliliJii 



•S-S o 



oi Oft a» 



OftOftOftOftOftOftOftOftOft 












llllllllllli 




leldl 





§PQ • eo * J" 



-Ilk- 










§2§ 

00 Oft 00 



s 







I 

Oft 
10 




5 



1 






O Oft 

m m 

to c* 

D < 



0> Oft 

10 cf 






c 
a 

< 



11 

is' 

H 0S 






n 00 



11 

it o 



s 



c 

o 
O 






10 10 e>i 

^^ ^4 ^4 
a> Ok Oft 

^4 ^4 v4 

• • • 

^ «D <M 
•-> "n >-» 

*i4 ^4 iM 

O* Oft Oft 

lm^ W4 W^ 

s 2 a 

4dS 



g 



00 -^ s ^ ^ s 

04 O U r^ wt ^ 



a 



09 

•5 



6 






.a 



& 



I 
J 

I 

1 



lot 



612 



Rbfobt or Stats Qivil Sbbviob CoMiciasioir 



o 

o 

O 



-I 
II 



•S-3 



e 



^ 8 

Hi* 



g-8 



i - 
|"5 S 

lit 



o 



8 8888S 



a 



00 

Oft 



00 

Oft 



lo C4 »H CO ei 









S8S888888888888 
§§§§§§S§§§§§§ 



eoe«e«e«e«»-i^e«^2^<*^^** 



ooftOftOkOftSoftOftSoiAaftooio 

§iisi§§i§§S§i§i 




n|i|l5ll5^^lllt 



a 



mm 

:a . r^ o «. 3 J 

3 "-ft o « « . M 




^^S4k4 





I 



1 

imim 




m 



Classified Civil List — Counties 



513 



838888S88S88S8SS8888S8S8S8888S8888S8 
§§§§S§SSSS§iS8888888$99SS888S^SS88888 



«- w 



""^ ^ ' ' ' i ' '• '' ' '• ' ' '• ' ^~5 ' ' '• • • • '• ' '• ' '• ^""^ ^~^ '• '' ' • 

'S-ifllllllllilll^lJlllllillllllpIl- 



Jil 



B Pi fa • ^ *. C 
•-> *n "< 





S 6 J 4 1 ^ £ sS 4 ^ a ^ ►§ 




a 

I 




-«i o *^ 6 ^ 



, . « O ^ hJ u 






! 

s 







"3 



I 

s 



•M •^ •!' 



.M ^ 



Jd J< Jd J4 Ji ^ .^ 



MM 



mil 

nilJiUl 



M M M M 

V O O « 

pJB •Q ^3 ^3 ^J 

^ i; d d d d 
"C « •"" "• ••* •"• 

■I' 



M M M 

O « _V 

•g TS "o 
d d d 



5 

o 
d 







514 



Repoet op State Civil Service Commission 



8, 

T 

H 

D 
O 

o 

O 

B 



d 

o 



8. 

e 



5.? 



•o-S 






8 



•s-s 

g-8 



i - 



!2 



S8SS8888SS8SS8888S8SS8S888 
l§§§|SS£§S£S$Si888$SS88SSS 









w «-• ^ ^ ^ .^ 

•?< "^ rt £ K 



'^ 






o 



8g 






2 8 g 2 ^" 2 g ;?" -" t: o»' 2 2 2 -^^ 2 ® *^ -^ 2 2 -" 2 '^* --' «*' 



S -: -• >• 
(3 d a «8 






>% >> 



» r« "^ "ra 






t! >» > 






>k >k 



3 "5 ^33 



^ e 



c52£l< 




II 



« > I -• J 
: •< < Oi 00 

d ^ 0L4 O JO 





-i ^ •* 
6b O f- 

•-« •-• CO 



t* ►• « » ^ 

9s *^ 9} *4 c* 



d 
2 



S-^ lis 



e 

s 

o 



_ ♦ ♦ 

.93 J. ^ ^ 5 h 



s 






>. 



ot 



d 2 8 — S o Js 



2: 



00 

O 



M M ^ M 



JS 

a 
S2 

M 

O 



§ 

Q. 

6 



a 



k« M '». u d 

OOUOroOOO 





.a M .a 

III 

« JD JO 



Ci-AHaiB-iKD OiVTL L18T — CouimBa 



SSSSSS3SSSSSSSSSS8SSSSSSSSS3SSSSSSSSS 



lllllillliiililiiiililllillllllllilll 

igjjjiiljiiiliiiliiiijijjtiijijijjjii 
iiiiliiiiiJllliililiiiiiiiiiiiiiiiili 



i||il 



iiii 



lUiiUi^ 



li'iiiiii' " 



a « P 5 5 ^ p 






iiiil J 
JlJdl 'Jl 



tj 



r imimmm 

'■*^? i ^ * - « -i s ; ^^ 3 ^ * " s -^ « « 



■s15lj|fi||iiS|ill 

s s s s i rS a iS 4 a s S 2 5 II ! 



|-l-ii-!*i-|l-5 ; ; ; : ; i ; : ; M ; : i i : ; i i i ; 1 1 ; ; ; ; 
iiiiililii ; : ; ; ; i ; : ; ; ; i : i ; ; i i i i I i i ; ; ; ; 
1111111SIJ ; ; i ; i i : ; i : ; M i ; i M i i i i i i i i i 
l||lll|l|l : : i : i : i i i ; : : ; i i ; ; i i ; i i : i i i ; 

•ao's^'a's's'E's'o; ■;;:;!;:::;:::; :::■■■■:::: 

1 1 1 1 -I I € 1 1 -1 1 1 1 ■? -1 1 i 1 1 1 1 1 1 1 1 1 1 1 II I II 1 1 1 1 



516 



Bbfobt of State Civil Sebvice Commissioit 



o 
o 



a 
S.2 

o — I 



^ 8 
III 



I ^ 

c ^ a 

•SSI 
.1.1 



I 

1 



^ £ o 

^^ ^^ ^^ af 3E b krt 

« « W.S5 R ^ ^ 



5 5 

c c 

g 8 



8 888888 


:S 


»0 tf) C4 ^ n PI M 


• r-^ 



8 



»<• iC GO GO 

Wii< VH «^ 1^ 

a e> a a 



GO 

O 



a» CD O) <o •-• Q r« 

r^ wm ^* ^^ ra >*4 



(D (D OC CC tC tD 

•^ •* "i* »^ ^» ^^ 

ot o> ot ot o o 

v^ ^4 rM v^ »4 ^irt ^4 

i4 •M »J e: <c oc o 



•? -< 4 -< 



''^^ a 



•^ n 



c a 

eS 18 






•-»•-» ^ •-: tti •-» 



CD r^ iQ GO r^ (D 9 

A aM ^4 ^« ^4 O O 
9 0> O) OS 0> O Ot 

^4 ^4 ^4 »4 «i« l>4 W4 

0> « O V •-- Q t* 

^4 »^ ^< 1^ w ^^ 

if » ex i.&'a, 



00 (D <C OC <0 CO o 

»^ W* »^ »^ WK »^ ^4 

01 O 0> O) Oft 0> Oft 

^i< »4 ^4 1^ ^M »4 ^4 

pJ ^^ »^ C» f-« 00 »o 



e a 






^ 



t^ •-»•-»■<»-» fc i-» 




s ; 

32 a 

« 8 

I. «i 

g CO 






: c 

c ^ 
- & 

Q e 

o 

1-1 N 



• a 

CO . 



.^ 



oo 

.a 

<^ 

CO CO 
S CO 



CO 



a 



=: (3 

c 



J5 s: 4- 

* 5 C 

u: J c 



5 ® >» 
Si: 2=^11 

C *, .« s £ 
^ fl 5 ^ •=•§ 



X 

o» 



e 



> 
o 

Z 



00 
O) 



c 

cS 



a 



CO 

> 
o 

Z 



a 
>» 

3 
§ 



a 

8 



OS 



3 > 



00 

a 
S & 

^ CO 

i- 

E 

e 
j: 

H 



c 



SB « r. X a IK 

o. c c c c. a c 
o c p c c o c 



J4 



S c 

•3 •« 

(3 a 

2 8 

a e 

•8:5-5 
«> I 

& o 

es 0; 

.M le ~ «* 



a > 



«> 

OQ 



i^^I'll ill 



Classified Civil List — Counties 517 

SSS8883S3SS3S3S3SS3S3S83383338S3 3 



iiiiiii'Siii'^iiiii 



1 : 9i I9|S ss 



|S*| 



idl" 



il 






Ipllllllllpl 



si's 



E -a : I 



? e a : g i : ■ "5 : 8 a' 



fljllj 



j|<s 



IJ i Jlil 11 ] IJIJ J?l IJ 



m 



lllllll 



111 



iililiilillilllllllllililliiiiii I 



518 



Rbpobt of State Civil Sbbvioe Gommissioit 



I 



S88S S8SSSSSSSS88SSSSSSS8 



8 



I 



I 



9 



e* 



^eQcorH^io^^Me>9eo^e<9^i-«fHfH^»4v4 



•-I CO M CO 

^4 ^4 ^4 ^4 

Oft Oft Oft Oft 

< « ^ "^ 

•x CO e>9 M 

^4 ^4 ^4 *ii4 

Oft Oft Oft Oft 



e«r«iOio«QO^^'«eMC9co^ior^'««Dqo«c 

OftOftOiOiOftOiOftOftOftOOOkdBOkdbSOkOkO0l9 



« 1-^ 



s a a -^ 8 s ^ -"' -" s -"' 8 -"" -" 2 -^ -^ 8 
llll|s|||i||a|||||i| 






M 



88 



M CO 






^ iH ^ ei 

CI 



lO VH 



8^^'^22g'^'^S'^82'"'*'^as 



II45 



>^ 



9 >» >» 



> S b «i^ 



SI |ll||S|9||^3S||j||||| 



§ 

4 

55 



5?: 

o 



CO 

O 




oocOO 



Classified Civil List — Counties 



:-!-!-!-!-:!-!!l:-i!!!-!-!-!-??!-:- !■ 



8 SS 



mimmmmmm 

iiiiiiiiiiiilliiiiiiii 

a s -■ •■ -■ i -■ -• ii =■ a - s - - - " s - S -' a 

jlliJll^llllSillllilil 



mi 



%4i 



I 









ili liliniill 



II 



I ii 

i 11 

1 ii 

-- J 2" 
111 

ii 



'i 



r i i 



1 11 



iiiii 



iffiililii 



i 



illlllii 
illjilli 



i i I 



520 



Repoet of State Civil Service Commission 



d 

o 



s. 

a 
6 



a 
o o 

^ o i 

« a tJ 

G 2 ° 

d 



ss 



C« CI 



or? 



o 

2 ♦* 

B «M d 

o o S 

— ** o 

OS ft 

e8 



I 



g 

o 
u 

O 

g 

o 



w 

s 

2: 



o 



1^ lo 



i 9 






9 9 



I 




I 

o 

H 

E 



S888 § gSS 
S S 8 S i i 8 8 

lis- 

s§ 



8 











s 


n 






-* 


^ 


* 


^ 


tC 


(0 


^ 


c« 


^4 


m^ 


^^ 


w^ 


v^ 


v^ 


8 


vH 


o 


a 


5 


o» 


o 


o 


o» 


^4 


wm 


^4 


1H 


^N 


1H 


^4 


•H 


^4 


ph 


^^ 


^4 




» 


• 


• 

o 

»-4 


• 


• 


d 


•5 


• 

ft 


• 


cS 


• 


(S4 (S4 


c9 


(£ 


<£SSS 


"^ 


^ 


«e 


f 


lO 


«o 


,^ 


04 


^^ 


^4 


8 


t-« 


v^ 


V>4 


8 


^^ 


O 


e> 


o 


o 


O) 


O 


»^ 


^4 


^4 


•H 


F.« 




^^ 


•H 


w^ 


* 


1H 


• 

1H 


F.« 


1H 


* 

CO 




Fob. 
Feb. 


• 

9 


1 


•** 

a 


• 

OS 
2 




• 



*S *u S S 




I 



888 

» » » 

e« »-« f-i 



s 



9 

8 




*« *« «D 
O o> o> 

^^ ^^ ^^ 

^ <-« oT 

c^ ex .a 
oS oS Cm 

a lo «o 

S fi ^ 
00 S oa 

^4 ^4 ^4 

» • » 

4S£ 



IMS 



OQ . 



Pk OS 




88 






® J! 

as 



25 

O 9 



•n "^ 



Classified Civil List — Counties 



521 



||28||S|8§§gSS5^Sa55SSSS5gSSS?gS^^^^'^^^S 

*- ci M* -i^ -^ -^ ^" ^" «-r ^ fH ^" -X •• 






s 



00 O Ci cS 






'^ o ^ ^ If: ••'5 -N lo lO OS ^ I ^ wt a 

CO ^^ ^M »i< v^ ,,H I 






Q. a. 



c. o a ^ V 












I d ^- r: -9 ii s si t 






c»'^»t«»-'5^«-*b--*oro — -^ 



•fi «if lO ««• ^ o 



£22 2 22222^222222rJ^S5**®c»c»c>o»o»oo«o»a»a»o»a»o» 







S-9 7 J 



a 
I 

- pj ^ J3 P5 

<< -B <0 -S CO 
S 3 2 2J S 



a: 



-■ll 

ill 

WoQg 

Q W ^ 

O O 04 



1 



« 



•si 



C4 




«* c« «e ^ 5 

CO «-• 00 1^ do 



I 



I 




8 

8* 



I 



ft 

d 



(8 






llhnjii 








d 









9 -a :;: .3 .3 



I ll||jsjs|jsl| 



622 



Report of State Civil Service Commission 



S 

'3 



s 
6 





I 

o 

o 

O 
Oi 

o 







8 



00 



o 
2 



00 

at 



> 
o 



O ^ 3 
o o « 

H 

E 

U 

P 
O 

.s 

ft 






88 



M IH 



88S8 



8 



8 




•* lO 



^6 



o CO 

II 



PQ 



55 

O 



3 






« 

US 

d 
o 
o 

s 

4) 

ja 
& 

c9 



»4 

QB w . 

' is 
l°6 



8 



00 
CI 



^ eo 00 t« 

*« r^ ^4 ^4 

0> Ok O Oft 

^4 ^14 CN »M 

* » •• • 
^4 ^4 M fH 

III! 

•-■ eo 00 K 

«4 (iH t-4 <^ 

Oft Oft O Oft 

^4 ^4 «4 y^ 

» * » * 

r4 ^4 c< *^ 



!< H^ 



8 

eS O 

-S d 
2 o 

•si 



a 

O 0) 

C 73 
O C 



00 

r 
& 

00 

Oft 

I 




d 

S 

c 



tc 



c 



s 



M 



00 
oa 

el 



a 

«9 



00 



s 






5 



S 



S 



a 

H 

K 



5 



d 









d 



d 



4 

c 
S 

x 

& 

9 

m 



Classified Civil List — Coxjntibs 



523 



S888S 8888888 



8 



888 

Cl 04 M 



00 <0 $ O CD 

go-l 0> »^ i-« 
Ctt 00 Oft Ctt 



2? 



dT d S g 



GO <o <o o o 

OO 00 00 O) Ok 



.5 S § g o 



^ -* * - 5 

S -»? S2 o d 

M p ^ « « 

lO 9 C9 iM Qs 



o S ^. g J 
£ •< S O 



n 




8 8 o o o S 

^.1 »i< t-« ^^ •-< CO 



(O 1^ <0 O l« lO <D 

<.4 V.4 a ^4 •^ »M Ok 

Oft 0> 00 0> O Oft 00 

^4 vH Vi4 r-i V.4 ^4 •>< 




to t* .« o r* lO 

t^ r^ Q ^^ w^ r^ 
Oft Oft W Ok Oft Oft 



^4^4^4^40 ^4v.4^4^4v.4*ii4fH 







■ 

ll 

JD 



5 



X CQ 

« P5 



o 



CQ Ed 



2 d 

.d 
. o 



^ w 



CJ "2 M 

[^ Ed H 



1 



I 

« 

d 
•§ 



2 5 5 




e 

2 

'*• 

08 

«* 
o 
C 

J 

Q 



S8 


S88S 


SS : 


^%i^ 


CO « 


1 M « »^ «-i 



888 



® ® ^. & & 

25 
HE 



00 


o> 


• ^4 


^4 


•O 


-* 




t^ 


^4 


^4 


o> 


»H 


o> 


o 


Oft 


Oft 


00 


Oft 


^4 


^4 


^^ 


r^ 


»M 


»H 


04 


1-4 


r4 


^4 


» 

Oft 


»H 


^>4 












5 

-< 


• 

d 


• 

d 


d 




8 




«8 


•-> 


(2 


^ 



Oft Oft 



ss 



kl 

2 fe 

<§! 

d >• 

i ^ 
05 



a 
.3 



e 

CQ 



^ ^ 1/9 ^ 

1^ — Oft i-< 
Oft Oft 00 Oft 



^4 ^4 Oft *^ 



s 



•-> CD In 



Oft 


Oft 

1-< 


Oft 

1-< 


1915 
1915 






m 


00 «D 


i 


• 

§ 


Mar. 

Dec. 
Deo. 


Oft 


CO 

Oft 

^4 


0» 


1915 
1015 


^ 


m 




00 (D 


a 





a 


Dec. 
Deo. 



5 8 

8'g 



QQ 



5 

< 

G 

o 
CO 

o 



ll 
p 






-a 

o 



61 o r« 00 

t-« ^^ 1^ CO 



9 
B 



« o 






I g 
d " 



W •< 





T3 

e 8 

• •4 A] 



S >> ^ 9 O 

Hi 

S ^ o 
H ta 08 





O OQ (U «-< vl^ 



B24 



Bepobt of State Civil Seevice Commission 



o 
u 

o 

g 

o 



I 



8. 

E 







c 




o 


o 


te« 


c 


4-I 

•3f 


o 


•"• 


k 


o 


w 

f 


a 




G 
•** 


-** 






O 




bi 






^ 






«d 


^ 


•*• 


e 




o 


■"• 


> 




« 


Ik 


^ 




$ 


e9 




•«4 




a 

0) 





I ^ 

:§ o s 

*ei ••' a 

\ «8 




S5 

O 

1-4 

H 

OQ 

s 



8 



00 



d 

3 



00 

o 



a 

3 



s 




e> 




• 




1H 


s 




s 


e*5 


GO 


F* 


1-M 


o» 


O 


»^ 


i>^ 


fi* 


o 




•H 


• 

o 
<*< 


d 


^\ 


OS 


^ 


•-9 


ro 


OO 


^■i« 


fH 


Cl 


Cs 



»s 



•-" i-s 



5 

w 

X 

o 



TO 




1^ 






?^i 






" ?? P 



H 



o 






o 



CO 

o 

0$ 



2:2 






=^8 



►.^8 



8 



10 



« ^ 00 

"-I ^ ^ 

ffi o» Ci 

»^ »^ t-t 

' • • 

•^ ^ *i 

-« <; 1*^ 

o ^ « 

o o» o 

•^ t^ •-< 

o r* !-• 

• • • 

kl M h 



s 

o 



5 
s 

us 



09 






S 

ua 

o 

o 

Pi 



03 h 



S 

us 
o 



sS 



6 



IS 



r 5 



o J« 

"^ ^ fa 

J* C 
- C >» 



8S « 

f« "^ « "^ "o « 



o 
•0 



10 10 



22 


•-• 


00 


^^ 


CI 


ift 


In. 





^•m 


■^ 


^4 




v^ 


1^ 




1^ 





*^» 


» 





v4 





« 


r4 


- 


«" 




hT 


W^ 


>> 


• 


V 


n: 


« 





, 




^4 


r 


c 


£• 


c 
1 


C/ 


*S 


#i5 




•< 


GC 


■^ 


(^ 


« 


^^ 


« 


^^ 


C^ 


l« 


f 


^^ 


■^ 


^^ 


^^ 


fm 




vri 


cs 


CJ 


Ct 


CS 


c- 


Ci 





<-4 


F^ 


«^ 


^^ 


v^ 




»^ 


• 


r-« 


-- 


ad 








-4 


>k 


• 


», 


• w4 


« 





. 


ee 






a 


1 


e 
3 

•-8 




a 



* .fl JS 






^ t 



O fa 



I 




Classified Civil List — Counties 



525 



8S888S88 



§§ 



8 



8888888888888388888888888 



0» ^ t» 



CO t» QO r« 



C9 C4 r4 »^ w^ r^ w^ 



Cb Ok Oft Ok Oft Ok Ok O 



00 oo t^ oo CO r« 

01 9 Ok O) Ok Ok 



00 t^ 00 CO t^ 
Oft Ok Oft O) 9 



00 00 oo 

a» Oft o» 



00 r^ r« r« 

O) Ok Oft Oft 



^ 00 00 00 00 00 00 
Ok Ok Ok Oft Oft Ok Ok 



^»-«^09«-ie9Ot« 



C4 



§i^j5«^«^g^2 



v4 lO f^ 
CI i-i 



otoa>e«*-iooi^ae>-4i^>-4 



imnit iiiiiiiiiiiiii 






t^ii 



4D •! 



r«ooooe«oke9iOoo 

Ob Oft Oft Ok Ok Oft Ok Ok 



00 l« ^ 00 CO ^ 

*^ v4 *4 t>« ^4 *ii4 

A Oft Ok Ok Oft Oft 



00 t» 00 W 1^ 

Vi4 ^4 ^4 *ii4 »M 

9 Ok O) Oft o 



00 oo 00 

»^ ^^ rm 

Ok Oft 0» 



OkOftOkOkOftOftOtOkOtOftOOkOftOiatOkOkOkOkSOkOkOftOkOt 



00 r« r« »• 

^4 ^4 ^4 *4 

9 Ok Ok Ok 



l« S W M M 
^« !Z r4 v4 ^4 



00 00 
*^ *^ 
Ok 0» 



d 00 ^ lO 
C4 ^ e$ M 



-^ lO lO 



v« lO «N 

CI 1-4 



Otoakci'«a0'^ao*-i»^»^ 



A *9 >» fi 










626 



Bepobt of State Civil Sebvice Commission 



1'^ 

||& 
oil 

s i 




8 




O 
O 

Q 



O 



o 

1-4 

H 

1-4 

GO 

2 



// 



S8^ 



O 



Q -* ^ 
O -^ »^ 
O 0> Ok 



III 



O ^ ^ 

n i-H t^ 

Q Oft O 



.^ Ifl ^ 

»-i eo 00 



2 « 



SS88S 



l§i 



o 

94 



CO f-i 



lo en ^ 9 
00 o S o 



f* . . . 

w ^ s « s 



^ 



•o o» ^ o 
e> -* o «-• 

00 O) o> O) 



•? • . . 



i 



s 

> 
2 CD 



s 



■s 
1-^ 



n 

^1 



el 



II 



^ CO M « 



00 ^^ 



t-i eo 



•14 
O 



2 



ass 

^ 4 «> . 





888888S88S8 

8SSS 



4 vS S 

CM M M 



ar«aOi090iOe3<DiO« 
00 i^ t>4 A w '^ O O *■ «« •« 

oooiooooooooooo 



>« >> 



^ £ O S ^ -? ^ .^ Q S S 

rr r^ 30 10 a 00 tO o o 10 « 

o0ooio0oooo>ao90 



fo f^ >i4 









§(§(§(ISzM 



CI.A88IFIED Civil List — Couhtibs 



627 



8 



M 



S8 



8 



888 
SS8 



8888888888888 SSSS^ 
§§§§§§§§§§§§§§§S§i 



3 



i 






» 



1018 
1917 


00 


^ lO 00 

^14 rH fH 

Ok 0» 0» 

f-4 ^ IH 


1^ 


1-4 


^ ei ^ 


Jan. 
Nov. 


• 

3 


April 
June 
May 



C4 r« 
455 



^1 
Jl 



J 



00 

0» 



8^ 









d 

(3 

I 

d 

I 

d 



fa 

I 

GO 



! 

o 
K 

H 
H 



t-i lO 00 

-^ »^ »^ 

Ok Ok Ok 

•"^ »^ »ii^ 

• ■> * 

«-i « ^ 

^ 2 >» 



^1 



•d 



CO > 33 
*^ *^ o 




o 
:d 

o 



a 
S 

u 

ill 

d d % 



5 

£ 



<0t^c9eoeomco(oeo«DO«piOioioioeoo 

0*iH^HQOOQ<-40^^QQfH^4^4^4QQ 
OkOOkOOkOkQOkOkOkOkOkOkOkOkOkOOk 



eo 

Ok 



<o CO (O 

»^ O tH 

Ok Ok Ok 



lO kO lO kO 

•H *4 ^4 fH 

Ok Ok Ok Ok 



-^s 



•H^^^«0^«0»^»^r^fMfMr^r^O 



iiiiiiiiiiillilisi 




J4 

I 

CO 

■•I 



^^^^{•^13 ^tP*^ -. S « d 



^ td W g « «» fc O . g 

8^ g = |3 a >j d 
10 C ^ tf cd s o 



8 is 
a .9 

•"31 



4* 

J 
1 

3 



SSSSSSSSSS 



S S ^ «j 
5 5 5 2 5 ^ 



d d 

lisiiisisiiiiisl 



628 



Rbfobt of State Civil Sbsvice Commission 









o 

e 

o 



I 



2S 

o 






8888 8 88 8888|||||||888 88 

R Q N Q Q O Q O O ^^ ^^ O O O O O 

« i«i liiii §§ ium &§siii 



Tf! CO CO CO CO CO CO 



ogioioioioiOiOr«(OioiOiOioioiOM3ooaoi«« 
,H ^ ^ ^^cO'-40'<^^ior<reo*-7eocococo«-«^^i^*^«Q 



ijiiiiiiiiiiiiiiiiii 



esc 



to 

s 



§2 



i:-:- 



ioioioiOiOiOi^«ioie«iOiOtoM)ooiot<.« 
oooooiokOko»aae»c»oko»Saia»aaoo 



i-T** •HC^t-ToiH^tfflCcOf^COCOCOC^'^t-^i^'^iQ* 










s^a 



ti^i||iiiiilit 




SI'S 



i^i^^^^^^i?^^^^>'i^i^i^i 



S 

8 



Cd9999999:)39d90999'SSd:S 



CukssiFiED Civil List — Counties 



529 ' 



8 88S8S 8888888888 
8 iSS|8 S88§88S8$S 



888888888888 
SS888888$S$S 



« 


M e <D « e 

M v4 .M ^4 ^4 

«) oa oa e» • 


•M 


o» 


v^ 




^4 




i 


ll 3 H 


»n 


•< 6^ in •n »? 


«D 


ss s s s s 

S S 5 Ok Ok 


^4 


^4 




^4 




• 

9 


April 
Mar. 

Jan. 
Jan. 
Jan. 


•-» 



o 
o 



O CD 






u 

D 



I 



g 




1^ 

Jill 



as 



wtf S #^ ^ O ^* <B 



! 






n£a2iS 




OkSSSSokOkOkSS 

v4^4»M»M^4*ii4^4«M^4^4 

iiiiiiiiii 

SSSSStS!SS8S 
wSODwOkOkOkCKoi 

^4f^^4»M^4^4w4»4r4^4 



is. 




s ► 2 g f' • "^ •» ^ ' 



S 6 ^ M vi^ 







^ 






J J 



I 80 




■« -^ 



^^iiiiaa 



O»ako»ak0k0k0k0kakako»ak 

•N^4^4»i4»i4^4r^^4^4»M^4*i4 

OkOkOkOkOkOkOketakakakOk 

*ii4r4»i4^4r4(iH»^^4v4*^^4v4 




OS 






I 



d 

o 
<*» 
a 

I 



a 

s 

X 



Miiiilllil 



530 



Repoet of State Civil Seevice Commissioit 



& 




S8S88S888888SSSS8 



8 



eo 



S8 












9 



^ ^ 






to 

•-4 M 






2 o 







K 1-4 vH CQ ff pli K 



95 O 



■o 13 



I 

00 



8 c 
S £ 



.a 

h 






"S s 

3 ,2 






c •= 



Q H -i 

8 a & 




o 

is 

« 

a 



333^3 = 3333 




3 

•mm 

I 



.b 2 2 



CI.A8SIFIED Civil List — Countibs 



581 



sss 



§ 






8 



« ^ 



ss 

• m 



3S88SS8S8 
SSS88. 

C» 9 Ok ^ « 



0> 



8 



e o 

P. 



S8S88 
88SSS 



to 00 



8 



CO e «0 ^ ^ oo lo 

Vi4 v« A 1^ *^ «^ ^4 

O) Oft S) O Ctt O) Ok 



C9 



o» o 



to o t^ 

s s ? 






c« 



• 

I 



S4 



-^ N 



II 



f-4^4tC*^lMO>^t-(<^ 



lO 00 lO ^ ^ 

CI ei ^ 



o 
O 






e 



2 



I SS SI 



s 



a» Ok 

1-" N 



C« CO 

oo 



8^ 



C0r«C0OO30OC9<0 

oowooftoowSSSo 

^ I lO ^4 ^4 *^ fH I O 



1 



I 



S4 



SS i|SSl|;S 



0. 
< 







,M .SB ,39 jm s ^ 



o 



M 

s 



S 



S 



i 

a 

5 

d 






00 00 ' 







•X 00 K) v^ •-• 

liiii 




SI I'll 

o> & -i« r* -2 

lO 03 C« M K 



g 

o 

s 



s 

> 






O 



■-s < 






>-9 
IB 



«I 



M 

5 

I 

J« Jtf ^ ^ 



532 



Bepobt of State Civil Sebvice Cohhjssior 



i 

I 




■s-a-? 
i5|? 

8-8 




I 



O 



8 



8 



8 



ei 



8 



M 



8 



8 S 






«0 



00 

1H 


00 

oa 

^4 








» 






W4 


f-T 


>% 


• 




^ 


• 


3 


a 




iS 


1 


00 


00 










2 




• 




• 


^ 


ti 






^ 


• 


g 


>k 


• 


3 
*•* 


8 

*-> 


8 


j 


s 



s 



s 



SI 

"3 






e» 



i 
I 



S 

a 

c 

3 

<3 



I 



I 

ii 

E 2: 



H 

H 

O 

O 



o 

m 



8 

tz: 

J* 



8 






S 



a 

o 



a 









2 



5 



O 
I 

8 






I 



9 

I 
I 

3 



Classified Civil List — Counties 



583 



^S88 









8 88 



CO 



M CI 



8 8 8 8 8 8 S 8 ;§ ;§ J :§ J 

2 O C C O 

2sSa.9?SS9 •- *• »- •- •- 
•""_:"--- ft & & ol a 



8 88 



5 5 S 5 5 

6 u c o o 
m •• lO i-'j o 

O O O^ O Ci 



^ t>. cc « 

^4 *M VM .4 

Ct o c; c: 

• • • • 

w ^ -^ — 



C c a = 

CS 5 «- 3 

•-3 X << *^ 



■Ci C C. C> 

C) ^ ~ -r** 

C C eS S 

ce 01 1^ 3 

"^ X •< "^ 



8 



jO 
Ex. 









< 





o o c c o 

• • • • • 




fflh-t-OOI^'-'^O'*'— CO 






Dec. 
Oct. 





— o 

Ci o 






r* r* o 

S S o 



8»^ t-^ »H S S •H "^ 
O) O O) O '9 o c< 



•© daa&oJS 3 3-g a*© 




04 



5 



< 



• s • 1 1 8 J 




ill 

|ll|siiili"-|8 

o o o o (Z ^ li^ (Z n .1 ^ ^ a 




iS 'fi 'tf '** "tf 

b M I I I \ I 



.M .M 






e 













a d 

cs « 



o o^ 



S 9 




I 



i 



9 
00 



> 



ii 



tl 



534 



Bepobt of State OivtL Service Commission 




8 S88 88 888888 



SS 



8. 

T 

O 
o 

< 

CO 
CO 

< 



e* 



Oft 



5 



5 

-< 



Oft 




Z 



S 



a 

o 

»•> 

S (> .a 

S g J 

o S ^ 

e "^ i: 
!< S £ 

CO 2 

s 

I 



t* t* « 

N CI « 



'^ t*- r* 

r4 r4 fM 
Ok Oi O 



SB 



'^ t*. t* 

vH r4 *M 

Ok Oft Ok 



I 



SS 



00 

O) 



5Jj5_^ 



e« o 

9 i 



00 00 

o *^ 

Oft O) 

CI o 



. . a a 




o 



'J3 

o 



4> 



a 
8 

«8 



a 

hi 

s 



C. 




S lo s 



8 



r* CO ^ 

vH o v^ 
Oft Ok Oft 

r4 ^4 ^4 
III 



8 

o 

H 



»^ eo «o 

*H VH «-4 

Oft Ok Oft 

^4 ^4 ^4 

« s tf 



r^ 00 *H ^ 

«M O ^H ^4 

a» Ok Ok Ok 

*M ^4 ^K V4 


1913 
1916 


* » « » 

^ 00 00 00 


81: 


Aug. 
Sept. 
May 
May 


July 
April 



II 



•4 « 

>4 >• 







Classified Civil List — Counties 



585 



88 



8 



8 



e^ 



888888 


s 


lllllg 


o 

CO 


CI ^ ^ ^ ,M «-i 


e« 



8SS8Si7« 






^^88 



T3 



^ ^ d « ^ g g g g g g - 



p. 






3 






3 



o 

9 

o 
u 

o 
Soft 






a 






I 



I 
& 
g 



00 


«D 


(O 


«D 


«D 


o 


9^ 


w^ 


»H 


VH 


r^ 


^^ 


a> 


o 


a» 


a» 


oa 


a» 


r^ 


r^ 


^4 


^H 


r^ 


*4 


^4 


• 
^4 


Pi4 


^H 


t-l 


^H 


• 

ft 


• 


• 


• 


• 


<^ 


o «> o a> V 

fa fa fa fa fa 


(D 


CO 


«D 


to 


o 


o 


-H 


*^ 


^4 


^4 


^^ 


^4 


a» 


O) 


o» 


o» 


a» 


o> 


»H 


*4 


^4 


r4 


»H 


^H 


^N 




• 






tH 


• 
J2 


• 


• • • 

ja JO ja 


• 


t> 


o 


0) 


C 


o 


fi 


b b« pK4 Pm Eh fa 



5 



5 
o* 

CO 

O 



^ 



fa 

t 




g 



s. 

« 

w a 

fa 5 #^ § s5 fa 
•*< .t: fa Z^ 

*? J iS f*< ^ "? 

o S ^ o o 




^ 






M 
OQ 






a; 



a c3 a q a a 

c a a a a a 

U V V 9 O V 

4-> «J '<-> -^ '^ -IJ 

^tJ «J 44 «« «J ^-t 

e) cS (8 (8 c8 c8 

■^j .*a *» ■^ *» *» 

s 3 3 si a 



as 
o 





00>0>00>0»0>0>0>0>0>0>0> 


^4 
• 

1 


r4 fM *H r4 pH 




000>000)OOiO)0>OiflkO 



d 



.?fa.?fa<^<<^^»?,? 




do^ofafSt^faS 






GQ 

D 

CO 

F- 

o 

s 

O 

a 



IS 

•c 

-s 



a 



^ 






S Pi Q, a a a a 
~ «; o o o o o 






DQOQQQaa 



3 3 



\& \& 



O. Oi.S JS 



536 



Report of State Civil Service CoMMissioir 



8 



O 

i 



a 
o 

i 

s. 

6 

o 

O 



c 
o o 



^ » I 

« c c 

« s ^ 



a 
c. 



5 



I 8 

is 



» o « 

I 6 t- 



o o o ^ 

- — gggsss 






S§8S8 

s s ^. ? 5? 

O * « o o 



« 



-ft'* 









c c *r c c 



C^ M M M M ?^ 

i t t t i C 

c = c c = c 



2 

c 

« 

s 

?! 
?! 

3 

o 



o: 

H 



OD 






^«fit^^t^XXXXXX 

O Ci Ci o c; c: © c c o c. 



CI CI CJ c>< W CI 

e. e. c 0. o c 



-I tS o ^ c 

-5 J « ? i 



.? s I s :; J? i 

O U. Q 04 



.id 



I -2 I _ 

c 53 O c5 j2 ^ g 5 u 

C4 ^ t-i »-i C? 



I 
c 

3 



O 

X 






c 






o 

<8 



B 



C 

8 a 
S 

S • 

«( « 

OQ U 







c e 



r^ ci 5 «f « 

w* ^ ^* ^9 w 



•^ M I?: e c 

CI CI — 

• • ^ ^ • 

c = - t c 

•-s -^ •< < ■-» 



r^ ci X — 

,mt ^ ^ ^ 

CS C5 ?. O 



^ CI 1^ o 
CI CI 

. . > ^ 

C C iS ^ 

•-s "^ •< < ' 



H J! o 










ill 

D 



= <3 



1^ 

a ^t 



£c2 



o 

a 



e 

5 






S 

a 



i 



H 

H 



a. 

a 




la la la b k« k 

s s 2; s s s 

o o o o o o 

o u o o o u 



Sw w w V w u 



^ e fi e s s c 







Classified Civil List — Counties 



587 



8 

s 



8 
8 



888 

S 9» CO 



8 8888388888888888888 



o 
le 



8 






8 



O 00 00 



s*- 



8888 

to CO CO CO 



CO 



•^ « 





«ii4 

Oft 


r« i« to 

*« *M ^4 

Oi O) 0) 

VH VH V^ 


2 


* 
^4 


v4 


-28 


o 

r4 


• 

a 


• 

3 


Nov. 
April 
Deo. 


3 


p4 


O 

w4 


^ r* to 

O *H vH 

O Oi o 

*« •H ^4 


Oft 

«ii4 


■iJ 


*4 


o o »o 

v^ •-« «ii4 


o 


• 


• 

d 
ef 


May 
April 
Feb. 





^•ooooao^t«c9t«ao««^t«^r«90co<H 

OiiHr4^4vHv4i.^O'Ht^OOO<^00*^'^*^ 

wwOiOtOtOtflkOiOOftOOOwftOftOOOiflkOi 



CQCOUdiOfM^<NC9*4COcfe«CI 

X f^ ^ <S Old 9 ^iSiH Q<ftft 



*-l A lO <M C« lO 






^ 






r*ioooOQOfr*'-^r*oO"*'^r*^r^ooco«-« 

O^OOiOflkOOiCftOwftwftwftflkOOftOflkOi 



CO CO to to •-• *H 



"N N -^ CO e« C« N 

e« d N »- c« 



*-4 A lO *H C« to 



I 



*C 



a 3^ !• « § 5 « « a a ft 



as 






a 

OQ S 



I 



« 

o 



> 

1 

« 



a 

O § 
H S 



i I 



1 
-I 



*3 

o 



9t 
H 
W 

» 




s 

> 

S 



o 



5 

00 




i I 
I 



s 
& 




588 



Bepobt of State Civil Sebvice Commissioit 



8, 

T 



O 
O 

< 
CO 
CO 

< 



a 
o 

I 

I 
6 



a 

s I 

Oi 



o — > 
S*8 



8 «. 

ft 

«8 



I 



I 
z 



7: 

o 



O 



8 S 






e« 






^ 






o 

cS 






5 



C3 

o 
O 



9 



Eq 



I 



hi 

e 

3 






SS833S8888S8 



04 



O O 00 t« C« 



to to lO lO lO »« 






le lO oa *-• 






O O 00 

w4 m^ 9-^ 

0» Ok o 



to e to lo lo »« 

V^ ^4 ^4 r4 ^4 v4 

Ok Ok Ok Ok 0> Ok 






ii^ ti 



2 <S(Sqs^sssss35 



4 

0. 




C 
3 






„ i. u 13 

S.S. S.I 

2 g £ '^ 

^ ^ ^ ^ 

S g I t fe « • 5 



4^ JM Jtf 

3CD 



• 
OQ 



8 






s 






eS 



as 



I giH 




3 



Classified Civil List — Counties 



589 



S8 SS88SS8SSS8888888888888883888S 
S§ 8^^^'^§§§SS88888 



^ 5 






a a 



oo *n 
oo 00 



•^ r* 






• m 

09 OQ 

U 



flQ g 
o 

l5 



0(y>t«cgr*or>Aeo*4 

OAOOC^flDoSSOw 

^•-•»Hodeo»^»^o»»^»-4 



§ioiooo(D«Dr«ooooooooMoe4t«t«ooooooio 



c 
es 



c< ^ o a» K a» 

»^ ^ l-^ ^4 VH 



v4 fM r« 



^ hj ^ ^ ^- rJ r£ g* 



«* » M 
fM r4 lO 



i 1,^ 3 1-8 tt I I i -8 l-t-ls i g I S S -8 -8 S 8 8 S 8 1^ 



r« cr r^ «o «M r« r^ 

o c e> o a o r> 

O O 00 A 00 O O 



*^^oo^oo<-4qet«XiHM 

Oft00t0000>99000t0 



r« t« 00 00 o 1-4 

w4 v4 ^4 vH A ^4 

Oft O O Ok 9 0> 



•^«-«i-««OeOr^»'^»^^»^N»^ 



a-^ss 



0)iH<-4cor«okf-ico^e«io 



S3aa-S2 



Illlllll|is|s-t3^gs3§g«s|lliji-8s 




.s 

o 
o 

•c 

I 

s 

00 



COCCpCOOCGoQOO.oooOoS 




a 



:s."^"a. 



540 



Keport of State Civil Service Commission 



"S 
8 



O 

o 





a 






o 






*» 






S 






d 






s. 






E 






o 






O 








a 






o 

•s 


o 


'** 


S 


s 


S 


0. 


eS 


B 


«• 


fi 


-» 


a 




s 


a 




c 


8 


•s 


• ■i« 


> 


5 


8 

B 

2 


8 
*> 




B 


*s 




0) 




t 




«> 


a 


«aM 


B 


V 


o 


u 




« 


6 


S 


S 


.9 


1 


«8 




s 




et 




• 





8 










2: 
o 



o 
z 

§ I 

O . d 

s si 

O °° J 

9 






s 

■< 

o 

a 

H 

M 

H 



88S 



iC CO 04 



00 o (O 

VH ^ri «ii4 

O Oft o 






00 <D CD 

»^ »i^ 1^ 

a» o> o 



"-J fc »-s 



CO <M 'H 

^ OQ ^ 

>♦» » ^ 

«^^ 

$ Oft N 



I 




E 
6 



888SSS3SSS8S8SSS 
S^s;5^g?S8 88S| 



S2 

CO 00 



eo CI 




Me4<oe«<«ooooe4e«<«<««aoat> 

0>0>0>0b0k90>0ft00k0b00k0l00 

S (JS 4 (j^ s I (£ £ £ S S £ £ I S < 

dftAa>oo9>oo>obO) a>ootok9o 

g|£g j^£g£S?;£gls^ 
::: b ;: ^ •:*••••• • 

*i OO J < *i -• r ""^ ♦i 03 *• . « * . : 
WO00W^**«0««-«-^ipc9»^'*«$ 

ci«»M<^'<>«HiO'<>ioe9ooeiSS9^e» 




o 
6 

•S tt O 
^ 5 •< ^ 

illlUlJ^ 



9 






iiiiiiiiiii 




CuLBSiFiED Civil List — Countibs 



541 



88S888S88§8SSS8S8S8§S3S88S8§SSS33S§ 



^SSSSS888S8888S 



o o o o p --> 
M e* M »*i «i c« 
eoneoooooo<^ 



n 
or) irt 






'aooracaoocxaoMeo^aoiOioooaoQOo<Deo^^'H<^>oo-^9>9e^t"C40>oe9 

^ ^ ^ ^^^^^^^tti^w^ ^ ^ ^ ^ ^ ^ ^ to ^ — " —" -h" ^ ^ -N* w — * o' -^ «o r>.' «r 

rj r 3 33 3 3"gcoc-g3oO ai5 g g"? ^o o «» 5^ ^ ^ H ^ SJ« Q-JhiS 

aDocoeoeoeoeQO»^^•^aoMM^^^oc^5>e>^^<<^»*«lOO^^«a'^^r*lf^^«l^« 

3333333S^»«g5as'DiJS*S'3g'oo<»2^c.^^i22*Qii2»2 

• ■ "r.'ci :' '6r<o6^6 'o • ^ ^ >^* ^ ^ ^ o ! :ooo : : :0 :Qo 

. • • O W rS '^O c'^O * *..•►»' U .• ^ • r'v . ..• . r> . ^ iJ .V* ^* . 









CI 

t 









M C' 



K 



r « — 



* .r'. "J 3C 






•5 « 



^ -^ C ''^ 



^ S S S B 

^ cT .3 S 6 .S 



"a 

^ j2 o 
-r; 'u6 55 



-1 



e 
Q 






9 ^ ^ 
<8 O 



S o - 2 § -5 



e 
o 



o 
< 



S 

el 

CO 



a 



■» ^ 1-4 



s 

5 g 
>» rt .3 — 

• 9 



-5 V 







^ Jrf J4 .M ^ ^ 

o -3 



M »• »« ka >« M 

o o 9 a» 9 o 

•=»•*•« -S -3 -3 

M M M 






6 

d<SI 



55 w O 



c e 

:^ p »2 



1^ 

B 

c «^ ^ 

•< ^ ^ — 
o. w ^ u; 



S 
•a • -S 

•31-s 



o 



•^ "-J >-i S5 
•-^ ^ C OQ 



o o ^ ^ g g 

M ^ J3 M XS ^ 

a a Oi a a a 
2 C 

o o 



o 



.2 



3 

6 

a 



eS 

a 



J3 

3 



««ov«o'Z'S'S'S'S2SadC3a 

iiimaalsliislill 



. hi M k M b hi 

b 0) « C « V V 

O "5 rs •« -^ -TS -5 

.^ d a c a B a 

r -Q _0 -ft /^ ri ft 




£ 

1 

c 
c 

M 
w S 

•9 2 
§^ 



OS 



I 

d 



542 



Rbport 07 Statb Civil Sbrtice Commissioit 






o 
o 



i 

& 

i 



•3-9 



1 1 

s'il 

8| 





8 

eS 



7: 

o 



O 



88 



S 



o o 
2 « 

MOO 

« a I 

• re ^ 



la 
P 



o 



5 




3 



»« 


00 


eo 


v4 


*M 


r4 


a» 


a> 


a» 


^H 


^4 


w4 






» 
r4 


>i 

3 


• 

a 


i 


•^ 


»^ 


•-> 



00 CO 



2 



s a 

J WW 



H 
M 

w 




o 
o 

2 - 
o 



J 



S -^ 

" 2 

a 8. 
Q '^ 



8888888SS888888S88 

O 40 <D k3 CO CO CO CO so M CO 



88SSS 

<r v^ e « «o 
ci ci" »^ »^ »H 



r^«i«aQ(scoc«eMe4«oe4e«e««oe«cfe« 

Oi0k000k990k0ft00k0b 0& Oft A o O a O 

«-iooQDooooaoe<o^A^AiOio^oDr»ro 
oSS^oooSoSoSoioDotSSSobSoS 

,HfMr4r4r4«Mv4«-4^4^4^4vHvN^4vHi-4>i4«4 

|ll||fc-|||||||lll|J 

'^e^^^*-iaft*o*-*c9Q*^e«coeoh>esfi 
oo^ao*-iratoc4t«e4Mi0^^coeoeoao<« 







n 



.2 

O 

V 

u 

•a* 



'S'o'o'S'S'o'S'S 
oaocoflo ~ 



J^ M M :^ M 



p 8> o • o e 
"S "o *3 "o 'o 



^1 






ao 



• ^ t^ "^ ••^ "^ "^ •»>4 Wfl^ •5? 

rt (^ o '^ r» ft *N S c* " " -_^.— 

p » 3 6 o o 8 SJ^4S<sjsi^I 



Classified Civil List — Counties 



548 



8 



8S888 



88^ 



o 

C4 



« ^ CO le 1-4 



SS8888888888888888888SS 

888888888 



8 



9 

^ 



CO CO 



c«e4C4coe«coco^^e«e«e«C4e«ci 



o 



o 



s 



O 

m 
m 



n 



^ 00 le 00 t« 

^4 r4 «^ ^H r4 

Oi Oi a d Oi 

w^ t.^ m4 —* r^ 
w^ to T-i ^ to 

d d g 23 » 

O 00 lO QC t« 

*H ^4 *i4 v^ v4 

O 9 Ok 0> O) 

^4 vH vH v^ VH 

«-< «0 "^ ^ «c 
•^ "^ w <* ■< 





2222222222288«S§8S©SS8S 



j.^c|r^^^^-j^«„gj2-20«gg2:'""S 



. « 
e d 
« 9 



S-l-s 2 § s 8 a3 a s » s -l^'^^-gt I 




-3-3 



o 
o 
o 



8 8 

*c X 

o « 
a a 
d d 
• • 

d d 

« 08 

Si 

'S'S. 

d 

o 
g 
B 



a 
o 

a 

6 

8 



u 



d 
"? :* -^ 



^Slfv^'ia^-^^daSSadcaddcedd 



o 
d 



544 



Kepokt of State Civil Sebvice Commission 



1 

"8 

8 



>4 

H 

O 

o 

o 

5h 



g 



a 
o 

o 



2.S 






1 

a 



! « c 

C O 



*t o ^ 



:s 



e 

cS 



2: 

o 



O 

04 



S§8SS8S8888S888SS88SSS8888 



8S 

O CD 



T' 

« rl « 

a 



H 



^'^o-^o^a^^^aaaaaaa «a a ^ a \i £ £ a 

o 

■« 

::..:.::::; : o T^JTTTTTTTTTT : 
o : : : :„ : : : :d r^-o^-ob^"" : : -riZ- ■ 




86 









^ £.; -g ^ s •* ^ 



eJsSsgg* 



5o£«g«--^ 




'o'o'S'S'S'o'S'o o o o o o oo o o e oT'o'BoiB^* 
aadaaadcaacfldaaac 

ooccoccooccc3ocoou 



o Jo 




Classified Civit List — CouNxnts 






g88SS88S8SS888SS88SSSSS8S88S88888S 
SSSS8 



i3?ii 



28 



2 2 
^ 3 



o o 



ZZ mH mi m* mi mi ^ ^ ZH w^ "^ f^ ^* f"^ r^ f-^ ^* ^^ t^ '^ ^* '^ ^ '^ ^* ^* ^* ^ 

^ «; -i; ^ « -T ^^ ^^ -h" o o » « o* c -^* o r>: ^.' o « - ?2 "^* 12 ^* -* 22 »2 '^ '^ '^ '^* "^" 

Ills j:g^slal>^lcg^^<cj!J8J'<Sol^>gSc:ss<s>^^ 






O to « "* <0 CO ?0 
•< O »^ ""^ "^ "^ "^ 
9 O 9 O Ok A CO 



0» 5> 



00 00 

m^ m* 



00 00 00 

v4 aH •irt 

03 O CD 



> 

o 
Z 



»H iC O ^ •-« iC K? 

^4 VN ?4 ««^ »« 



l^ ^^ 



•H iQ 00 00 



»5 •< Sfci ac "n I* Ss* 






4, « 



&^;g 5.9- ^'31^2 



^5 -< 

oa 



•ft N 
CI 

< U, 



'T'T^WNO-^'-' 



^ •-> Cb 



• -: .; • * 
4> « * 

b. (hi Q 



3 3 



>*6 




5?i 



OS ^ . -5 
•o-oZ o 

^ 30 .tJ i^ 

■* "5 fiu o 

^ ^ «0 M 



OX 

n 



> • 



o6^ 

ZZ5^ 

d O g tC A 

•2 •H »T "^ •^ 



s§l: 



Ki c^ "f 



O • 

o :5 CO 



o 



r* 
o 



Z ^ 

» • 

1=2 



a .2 






* 
e « « U 2 






. % 

^ ® ^ jd g g •? 

II I 2 5 2 i 
•^ *^ O b, < O b. 



Oct* 
•fi 2 "^ 

p. O c 

53 






6' 



I 






09 



• 

be: 




646 



BxpoST or Stats Civii, Skbvick Couutaaion 






I 



o 



3 

7J 



888888S88S83S888SSS 

§888888888888888888 



IIIIISslllljllllll^ 



55 25 



>ia5 2 2i 









• 6 



:6 



*- ^ 2: ^ . . o 55 



2: 



a . - ^ - ? ^ * - QL »^ ^ « 




6 






i? 



I 

I 



«• « 



,1- - 
^ lis* 

llljllj 




si 



o 

ii 



•« «* «« «* «« •« «« 
a a a a a a a 

8 8 8 8 8 8 8^ 
5 ii S i 5 i5l 

1 1 1 1 1 1 1 



iiisiaiiiiiiiiiiiii m 



883 

* • • 



III 



lO ^ •« 



§ 









O 



O 



.>* 



:f: 



u 



2>i 



5 'iz 



OQ 



i 



-9 5 • 

e ^ > 

32S 



o 

B 

o 



X 

p 



Ci.AB8nnxD Cnm. List — Comram 



547 



88S8 
§§§§ 

■ * a > 

r« r* »» t^ 



'T ^ r- 
S S S 



6o 






■* fp "^ 

r» m « 

^M «rt M« 



S ^ a <3 
Ian 



888888S888S888S8S 
§§§§§§§§§S8888888 






O^Oo^iOvHoHt-iviNtM 



« • • » » 



III! I^ll^2|gill|ss||| 






0^0*«M9tM^i**4vHv40 



g--g_ 



l|s| Jllimiislilllii 



00 



s 

M 



• • " 

Z . r 

00 ^ ^ 



J 9 O g 5 



gsSisSisi 



00 .a! 
~, r CD 

III 

« M O'* 
•- ^ « 



^ ^ o • • 

^ . >< • • 

2 55 ^' ^ 55 

. .2 r r 



00 



00 M 



.e *= _ _ 

•* ^M mm ^ ^ 

^^ Sal 

si^ £c3u 

K fl S -• M 



>» s 









I 



e .!f d 



IIIM 



I 



5 j e 2 

J*JUIo p i gJS-5-S S ij.3fl 
t2 4 ^ s -< » j^ o :i o 4 2 ^ ^ 



•a s 

O c:2 S z 

I mil 

^ 5 4* «« *« 5 



i^- 



i 



i 



S : .3 3 a 

•5 S ^ a »r« 



9 
J? ^ «• ^ 






& 



•f -f S5 S 5 S55I 
aocflcad'^ 

5 5 



nil nm 





8888888888 



iiliiiljjj 

•••••• F\ • • • 

• ^^ • ^ , • - 

^ 55 2 2 2J 2 : 2; 2 35 

» ? » » ss It 1 :3 » s 




999999999J 



X) 
09 



4> 



S 
6 



548 



BxPOBT OV StATB CiriL SxBVICK C0MMIS8I03r 



II 



i 

g 



I' 



8 

8-8 

ll 
I' 



j 



o 

B 



8 



e 

8 



888SSSSS8SS8SSS88S8SSSS8S 
SSSSSSSeSSSSSSSSSSS.SSSSSSS 

£tt Cm fi# ^4 v^ v4 fli 

H 9| j| H J 3 J s i 3|3| i^l i||| i 

o iridd : '-rldtl -d^ ^ri^^ ^driJ '6/' '- 





•S-; 



li 



S ! — * 
e < i "8 1 1 









o 



•« 



ill il-^lllJiu Mill illll 






•S •{f -M ^ j« ji j< ^' ji >f ji ^ ^' 6 I • § S» I : 








lilli 



5 
I 

"8 



Classified Civil List — Countisb 



649 



8SSSS8S88S8838SSSS588S3SS3SSSSSSS8SS 
e88888SSa8^888|8888§88Sg88S888S8882i 

C4 ci e* c* ci ei C4 ci e%.e% c* ei ei ci ei ei ci ei ci en ci ci ci ci ci ei ci ci ci ci ei n e% n n ei 






€4 c« ^ e« ^ e« 



^ « -< 



CI ^ 



«-• i«* e« -^ ei 






e% CI «4 

"^•S-S I s' ^ 



4^i 

J* *^ J2 w 
&• «« O *n 



III 



U3 

e 



• • . * • 

. ^ ^ >-* ^ 

►* 25 55 „• 55 

8S§S§ 






• • • • 

«• ^ ^ • • , 

M a O ^ .^ U 



>>;S5 



i = B 



o 2 w *» "^ « 



S5 55 J 



J ' * 



I 



sis 



^Bcpars^ 



^ CI 



^ Q a 

CI OD W 
— P^ lO 



• • «j 

< t ?•< 

S i^o .S 

55i «» 

. ^ 8 «•• 

O t* Q 25 

^ « 55 e« 

^* ^« iM ^i* 



M g ^ «|i 

•* « «2 

o vM t« e^ 

« eo «-« c«» 






^6 ^ci^oo^ : 





§ s § s s 

•O tJ "O •« •© 



JacaaaqcaaqGaeqaaGaqaaqqae 
gaaoccaedgflaaaaaaficcadqedgeeaaaaaadd 



660 



Bepoet of State Civil Sebvicb Comkissioit 






>4 



O 

o 







111 
- ^ 'S 



o 

H 



! 

z 

I 



ggggsssSSSSSSSSSS 

§l§§il§§§§§§§§§§§ 







II 



a a a c 



''•S 



a 



"O "O "t3 "U "O 



s 



■'I 



•S-5 " 



a c a 

^0 ^0 ^0 ^3 ^j *w ^0 _ _ _ 

aaanaacGacaGGGcat^ 



8 888 

§ IS 

* m m • 

tt» O l« N 



O 
O 



r* o - 

^ «« «« 

IQ (i^ V4 



5; « *• 

*5 "^ •! 



K O 9 

w4 aid w« 

• • • 
IQ ^ «4 

in 

Si « 




a 

5 
1i 



5 



Classified Citil List — Countikb BI 

SS?SSSSSSSSSSSSSSS8ES8SSS3SS888SSSS 
g§l§P.§l§l§§§iii§§§|§8§§§8|l§§§§i§§ 



i|s|^|ss ss|s|||||g II s3a|J|^|l||J|J| 









s=Ss§ISIs5a 



Hull 



llllllll lj 



fiiiii 



lliiillimiimiiiiiiil! 

iiiiiiiiiiiliyiiiiiiiiiiiii 

llJiJIIllllllllllilllllllllllllllli' 



652 



Report of State Civil Service Commission 



I 
o 

O 



a 


1-^ 




Q & S 
** s 


(3 9 


• S 


^ 8 


•s-!! 


^ i s 


e| 


g-8 



i - 

Jo 2 

I 5 a 

in 




95 

O 



s 



I 



SSS8S8SSS8SSSSS888S83S88 S 



8 



r> o 



^888888 



888 



S 







e 



E X 
« c 



5 

5^ 



'S 

«8 



C 
O 



s 

1 

c 



^ JC 1, 

a 



< 



t c 3 ;s 



9 "• 






ca 



n 
e 
« 



•s. 



S3 S ^ 2 a 

u e *a « M 

s*« • -3 T- -^ 



X -^' 



^ J 



£ 

at 

33 



ft 



s 

e 



«>09i9«c«e«e« ^ 









c 



e 

u 

S 
•c 

.9 



e 

2 

A' «« «* 

« <a (t 



E 2 
22 



c 

X 

e 
2 



•C X 

J .a 



3 3 



c a 

2 2 

S3 

3 3 



s 

2 

X 

.2 

•o 
•*> 
e 

ffS 



• «« ••« •«i« •m^ 

SI32 



c 



<a 
X 

c 
2 

$ 



O tt 

c a 

u u 

O C 

at « 

'«' «* 

o o 

X X 

c c 

2 2 

« m 

£ S 



>k >i >> >% 

«. V «> o 

E £ S g 

2 2 5 2 

« « « «s 

*** •** •#■ •»« 

u ki C X 

^rf «< «■< «4 

fT « « • 

•c -o -o -g 

-tJ *< 41* ^ 

c c a c 



>> >k >. >k >i 

«> & ft) 4. a> 

a e c c c 

t. ki ki •• k 

o c c c o 

«< «« ^ «> 4-> 

((. « a «e «s 



c; 08 « 
«rf «-> «« 



<a 



>. >i >. >> 

3 3 



£ K S 2 

ca « « 2 

>k >> >t >k 

»> «rf •■« 'tj 

3 3 3 3 



X X X 

^ «« *J 

.2 .3 .S 

•O •© T 

«j -tj «< 

CCS 

ee cl 06 

«^ w «>< 

.5 .5 ^ 



S 



* r. 

« 1. 

(3 « 

«rf «« ♦^ 

3 3 3 

a a (^ 






X X 

.2 2 

C K *; 

♦■» ♦J t* 

« « C' 

s $ 

3 3^ 

a a ► 

Q Q 04 



e 

ol 

1 
2 



e 
e 

« 
c: 

8 



-^ u M J* M 

X », r 

4. 3 e 

^ "^ "S 

CO ^ 



3 S 

jg _* jt p 

♦**»«* .5 < 
e c c •«' «« 
«> ft. & ^ t; 

E fi E •X 

a " S-al 

•p< •** -^ W i3 

•« T3 TJ ©^ 

a c B 5 

*« a^ M W 



CuissiFisD Civil List — Countixs 



553 



l^||S 8 88S8 S8 S8SS88S 88 82 3S 8 
11^5i^?^S^'SSSSSS^?S5 5SS8g 



882883888 

§SS8S^^s8 

lo ««•-«•-« N ei c* ©• 



c«-£t^c9aoioeo^h«i^QOxt^cDr«ooc(Ch.cDO<oooao 
o&Oftoa90Ci090ta>c:ekO)oo>o»ooe^o>a>oao» 

• Aft * 

SSoS55?s?S5<=9'>uS'3&(3dQqQ^S 




• ^1 
SI 

■3 - 



a 






5 i sl 







•8 

.a 
3 







5 S i^ 

00 CO OQ 



V a « 4^ «) 
■ m »• c 

> > > > Se 




12S2e2S83^S 





QC -« M 

P^ V4 Vi4 




r4 •« 


00 


s' 


- • • 
«4 »4 •^ 


• • 


• • 
mm mm 


^4 




• • • 

e a a 

«S « fl 

*^ *^ -» 


April 
Juue 


Jan. 
Jan. 


"3 


• 
• 


• • 

• • • 


• 

• • 


• 
• • 


• 
• 




a ± 

jr. 



3 
1 

d 

M 
t 

•s 



C 



S 



^ • #* fc. "^ I. 



^ JT 

Zc 



11 



*: (c 






-^ 

O 

d. 
S 

-•4 J4 J«l ■♦- 

U .. fc 

«• C O 



^« »-\ W >. >^ >J 



554 



Repobt ov Statk Civil Sbktio Commissioit 






1 



o 



I 



8888SS3S8SS888S888888888S 



MeiMMeiMMeiMMeinMoiei 






§1 









• • O • »^ r • 

>: as ^. r >i >; a; 

» 6 ^ « CO 00 I 

'"ill 
^11 




^ < ^ CO 
3 _ CD - 



c a *■ '5 **• © 
5J|g 1 = 
«• ^ it ^ .1 «. 



o : 
• o 

ox . 

Z *i ^ 
.CD J 



sgssssss 

^ lo ^^ ** •* «^ 



^ •< ^ ^ 



u 



'f ►• CO 

IQ ai* <-• 

r« (O M 



>.^ • • ■ . 

-< aS . r r * 

e s 9 ^ 1^ ^ 
•H e« S «4 M -^ 





* O I H I ^ S ^ ^ 5 5 ^ J . •§ O (^- yj r . e S ^- i^- 






Ci.AS8mxD CnriL List — Cotjhtim 



558 



SoSSSSSSSSSSSSSSSSsSSSSSSSSSSSSSSSSS 



«o <o <e Q r^ 
»« >• r« <e 



o»o»o»a»oio»o»o»o»o»222222 2s222s2s5sss222SS222 
•* •• « -' -* V -^ r^ ctf -' j5 Qo -: -• -«' *-• g g -^" 2 --* -' o -* -*' -■ -* -« 2 2 • '^ - » jj 2 

odkoieiae»e»ooio»e»e»cio>o»e»akoaDaaakakeiack22^2222 

4<S (?l o 5 5 *« S5 55 5 £ ^ o 2 5 •? 4 4 4 £ 5 o £ 18 S o o 5 ^4 (2 -3 S fi 
ilS||| = S2-|^-e|a2s2i«2g5«52-Ss|g|j|5s 









"i "3 " d w M 



_ _: o •§ ■< * p 



•3 *» 







llililllatStS4l;i^ 



«3 e 



I 



•II 



as 









s J 



•9 .S Q & .3 A .5 Q 1 # T .9 ^ B c 



I 






mm mm 

2 s 

s t 



S S i S S i S S S a S Si S Si S SZ^ I^ } ^ ^ 







« 




*• W I- — ^ 

^ ^ ^ ^ ^ 




^S^^w^ 



6S6 



SspoKT or Statk Civil Skrvick Comuissiox 



? 



o 

o 



1 



111 

<sll 



III 



8 « 

S'sl 

III 

pi 



i 



2: 

o 

mm 

H 

00 



SSSSSSSS8SSSS83S§8SSSS888 






1 1 8 $ 1 ^" S ^ € ^ ti c* ^ 2 i t5 1 i S i 8 fl ^-5 B 

^Q09Ao>aftoo90ba»ab999ab9ia»9e»oakoia»ai 

S - « S • a g - -■ ►•■ 2 gS 2 S 2 "' S " *■ - •* ••■ - 8* "" 

"Bs58e2li5S*i§i§5S2^55s 




•o • a 









- q B % 9 Q ^ 2 




« •> « 



b h k> 



tl W 6 . _ 



= ^ « 



^ ^ 



o a< « »* w ^ w 

H ^. ?. t e: 



1 1 1 g 
I 1 1 I { I 




ffililli! 

££££££££££»: 




Classified Civil List — Countixs 



657 



S8S88SSS88S888S88S§8S8 



C9 M ffO CO 



t0 



CI 

o 



««( «0 «B 
**! P« C« 
O t^ t^ 



to 



<0 



CO 

C4 



CI CI 






CI 



3 






3 



8 



88 



« M 



888 

1^8 
« ^ t* 



aoron«oaft«^»oio«o«ot«ooaoaoaoooaoooioce»^ 
aftaft900eft0ftooe>cftaftooao>efta»ofta»afteft 

C|f-4fiirt«i4 Pi4l>4«.4 COM 

aot^«eoeftcoeo^'«x?o^aooo']oooooooQe*/»(9«9 
oooooafteeftAeooAooooeftooeftoi 

»^o-^«i-HC>^e«^r*^offcf^*""0»fo«H^»-o»J'irf 
dc^v^ *4 CIC4 «irtv4 «i4 eoci 

:.::::::: :o : :6 ::::::: : 
•^••.•••ui.**- 

QOij;«'ir-o»-«'2;dr».«i55 — cicoos»2!5C««o 
eo»«?ociciiOi>*e«r*eo^<«<-4i^^<ii:ci^ZiDto« 



• 

CO 


1.1837 
1. 1012 


1. 1016 
1. 1012 
1. 1912 


3 


Jan. 
Oct. 


"3 o § 
*^ 7. ^ 


*4 
• 

CO 


1. 18S7 
1. 1912 


1. 1916 

1, 1072 

22. 1011 




Jan. 
Oct. 


•n -» ^ 



o 





*J so 



laiiiiaiii 



1 




lit, 



«) 

^ - BC 

d d c 







2 



9 



.•I J« .■« 



558 



Eepost of State Civil Seevics Cohmission 



IS 

I 

H 

O 

u 

o 



d 

o 

'■3 

J 



ill 
s2 




I ^ 

l-ll 

S • 



CO ra Ok •^ 



S 88S88 8888888 



9-» t^ t* n 

S o o S 

^4 v^ v4 w4 

•k • • • 

I CO ^ ^ 

"^i si 



S o -^ 

00 S a» 



• 

I 



•c 



n -* w* 



a fl 



:!(«4 



2 

O 







~ *• "w 

- O Js 




00 



i 



00 

o 






o 

s 

■ 

K 

H 



■O M ^ ^ 09 



00 00 00 <0 00 

^i* «i4 w4 -v^ *4 

Ok e» o o e» 

IM W^ ^H *« ^^ 

00 ^ O O O 

«4 v4 «4 

. ' • 

c S •£ a 

<a 4 « > « 

•n -^ "» » •> 

00 00 00 iG 00 

w^ m* w^ m* r^ 

0> O Ok 0b Ob 

^4 v4 ^4 v4 «i4 

00 «^ o Ok o 



B •€ O 



O Q C „ 



• 

2 



« 



X S 



• 

an 



S 
I 



2-S 

§2 



o6 
>'*>i 

• 

• 

:? 

5 «^ 

•2 :: 

3 '^ 
tJ ^' 

4* 



a 
c 



•o 

c 

6 



a 
o 

•s 



a 
<a 
s 

o 
X 

fid 

.2 
t 






2 « 

S.S 



o ra 



£ 



>« 
I 



>i h I. t. (^ 

5 ? IS IS ^ 



e« MO CO M CO M M 



00 


00 


00 


« 00 o 


^ 






^4 


mm 


«b4 


wm 


B 


Ok 


Ok 


Ok 


Ok 


Ok 


a 


9 




v4 


«« 


^4 


W4 


•* 


^ 


^4 


• 


«^ 


•^ 


M 


a 


*4 


• 

e 


• 

c 


■ 

e 


• 

c 




1 




^ 




m 
*» 


4 


s 


< 


00 


00 


00 


00 


oc 


o 


«■ 




w» 




9m 


^4 


*« 


S 


Ok 


Ok 


Ok 


9 


Ok 


Ok 


«« 


»* 




9m 


9m 


•^ 


«4 


-• 


^4 




wm 




• 

8 


• 


• 


• 

c 


• 

a 


• 

6 
4 


• 


• 

1 


• 

s 


• 
« 
• 


• 
• 
• 


• 
• 


• 


• 
• 


• 
• 


• 
• 



ou 






'->;>•>'>; . . 

• • • '^ ^- • 

• » • • _ 34 ^ 

sit ^ ff i^ * « 

CC mT CC CRj «* • 

«- gjj w- W 

•^ ^ ^ T3 « a «• 

t 8S§?S1§ 



t 

at 






*9* "n 



S 



•< fi* o 



3 .& § S g i 5 




.s ■? '5 u g .a 

< CB f QO < 



Classified Civil List — Couimis 



559 



8S8SSS8S8S8S8SS8S8S8S8S88SSS8S8SS888 

iljiisjjjjjjjllsjjjliijjjiiilijjjjjj 

- •«i»-e.-jjg 122- «--g -•*-•«•- ••-•315s g--8---grf---- -•- 

• • . o • • . ^ ■ . • • . ^ • • • • ^ •••.•.« ^ •..•(•••■ 

*: >• l- r 2 z -• 1 2 >• >; 2 K &,■ o 2 * I a ^ o . V ^ as J !- '^ ^ « ^ as »• ^ *■ 

Z -*J«^ f^p**2 r t Z :^ ^ if > -J -^ - r *j_Z** ?j(*^ fS^ » 




w 
c 

*5 

c «* 



K 

.5 fi 



iSl 



e e 
a e 

a s 

c a 

11 



.21 

6 « j 

8 ^ s 
5 « e 



ua 
b 



.S.5 
E S 

a a 



I 






'1 



I 

II 



iiiii 




IIIII 



e c * S 

ailllsll-iliiiiiilllll 



^ ^ '* if '0 

^ 2 S S S § 



B « X " ** _ t* > -r c T -e -r? 






ijJiiiii 



660 



Eepobt of State Civil Sebvics Commission 






si 

&Si 
s I 



Is 

S S s 



c9 

Q 



g-s 



g «M a 
800 

:§ • a 



! 



2 

O 

H 



! 



o 






I 

s 

o 

i 



8S§SSS8SS8SSSS88SS§gsS3 



h e« •^ M ^ ^ U 

>^>-^>;^6d>'^>:d^-%->:>;>:d>:^ id i 
KK^:^ ^^*>^Ks^^.>-'s5^.s^s^2:^>:^>:d>:0 

- -^ ^ r fi X .,• *i . ^ 2i : « i J r ;S fy* J ^ >- •»; ^ 

-*::xo«^ h58--**:S^2- §« §S i^ eoS 

l|l|3|l|llJ I i Jllli I 



a 



9 



£ 



a 

o 






M 5 

s 

"5 

6s 



s ;i3 



3 



a 
.c 
n 



J 



. _ c 
^ « o 



I 



o 



«< « oK ri -i 

8 -S 2 * "■ i 

liliiJ 



J3 
OS 




ca u "5 T 

sin 






Classified Civil List — Counties 



561 



S5i8SiiSSS3S?o3£S985SSS8SSSSS5bS|iy-| 



§8?8?? 






§§8 









lO 00 t9 00 to »4 
CM M 






9 m m m ^ • W • • • » 

^4 flirt flirt CO 



«eeiciakc»ske»e»e)o>e»ei90o»e»e)ek 



00 



at 



oteoioaoicao^ci-M^e^^^o 

xob9oooeko»9a»o»0k9n9 

v^^^vrtaMP^^HvirtvMMrtrrtvHwrtH^virt 



M 



e 



O 



•chra«r9e<radoO3er<rXci«0»^ 



firt 9* 



iff S 







c 
c 

X 

-fifj 






- S J a c- g 






•s-i&liiill^ 



|*«||5|°|3|| 



- a ^ •« 

■='3 CJ6?c*= C S CO &C'S fc 5 



_ a>k • ^^ ^ ^ ^ a, 



o O 'n 



l-S°it|IJII||i|2iJS«5i 






s ^ 



%m 

I 



^ M 




Jt Jt M M M 



iSSiiiitlii 




<2 



662 



Eeport op State Civil Ssrvicb Commission 



e 
'^ 



O 

u 
o 



1^ 

8 ! 



I 

g"8 




1 



2 

O 



;a:a:ass:s;ssscood6od6oSdodSeo5 



3 S S S S SS S^ 

lOlQlOiOiOiOiOtO 



• s« • »»• U . r-i • >« ^ ^ iJ • ^ '^ si ^ ^- ^ si • r • . ^ 

? S5 ? J ^ ? >- hJ 25 ^ ^ »z* • ^ - S5 '^ . 55 ^- 5 ^* • Z 
CO rQD*'^»i-: ,J*»;S5 r .;ti!^«<;SS>:S ? .S .5: 

;2S9S?§«S;:^MHgS^SS^SgSSS|S 



§ 
I 

a 
a 






s 



i 



|i|||>%*«siil|?"s 



I M *>» i c3 a t 



liJ 




•a 

o 

« 






c3 c u 



o o o o *cJ 



I 



••• 123 la la 12 ;a "•■ ?Q " O 

•SlIIII-E-g -5 

JllllilSS-a 



G a q a a q a 

•«q '^ •** ttP^ •^ 








Classified Civil List — Counths 



S68 



8 



8 88888 

o ® •t • ^ * 

M « m '^ *4 *4 



8 



888 



« M m 



eo 



00 



£ 



§ 



eo 



i 



o 

m 
m 

GO 






§ 

ra 

O 



d 






C 



I 



to 

S 



ID ID ID ID 40 

«4 vM *i4 v4 vM 

A 01 A » » 






ss 



« ^ 



I 44444 4II4III4II444 



ID ID O ID 00 

v4 ^4 ^4 v4 ^4 

0» 01 01 Ok » 



88983 

•n •n »^ "^ "^ 




I 

a 




M*i4ooflo«H#oie*i4^0p4^^ 

Ill4ll^4li444 



: :o : :o -o . 
. . >* ^. . >• o ^ o 

• • * ^ ^ 25 >* * >< 
2 S5 J 55 55 r ;". rf . 

J J ® J J oS * ► ^ 
oo£ feoooojo ^"^ J 

lllllllJ 

H oonraeocii'SvSSci 

> 



2 



t 



O 

m 





»8§-S|||l 




1 1 . 
I|ltiat33iass 



00 ID ID 

«4 94 v4 

» Ok Ok 



4 <4 



S588SS88«S5Sok ^^SkS 



•n ^ •n 



JHJH 



664 



BEroBT OF State Civil Servick Couunsios 



I 

i 
I 

6 



•5-S 



a 

8 i 



-is 

lit 

gD 



o o «« 



2 
O 



I 



09 



SSS8SSSSSSSSSSSSS8SSS8e3S 



o 
o 



e>«cfeieie«e«eic«c«ei»«eieiei 



S i^dddddd^dddi^d9ddddddd(;e« 

6 ::::::::::::::: ;o ::::::: : 
- . . ^ . . ^ . . r< c o • o o o . k! : • < : : n • 

" Z . J 2 Z .»•- 2: . r : z J J J^ i • >* . »• z '^ r* 



t 

98 
M 
K 

< 





,; *iJ SS us ^ 2 S 

•StfJ* S-fiJd O'S'fi 
tQ »^ U «« *^ "^ 



z ^ o J! £ 2 ^ fS £ p 4 ^ z 



2 

D 

8 



H 






•o •« 



•s 



:399 90 090099 009«'S^^-2'S?2^1t 

iiiiiiiiiliilljIJlllilJlj 



Classified Civil List — Countixs 



565 



SS88SSSoo883S88S8SSSSS3SSSSSS883^ 

S S 8 « S 3 8 $ S. ^. 8 8 i$. S S i S 8 8 S S S £ 2 2 « S ^ S 2 S I 

^^^^^^^^ ^^ ^ ^ ^ J ^ ^ ^ ^ ^ ^ ^ ^ ^ 



M eo M 



** '^ "^ *^ *^ "* ^ *^ ■■* '^ •* ^^ " '^ M *4 *4 v4 v4 «^ v4 vrt a^ p4 am wm •« a^ a^ w^ p4 «4 v4 












^«^*400«««-««i««4p«|%^4«Hwi«QO«ii4^4w4 



eo •« »« 



p4 ^ M d 



OS 00 






• d : : 

^ 1 E O 



00 tt >4 

S3 r 

*' '** OQ 

^ S m e« M 09 n 



• • • 

r . r 

III 

** s - 



«« ^ «9 a» 



I 



III 






• • • O : 
>* . >• r ^• 



.•I 

p^ eo «* 






: :d 

55 r r 5 
***** 

tA CM ia ^« 



. >* 



oo 



> .>*>* 



^ 3 



od 



2 z *: d >" 

> ® J . - 



?: 



iijj 



e '^ J5 -^ 5 



> 



o 



z 

* 

00 



"3 X 



j3 va 












M 



«^ c^ »7 <i^ 
M (C Z -^ 



I 



il 




«^ gl2j|5 ^ ills 

d! J s ^ c& S o H (2 ^ S (2 c 



SI 



tS i 5 " I 55 1 

^ _i «-• Z ^ "O JS 



1' 



— « -^s 5i ^ 









o 
a a ^ 



*f - 



3 









a 



If 

^ "^ "^ *^ t> 



v* a 

' 2 

a CO "^ -^ 



S| 



c 

•SI 

li 



^aa 










^ 



>*T 



JM JM JM 



laaa 




a X .3 
% t ^ 






k k 



CO 



t 

n 



see 



BxposT ov Statx Cith. Skbtios 'Coumssion 



I 



o 



I 

I 








I 



o 



QD 



83 8S88S8S 



§9 



s s 



•« 10 



s » 



•- eo 



5 S 



§§ 



•o o « •« ^ ^ « 



88SS8 8S8888 






CO « 



eo lO *i4 v4 pi^ 



•• M n M p« •« 



e lO le e« M r« et 
S S 3 S o» o» 9 

w« p4 v4 v4 p4 v4 p4 
• •••»*• 

00 MS lO ^ ^ *^ ^ 



8| iii^^ii 



le 00 CO r« 1^ 



o» » 9 ei » 

•i« ^4 «« «-• v4 

rC ^ Ml o o 



S2S8S2 
Ot 00 O O 9 



« •« *i« r« (i* e9 



«4 Ct 



III!! Jislll 






S S S S 9 

^^ P< •i^ •• ^^ ^ PP 

• • • • ^ • • 

•0 *i4 vi* oe le •«• *4 

• • • 4# • ^S m 



. . • r* 

H 
M 

H 



UU 



:o 



>> 



.►« 




S S « 




M» 00 09 r« r« 

» 9 0» 9 0» 

^4 v4 v4 *i4 v4 

iC ^ lO o o 



o Jh' J >i J 

>** 5s >; 2i jH* 

•fl "a •* o J 

** -9 « .S 5 



o J4 







SI 38SS 

00 X 00 S 9 » 

V4 «rt ^4 »« M «< 

• • • • • • 

« 00 »« r» 9 o 

•^ »4 ^m ^ '4 

: i id i : 

sj ' ' . -n 

, • • >« -^ 

^ . • • s« z 

>•>• • r 
2 55^25 

2x3 

*^ *• oo w 
<o lo « *4 n 
r>* lo c M CO 



— 35 ^ -> ,* 

J- 



oil 

Infill 

si o Si *^ 



8 






111 









Classipikd Civil List — Couirms 



567 



88S8888SSS8S888S8SS8S8SS8SS8SSS88S 

S§iSSSiS§Si§S§i§i§§§iiiilili 



CO 



^^cim*nw*toc*w4f^toc*r^ ^^p^,-iei»^w»i<»^»^»^»-i««^^»-i^^»^^ 



S - 8 •"* S r -»" si -»* S •"' §f 2 2 - - - r - - - g -^ 2 '^* ^' £ 8 a ^" --' 2' •"" 2 

^a^§t-83s3HS^Js§l|lssil'^|-8 9§Hsl|^ 

O: o \0 '. [rj '. o ' zj^ n • • • cj d • • • * »j d * • d kJ • * ^n d 

|B|«^ji|||i§P«2|ISil|i=|Sa'l3||l|| 

llllllll II l|l.%^'|IJilJli||l! la 

S3SSSS2?tSS4Srt?M^'^t^c4eQiO'ir90^<>itd^^o«»-^e^m'<r9i 





a 

a 

Si 

-:& 



« 

JS 



J? 



S "^ ft .^ 



1^- 



9 




.M .M 




111 



568 



RxpoBT OF State Civil Sjbbvicx Couuissioir 



1 



sl 


^ll 


^H 


6| 


o tt 


,.i| 


si! 


&H 


8-8 



? - 










2 

O 



88S8S8888S88 88888888888 
iiiii§§i§ iiiii^^^^^i 



r« M 






Hi itJi-8 s 5-g fei 






7: <Um 



< < 



oSoSSSwSSotSoi S«S8ss8ooeS 



^ t/iS t^ 



S^8 






Si 



s 

9 



M 
9g 



CO ^ to o •«• t^ 



ec p^ 



s 






III 










:j :::::::::: : :::::::::: 

:«;::::::::::: :::::::::: 

• "C 

:.^ : i : : : : : : : : : :::::;;;:! 
««i.iiir!. 

"B :::::::::: : :::::::::: 

lllllllllll lllllllll-S 



CiJussiFiED Civil List — Counties 



S69 



s s § 3 s 6 8 s ;; s s s c 8 3 s 



8 



J4 

t 

i 
s 



8 
§ 



o 
O 



^4 ^4 ^rt ^* ^^ •^ w C? ** ^ "^ ^ -^ •* 



s 






or 



o 



Aaoo>OioooQoaoow<x>a>9QO 
r-* rsT lO -^ rt' O ^* •« •* •« O « 0» ^ ^* O 



«1 

:3 



c 






O 



2: 



o 



oo 



-?: 



>• 



00 



> 



2iZ 



Q 






oc 

U3 



«* S o ^ -S •= o 
00 Q r« >» S k ^ 






.2 o 



O 



;o 



:>- 



?: 



zo 



:jh' 









s 



— o 



^o 



o 



to 

e 
oe C9 



§1 



!r >< 



. 2s t» ?^ 



•• « « ic 

W c^ « "^ 






:?: S 11 






^ 8 



11 



>:>;>; 

- * J 
5 J3 3 

•** 2 4 

H 2 Ed 

•o H 9« 

^ " ^ 

CO M M 







Jtf Jtf Ji ^ 

k u •« fc« ^ — 

V 9 « • ^ jBj 

"o *« "C "C "C o 

c 



e 



JO 

s 

ft 




Iff f X ^ 



llil 



c c o e 

•? * « )• 



« 5 S 

T? -9 






<<<<<< 



8 






8 









a 
«s 



0» 



e 

«s 



0» 






i 



^ 

s 



as 




o 

I 

E 



I 



a 



s 






670 



Repoet of State Civil Sebvice Commission 




Pi? 

go 



i ^ 




8SS8S8S8SS 

9 O 0k Ok Ok O Ok Ok 0k O Ok Ok Ok 
OkOkOkOOkOkSakOCkOkekOk 

^wmwSwicioSw4^'^^cic49-S 

•l3|i||HsJs|| 



8 



88 



i 

2 



o 



1 



I 

3 



s 

o 
u 



1 



CO 



I ill 




«* ^ ^ «* M • m 

^ -a oD .a - 

OQ g e g 

e ,*» "5 "o ^ '^ ^ o 



s •; > . 

C «-«i-3co*ec«eieor«<-*Ok 






M 






•-* M CO 








s 



01 o 

4Q 



4q 






Classifibd Cith. List — Couhtixs 



?88| 



s 






SS 



s 

CO 



s 



88SSSS88SS 



06 1» 



S 8 S 

^ "* CO 



8 



888 



671 

8 



10 00 « 
v« (ii^ v4 
O Ot A 



00 00 



qoqoqoooqoqoqooooooo 



10 M» C» 
«H «4 Q 
» » 01 



00 



S fa 00 



c 10 00 <e 

* .^ «H a^ 

X> Ok C3S O 



^ 00 



00 oc 

O) 0» 



M tH f-4 e» ^ 00 v^ 



•-^ « « r* 



Q O * 






•< •-» z 



ocoooooooooooooooooo 

OOOkOO^OOOkOO) 



•* eo ^ 



ll 



0» Ok 8 



i 



00 



2 « V o 
S fa O O 




O 



^ 00 

II 



M f-4 »4 Ok ^ 00 ^ 



s 
s 



o 






I 



«o=g 



U3 

•g 

O 
I 

2 






§ 

e 

a 
^o 
'2 

•t 
J9 

O 
u 

a 
5 




o 

3 



8 gj 

II 

o 

o 



J 



9 



5« 
• C 



g .2 
X O 



s 



sS"r: 






I 



as 

o 






s.as.aa§.s.a 






.c 
o 



1,; 






•s « a 






e 

fa 






C 5^* I H ^ (2 > 8 



a 

£ 
fa 



2 

e 



^ s s 



V 



8 3 3 9 9 



8 i-T 



i 



s 




2 



m • 



!^s 



e 



c 
o 

.1 

a 
I 



672 



Beport of Stats Citil Sxsvicx Cohmissioit 








O 



8 «. 

d •» e 

r-i 



2: 

o 



CO 

O 
0« 



a 



8S 
S8 






•5 ^ 






S fi ^ >> ^ >» 



eo "«r t* 00 00 

O A O 0t 0k 



M5 « 1-t 00 00 « 



n 
o 

S 
o 



M C 



& 



•^ « 



C9 



8^ t« r» 00 00 
Q «M «i4 «i4 *4 
SS 41 2 S ^ 



ra 



>» >» 






fe. S ^ 5 •» < 



s 

.a 

2 



S 






e 






|1 

0Q ^ 



IJi 



8 

6 

o 



A 



•8 

<< 



II 






s:^ 



9 

8 
o 




ir ie i( 

• ■■ •■« •mm 



8 



S 



SS888888S 



ooaooeir«o«fl9ci» 
a» a»a»o»okoi0iofli 

^4 v«»rt *i«p4*i4*i4*««4 



8S 



•irf 






Ok 



s 



It: 

•c 



<c*ooeoio««ci» 






c 



SS 



c«« 







a ffi-S" Ills 



2 

o 



- 5 

^ an 



I 



M 

C 



I 



lili 



*£ ^ 






1-2 "O 

JS 

o 



2 * S ^• 
8 



< S 5 g JS» 



8 



91 

H 



s 

c 




CukSsiraD Cini. List — Couimts 



573 



I 

& 

8 



8 

s 



88 
Si 



s 



8 S8 



8| 
IS 

i 

S 



8 8 



C« 



§ 



5» S 



00 



00 



^ 00 
01 c» 



eo 



s 



8 



mm ^ 



b>, 



a 9 



X 

o, 



00 



1 



< < 

to 00 

s s 



"2^ 

^3 



^ oo 

pm w^ 



5 

< 



00 



^ 













i 



H 

s .a 

C<9 2 



•SI 



ra 

a 



8 

^1 



& 

8 

I 

z 
o 



J 







1^ 



8 

» 

^ -at 



J 



5 



c. 






o 



o 



J-3 

< < 



5 

I 



z, 




6 







574 KiPOBT 07 State Civil Sxeyicb CoHicuHUOir 



o 

< 

a 

o 



1^ 

a 



i 






•8-s-g 



III 



3 



O 



8 



S 






8 



8 



8 
§ 



I 



i 



t 



•S 

hi 



i 



i 



1 

n 

2 



3 ^^ 



I 

3 
o 

tr. 



J 



« 



s 



•5 




H 

i3 



• 
• 

t 

< 



I a 
3 « 



8 

P 



8 = 
II 






J 






O 

u 






JS 



I 



1 



S3 

i.i 



« 


lO 


lO 


«> 


^* 


1* 


r* ae 


» 


01 


v4 


*i4 




» 


o a 


^4 


S 


v4 


v4 


w* 


pi^ 




* 
94 


* 


* 
»4 


* 

9-t 


w* 


• 


• * 


1 


1 


• 

2 


i 


i 


• 

s 














a 

00 t 

5? 



3 



ci 

•5 = 



8 



Cla88Ifiid Cini. List — CoTmnu 

8S 8 



888 
§§§ 



888 



88 



lO ^ 



C« v-l 



675 

8888 
§§§§ 

• » • • 
M M (^ «H 









► 

s 

o 

a 

P 



8 
P 



•s 

s 

8 

I 



« « r« 

»4 a^ v4 

o a» 01 



>k >t >k 
•n "^ ■» 



o « t» 

«^ r« *4 

o» o 0» 



333 



8 

P 

Is 



t 
i 






I 



00 



'I 






M lo a 
S S S 



O Ok 



s 



> 

o 



.^22 



82 

8 Ok 






> 



Ok Ok 



^s 



S 

■8''. 

I ^ 

.. p" '^ *** 

J S -^ Ok 






a 
e 

H 



1 1 

si 



a. 
s9 




"5 8 






o 2 

1-4 »< 






8 8 

•a -a 
PP 

• • 

< < 

^P 

§8 



8 
p 









A 



R^ 






h- !<• r« io 

^ 1-I ^ •? 

0» Ok Ok 0» 



U H i uii 



•«" o 



c 



^ r« r^ r« 

«i4 ^4 fM ^4 

Ok Ok Ok Ok 



« • ■ • 

•-» »^ "^ O 



00 "J W «) 
b > > . 

5664? 



9 9 9 



I 
I 




tt 

•S7J 

II 
III 



a 



I 



576 RxFOBT 07 State Cith. Samno Coumsstoff 




8« 




8 



S8 



•0 1^ 



lO 



i 

lO 



s 

9 



a 



Si? 

ss 



^ 



OB 

I 

i 

8 



a 

I 



CO 



4> 

I 

a 
e ^ 

II 



5 li 



8S888 888888888 



8 






8 



8 



r* - © * 

lO « CO n 



« •^ 



«0 


« 


« 


lO 


00 


*i4 


^N 


»i4 


^« 


r« 


o 


o 


» 


e» 


o 


v4 


^* 


^4 


r« 


»^ 


iC 


« 


«. 


o 


>* 


^4 




*M 


^ 




>k 


>t 


• 


>i 


'C 


9 


3 


Is 


< 


« 


«o 


09 


to 


ao 


v4 


*■< 


*M 


w* 


•H 


o 


O) 


O 


o 


Ok 


^4 


*i4 


• 


^i« 


^* 



<»akO>0»0»009S 



e «o 



a> Q -^ c« »« N 

•^ w — ei •* - 

S £ S z ^Zb^jz 



^--"^^ 



toooooaoao<ot«i«x 
o» o eia>o»9099 



lo ra <o o •«• 



«D (O 



0» Q — 5* »• !• 

•* « ^ « "^ •- 



•g-s.o 



>.^ 



> > > 



•9 a 



^^ZS-< 






s 





8 

g 

2 

O 



1 1 



X 

6 



«! 

•J 



C 

Z 



a 

i^ J 

H A >e 

k Is 8 



"a 8 'I V ?3 

^ • ^ a ^ 



ao 







1 

■ 

i 

o 



BSasskcB 

QQQQOO09 






e 



clti 






«» ? I 



s-s » 




Bsu;s^:?^w 




Ci.AB8inBi> CiTZL L18T — Couvms 



677 



8888888SS88S88S8888 



% 



8 888888888 
§ §§§§§§§§§ 



oooor<*ooao^aoaooer«>t»oiooaoooeor«r«io 









Ok e» 



|o » I* h- h- h- |o 

»i4 p4 ^4 *i4 »4 «H *4 

01 o o» » « e» ei 






s; 



^ 



CO 



M 



«^p4*4v4«i4«i4M«HF4 



llll^llllllllllllll I I ,J44liJI4l 



oocor<*aQao<«'aQaooetN.Ka>aoaogoaor<»t^r« 

OkO^O>OkO>OOOkOk90kOOOkO>0)OkOiOI 



•^8 



10 M 



*^e0«>4f-4v4«>4vi4v4 



cB ^ ,^ ^ ^ e« 
el CO v^ 



iliiiiliiiiiiiiiiii 



i|eeaegaaaa 













2 



S d d 

19 



i 



I 




SB 
P 



- 6 



OkOkOkO»a»0»0»0»Ol 






I 





s 

SB 

a 

B 

S 

a 






lllllllll 



678 



Rbpobt 09 Statb Civil Sebviob Coumibsiok 



1 



o 



y 



s 

II 



I 




a « S 



o 



88888881 

C« « « « ^ ^ fc 

8 






8 



8888 



§ gSRI §§ 



8888 






SS399|S 



O 



d 



as 
o 

i 

a 

5 

H 
O 

M 
00 

6: 
o 



r^r^ioiOioiQaaoo 



• • • « • '^ • • 



i 



<D m CO m 

•^ iH -4 pi^ 

o e» e» Ok 

^ ^ ^ Vi^ 


00 o n o 

vH v4 v4 »4 
^4 v4 «4 »« 


^ ^ ^ ^ 


» • » • 
^ v4 «4 »4 


^ •^ •^ •-» 


May 

Dm. 

April 

May 


<D CO CO m 

vH vH vH «H 

Oi Oi Oi Ok 

*H ^ ^ t^ 


00 O «9 O 

WI4 »4 v4 v4 

010100 

»H •^ ^ •« 


•H rH »H ^ 


* • • • 
O piH ^ r4 


• • • • 


III! 




8 



a 



D 



8 

H 



S ^ ^ H £ £ 



h3 d 

II 



I 

1 




a h 



00 

« 

a 

s 

a 



00989999 




Classified Civil List — Couittibs 



679 



SSS88 

«0 <D <D <0 C< 

r« h- 1^ w) e9 

lO lO »o ^ ^ 



S8 



8S8 
S88 



CO 



S88||8S 

M ^ ^ ft Oi^ 

88 



8 



§§ 



to to 



8 9 9» oi 01 

A • » • * 

^1^ ^4 ^^ 9^ ^^ 

•-» »n •-» ^ ^ 

9 9 O O Ol 

• * • • • 

VN !^ »N »N ^4 

•-» 1^ •-> ^ ^ 




<D :a o S o 



Si 

H 
OQ 




X 

D 



W.?'^ 




00 c« 
o» o» 






0» oa 
CO -«•• 



U3 U3 



-I 



■< 



1 

•si 

= 25 



a 



I 



c» 
P 



c 



U3 

I 






<D « ^ 

t^ V-* w* 

O Ol Ol 

»H ^^ »^ 

» • • 

««• <D M 

iH 1-1 iH 

III 

<D « ««• 

v^ ^H Wi4 

0» 01 01 

^ 1M ^ 

V «o ef 



a 



si 
.11 

a •a 



^ ^ •-» 



m 



<o <D o 9 v^ a 

iH iH iH Vi^ Q v4 a 

01 Ol 01 Ol 9 Ol Ok 

^H ^4 ^4 ^4 ^4 ^4 »N 

• *•»••• 

«-4 v^ ^4 V t« jlJ «H 

<D <0 O qO IH Oft 

^4 vH ^4 ^4 O ^4 O 

01 Ol 9 9 9 Ol ok 

tH *^ iH *^ «H f4 iH 

•-4 ^ ^ o r« Q f4 



00 t* 




s§sBs§§ 





^ 9 

00 I* 




ll 



i 



RiPOBT OF State Cim. Sbbviob Coiuubsioit 



88383 



S S 



SS 8888 
11 ilil 




Clabsivibd Civil List — Couittibs 



681 



8 



S 88 



M M 



888888811188 



0» 



9 



A 



m 



9 I 



O a 

o a 



o 



I 

.a 






9 



i 



8 



o 



D 



< 



I 



J 



o» 



§3 



la 



<s 



§§ 

r- 

|9 



OQ 

d 



31 






I 



I 






I 



S 






i 



I 



Is 



o 
u 



D 



1 

b 
3 



j*^ 



II. 






1 

-3 



1 

a 

III 



sssssgsssggs 

w^ wi C ^ wi wi C t^ t^ wi \ ^ 

SSSSoftSolSSSoSS 







I 



lilll 



Id 



i 



•a -s "S -s 

III! 

«• 4» 4* » 

9 9 

&CX a a 
« • « 

"O T> "O T3 



• • • 



I 



II 



li 



582 



BsFOBT OF State Civh. Sebvicx Commission 



I 



III 





2 

o 



8 88888SSS888888 



§§ 



o o 



o 



- r 

1 

< 



t^ 






S wOkoSoSSSS 



«-< CI c« QO 00 r« 

01 Oi Ok Ok O Ok O) 



I I''! I'"! |-r^^^^^o 



% 

Z 






I:; 







GO 

< 

a 

li 
I- 




►J O 03 I g 
3 o ^ .5 -5 a 



M M M M 

t ^ & ^ 
*S 7J "S T 



.M Ji J4 ^ 



•a 
8 



1^ 



-S -S -^ -M 
h fe ^ ^ 

o ^ •« t; J 

M M 60 tC O, 

HI'S I 

« 
0i dQ 



s 



8 



0» 



d 



oo 

0» 



•4 

s 



S 



OQ 



1 



M 
H 



n 

I 



I 

s 

3 



Ci.A88mxD Civil List — CoTmms 



688 



■* o e 
8 



88 88888 8 8 8 8 888888888888888 



M 



^4 ^4 tH d «-4 



s 



S88 

r^ r^ ^ 



simm 



^ CO <« 

9 ipi* o4 

« » Oft 

v4 o4 f4 

a a" - 

•-» H »n 

Oft a» 

W4 wm r^ 



o o 

0» Ol 



r« CI r« ic o 

»N »N ^H ^i4 *^ 

O Ol O O Ok 



cor^or^io^oiooeocor^QOQOQOQOQoao^ 



95 

< < 



o o 
oi a» 



< < 



00 



S OQ 



;^ 3 9 3 









Re 

II 



« ,H «-««-« O 



fl a 5 c a 

H> 1-9 Z In ^ 

r^ CO f-i lo o 

^4 Q» ^4 ^14 ^14 

O w Oft 0> 0> 



(O «-« M t-4 O 



a o. B d 8 



n 

00 00 



ill 

o o i 






S 



5 
S--2 



c 

"1 



c 

5 



h. 






fill" 






(or^or^iOiHtotooeoor^ooooQOooooQO^ 

00>OkOkOkO>OkOkOO>OIOIOIOkOI>OkOIOkO 

^^•ii4«M*^tHf>4^4tH«H^4i>4i>4tH^4lHF4*^F4F4 



4 



a 



!sX ^ 



£»?S-< 



^ «n "< •-> 



a ■• * _. 



1-8 






M 



& 

A. 

a 
o 
o 

o 

:5 






II ll 

S E S 

III 



a 
o 
a 

O 



I 



illisi 



o V 



O OQ CO O 1-3 S 00 





3 3 



d d 



V c d d 

d -9 •^ -^ 
d d d 



^D jQ 3 fS 9 tf ^A ^A ^^ ? 999999S399 

o 6 e '£ £ o << -< << 2 a^: a^: 2 s^ ^^%.%.'3E. 



584 Bepobt of Stats Civil Sebvicb CoMMissioif 



1 






g 

O 

ft 

o 



•S.9 



a 

III 



•s-s 

Ih 

g-8 



I-' 

II; 



I 



<• a 



2 



o 



8 S 



S 



M 



S 



M 



(9 



1111111111111111 

S88S8S88** 



e« 



t-i M ^ '^ 



I 



I li^iliii^iiiiiii 



3 



CO 



1 



4 

I 

I 






S S S g ^ g S s S S g g S S t: 



o 



eo 



1 



00 



a 








»"3 




CukBsaiwD Civil List — CoirirTnw 



585 



S. 



8 



00 

1-1 

at 



00 

at 



3 



I* 
01 



I 
I 

is 






1! 

o 



s 



a 

o 



§ I 

E s s 



P 



I 






S888S 
§§l§l 

» » m 

e^ w* m4 



t« l« 00 t^ 00 

^4 ^H Vi4 Vi4 ^ 

9 9 Ok Ol Ol 



^ •->•-> »^ ^ < 

t* r« h> r« r« 00 

«4 v4 ^4 «4 ^4 »N 

Ok Oft 9 Ok Oi 9 



• • • • ^A 

99 9 S| 

•-> ^ »n •-> < 





%% 8i 
§§ §1 



M M 



8 



88888 



ra v4 f4 f4 »i4 



00 ^ 

01 01 

00 ^ 
9 01 



§o e« •« ^ 
^4 f4 ^4 V4 
01 01 9 9 




I 

I 



I 



■a 
I 



o 




686 



Refobt of State Civil Sebviob Comicisbion 




8S888S8S8 



8 






um 



S888 
§§§§ 



CO •^ 



88S 

• • 



^ 00 QO 00 <D <D CO 
0) Ot 0> O) O O Ot 



8^ 

9 o» 



<Dor^r^i-*oo<oc«^ 




8 *. 

§5 



I 



i 

55 



O 



»n ^ •-> •-> 






«««0OQO0O^<DC«0pr^ 
0k0>0>0>0>00>0k0t 



«cor«r«aooooic<^ 



i>^ 



J^S S S » -Sua a 



3 



Ol 


11.1904 

17,1886 

aO. 1907 

1. 1918 


1. 1917 
4.1007 
3. 1019 


1 


July 

Not. 

May 

Sept. 


m 


• 


11.1904 

17.1886 

a0.1907 

1. 1918 


1. 1917 
4.1007 
3, 1019 


• 

1 


till 


III 



•3 



O /-N 



CO 

I 

53 ^ 

i 

S 5 



GO 







GQ 



!l 



3 



« 

^ 



S 



rco<^ioo3«io b«o s ^ 



s 

M 



V 

c 



X 



^ a 



2 2 

a 3 3 



S 



E 

a 
o 

9 

K 
O 

5S 



5 









I 



II 



I 



c 
g 

o 



|x« (>< (it* 



c 
S 

B 

t 

O 



a • 

« • 

Is 



ja 
ft 



11 



il 




Classified Civil List — Counties 



687 



8888888 8888888 888888888888888888888 

88888Si S$^?. S88 88i88S8888iS^8i888888 

eS 9( ^ ^ «4 S *1 T. *?. '^. '^. ^. ^ w UN S « w S S w « « S « N « S 

aao»o»c»oio»ai S8Soaa»a» oSSSSSSSSSSSSSSSokSSokS 

222S2S2 S5S22S2 222222222222222222222 

IIJsilJ lllllll illlaiJIillMIJIIlJjJ 




f f Cj § 











a 



11 

Hoi 






04 






-8 8 



u 



111 



> 



a 
o 



a 



o 

* 

o 

s 




hb $J3 a-»* 











M M M 



ill 

M M M M M 




688 



Rbpobt ot Statb Oivn. Sbbtiob Oomiosbion 



■8-21 

I 

8 



'I 

« § 



* I 



i - 



I 



} 



I 



88S8S 



<« O fi ^ « 

^ ^ A e ^ 

Oi 01 w 9 Oi 

«H v^ f4 f4 iH 






« e 5 v^ 00 

S S 8 S S 

^ V4 f4 f4 ^ 

mil 



T 1 I 




it S6 B 









4 'So 

o5w2 



h a d a a 
B 8 5 p p 

z « « « « 



a 



S8 


888| 


§1 


iiil 


M 1-4 


8 




S 


1906 
1908 


^ t^ 00 1^ 

•M »^ •-« »^ 
Oft Oft oi a» 

r4 t^ ^14 !^ 


*6^ 


et a e« ei 




^ CO 


Mar. 
Mar. 


Dee. 
June 
May 

July 


11 


<« t* 00 r*" 


oi 9 o» a» 


in S 


^4 «H »N v4 


-i^" 


S?5«*^ 


Mar. 
Mar. 


Dee. 
June 
May 

July 




00 GQ 



£ 



GQ 

4 
C 



GQ GQ 



S: 8 ^ GO GO 



a 

6 



I 



S 



•15 



M -J? 
It 9" 



•ti •% "S 



8 



9 



a 



9 
9 



s 



■ 

00 



^1 



8 
d 



OukBBirtXD Civn, List — Oomrrixs 



S89 



S88S8888|| 

§§§§§i§§|| 

88 
8" 



CV ^4 Vi^ ^4 ^4 ^4 ^4 



o 
o 



8 88 



88888 



CO et ^ 1-4 



11 
s 



5 



« 

8 



3 






milling 



Ol A CO O 

^H ^H ^14 r4 

Ok Ok o 0> 



M 99 t^ Ot Ok 

f4 f4 Vii^ ^14 i>4 

Ol Ok 01 Ok o 



Uiii^ti^i 



a 




S llsliilsll 




a 

■ 




dsI^ 



4 



3 





1912 
1918 


• 


• • 


=5 


Jan. 
Jan. 




1912 
1918 


• 


C4 


1 


• • 



si i 

S • 4 



I 









I 
I 



s 



op 00 00 00 00 

A iH »^ r4 f4 

9 01 Ok Ok 0» 

•H ^H p^ •H ^H 

» * * • » 

f4 ^4 f4 t* t« 



S 00 00 00 00 
iH i>4 !^ iH 
Ok oi Ok oi 

W^ 9^ W^ ^14 w^ 

wi wS wS tZ tC 

iiiii 




I 

•8 gi.5.9 



« t* 



1-4 M> 



9 d 9 9 S I 



o 



« 1^ 

Oi Ok 



OQ 



^ 



|5 



690 



Refobt of State Civil Sbsvicb Comuissiok 



H 

8 





o 






S8 
§§ 



S 8 



8 



8 



« 



O <4i 


a» 


e 


o 


<D 


•-t !^ 


«H 


«H 


«i4 


^ 


01 at 


o» 


o» 


Ok 


Oft 


»H iH 


»^ 


iH 


^4 


^4 


C« «D 


»^ 






• 


i! 


• 

s 


i 


• 

s 


• 

8 


•n < 


»? 


•< 


4 

o 


•? 


« <« 


o» 


to 


lO 


0> Oft 


v4 

o» 


a» 


^4 

Ok 


g 


^ F^ 


•N 


w* 


•■4 


•3 


• • 


• 
Wi4 


. ^ 


* 

00 


•ii* 


June 
April 


• 

a 
« 

•-> 


1 


• 

1 


•n 



I 

•ti 

GO 

a 



5 2 

: « 






OQ 
OQ 

5 



a 

<5 « 



o 

5 



i : 



- a S 
(^ o fl 

II i 



M 



CO 



• S- I 



s 



o 
o 



J 

o 



888888S 

§§iii§| 



I 



§<D ^ « « oe e 

v4 o o "^ ** "^ 

o o S o e ct 

•i^ »^ wH ^* •* "* •* 

00 •H ei" e« V •- ^ 

•-» *n < 55 •-» 30 

CO « «f « M) CO e 

8 o el» S o o> o 

Vi« ^4 «i« Wi« piH ^ ^ 

od •^ ©i" « V « g 

cx c a A. o c. ^ 

oB "^ ^ ^ Z ^ oE 




o ;^«w-^ 








CLAssivntD Civil List — Countixs 



591 



8 



88 
§§ 

* • 

CO M 



88 



8SSS888S8888 



eo ^ ^ 



88888 



oo 



11 



39 



§§ 



3 



e 

I 



i 



P 



< 



00 en 




II 




a» at 



2: 



r^ 1^ 00 

f^ W* pi^ 

Ol Ok 0> 

V4 *i4 »N 

* * ■• 

rJ o» o* 
ei -^ ^ 

lis 

S << ^ 



CO t* 



r« r^ 00 

iH !^ Pi4 

0» Oft 01 



OS5 



:S • o* 

M *H ^ 

s << << 




do (u OQ 



I 

to ^ 



•a 



to 

•g 

■•J 



9 3 1 ji S 



Hill 



S92 



Bepobt of Stats Oivil Sxbviob Cokmission 



O 

g 

o 

ft 
o 



Jl 

8 




i « 

11 



2: 

o 



88888888S 

ssmmi 



8 8 



00 00 00 t* 00 
Ok Oi Oi Ok Oi 



00 00 00 00 
Oft-S Oft S 



Ol 



eo <o t* CO w 



s " a s 

iliiiiiii 



§§§illtt 

CO t^ «-« fH «H "* ** 

• ■ 

e e 
It 

• c 

atoaoooiSeS 

^ ^4 1^4 Pi4 »4 p4 (I* ii« 
• • • •••>. 



00 00 00 t^ oc 

^4 »N r4 «i4 »i« 

01 Ol Ol 01 Ol 



00 00 00 00 
^* w^ ^* p^ 

01 01 0» 01 



• • • 

SoSSoiSaS 

9^ t^^^^^pmw^w4w«r» 



Ol 



90 <0 t^ 00 CO 



• • • • ^ 
00 QQ Z OQ fS 



III I 



•^'^•^•Mi-t^W^ 







a 

-I 



Illllllll 



im 



ss 



Olasbifibd Civil List — Countibs 



BS^ 



& 



§ 

CO 



s 



eo 



888 



88 
§1 



8 



59S 

8 



00 t- 



I 



8^ 



00 K 




I 



6m 



<D «» t- 

•14 ^4 O 

a» a» 5 

f-4 ^l t^ 

• * » 

o ^ ^ 

•^ * ►^ 

<D lO r« 

f-4 Virt Q 

Ok Ok o* 

f-4 ^14 t^ 

* » • 

o «-• ^ 



i 



a c 







a 



a* 



a 



a» a» ^ 

^■•^4 

d Oi 9 



• • m 

8 SS 



a» a» ^ 

•14 f-4 O 

Ok Ok 9 



8* 



M 

H j^ 

O * 

2 : 

s •-» 

C3 a 

I 
Q 

G 

I 
S 

o 



J 




js -x 



"3 9 



^ 






.9 




o» 
ei" 



«0 

< 



CO 

s 



CI 



o» 



eo 

8 



CI 

•3 



a 

<n 

O 

O 
d 

CI 





S I 






I 



73 






■ 



52 

f 



91 



I 









I 



594 Report of Statb Civil Ssbvics Commission 



I 



o 



•S-9 



I 



si 



a 



I 



Is' 

g-8 



8 



•S » i 



I 



.9 






o 



S8 



88888 

Q 5 So w 8 



4< 



^4 OO OO <D (D 

1.4 fH 1^ f-4 ^N 

Ok Ok Ok Ok Ok 

f-4 t^ ^l f-« f-4 

• » * • » 

OO t-4 t-4 M CO 

f>4 

vH OO 00 (D (D 

vH f>4 t^ 1^ f>4 

Ok Ok Ok Oi Oi 



OO 1-4 t-4 M CO 

« « 






% 

iJ 









o 




lIsS^ 




8 



Ok 

w4 

Ok 



a 



a 



8 

h 






E 



^ 



8888 



M ^4 ^4 ^4 



a» o K ^ 

fH w4 w4 ^4 

Ok Ok Ok Ofe 



d a a a 



O 



Ok O Ok o ^ ^ 

1^ H *^ '^ •"* »^ 

01 9 Ok Oft a» o 

1^ S '^ «^ «4 !<« 

o 






li 


• • • • 

» • • • 


<S 


; : : 8 




: : : 8 


6 : 


« « r 


B . 


111 


,-< 


oo < 


r r-g 


• 


:££-|i 



■ 
fa 



O 






|l5l 




I? 



!> 



zzz 



& 



dq44 



888 






cs d ^ 
•^ •n « 



t- r» »• 

8 S S 



8 ^i 

•^ •n * 




>^ • • 



I 




•^•^ 



Clabsitibd Civil List — Countibs 



695 



S 



S 



8 



SSS 



8 



8 






88 
§§ 



M 



o» 



o» 







o» 



o» 



8 

o» 



I 



3 

I 
2: 

e 

c 

« 

3 



a 

II 

u o 



S 

M 



3 



a 

I 

e 



^ t^ «D 

o» s s 






II 



CO h> (D 



S8 



9 S S 



o» 


O 


1939 
1910 
1910 


f-4 


• 


o «o ^ 

w4 


• 


• 


Mar. 

Sept. 
Dec. 


c« 


«3 O «0 


o» 


01 


O •-• «4 

S o» Oft 


»^ 


^i4 


*4 ^ «4 


lO 

^4 


^4 


^ « V 


< 


i 


Mar. 

Sept. 
Dec. 









a 



s 

8 



I n 

O 



CO 

O 



S 



OQ 



» 



■ 

I 

»« . — 

i 



I 



o 

! 

I 




I 




s s 










M 



O 



oS 



D 



r 



00 (^ 



696 



RspoBT OF Statb Oivil SsEyioB OomosnoH 



o 



1-^ 

1-1 



a 



|8 



^1 
I I 



I 




£ 



o 



8 

8 



d 



d$ 



I o R 
5 & 

I 

GO 



8 



i 



8S 







3 






d 
ft 

I 






I 



d 

O 



II 



8 



e 



JM 



^ 



P 



c 



mm 

s 

I 



8 



1 si 



4 li I ^ 



i i 



i 



o 



8 



s 






8 



8 



I 



ifji 






9 

I 

£ 
1 



8888 



S isis 






8 S 8 S 



Ills 




I 




CiiABSiFisD Cnm. List — CiovimKa 



597 



88J8888 



8 8 



M 



8888| 
§§§§it 

• » • * •• 

^ ^m ^4 w^ Q 

8 



S 



8 



8 88 
§ §§ 



«-• eo 



S:sst:ss 
Oft V o 9 o 

*4 «i4 ^ ^ v4 ^14 

wS to ^ ^ ^ ti 

S:sst;ss 
9 V 9 S Oft 

*4 Vi4 ^4 Vi« ^4 ^14 

mi ttS r-i ri ri t^ 



! 

I 



i 



*•§ 



III 











oo 



I 




• » * * .^ 

■o CO ^ oD «e 




<0 1^ *i« 00 <o 



I I mil 



CO 

to 



p 



^ 

C 



< 



r 1 



£ 



I 

u 



I 



1 sS2|«6 






StJI 



a 



^^ " J 5 

.5 "^ W OD M 

Mil 



i 

§ s 

II 

•*< 4* -S al !^ 



Oft A 0» 
Oft o o 



I i 



2 



i 



B 



11 



IJ 



i 
I 

s 



8 i 

D 



6 

I 

3 



li 






as 



a 
I II 



I 



a 



I 



III 



Bbpobt of Statb Oitil Sirticb Co«« 

I 



ill 
ill 

ii! 



Ill 



SS88 S8SSS88SSSf 
i§§§ §§§§§i§ll§S 









iii 
ill 


iiiil 


||s||i 
Illsl: 


KSh 




n * nrt « 1- 


•:• 






III 


UiL 


Ju. 17. 
Mtf.33, 

April 7, 
April 7, 



:i: 






Ifi ,1 iiiii|Ji 



II 






m 



llllillllli 



CuLSSiFisD Civil List — Counties 



599 



8888SS8888888888888388888S8S 88888 8 



2 

o 



o o 



o 



88 



o o 

CI M 



8 

c« 



i 



M«eoe9e9eocoMc<rr«e9GO«oooao^GoaoioioiQioGO^eororoco 



1^ 1^ ^ ^ r* 

frt l>4 fH f-4 «4 

Ok Ok Ok Ok Ok 



00 

o» 






IC to v4 ^ iO 

*n •-> < < •-> 



ooo»o»0k00koo»o»o»0)^oo»o»0)oio»o»o»o»a>ao9oa ^^^^^ ^ 

iiiliii d sii-ll-t-lallli slils s s 



o 

O 



O O ^ )H ^ 
CO ^ 

g O a a 



i^i 










III 

•n l> i^ 



8 
o 



e 

a 

< 




u 

a 



.M .M J4 

U U tm 

0) 8 o 

•3 -3-5 



•^ .^ 4! ^ 



8 




^11111 




i|i|ll|lillJ|lllll lull 



600 



Rbpobt ov State Cim, Sbbtios Cohmission 




III 



I 



§ t 



o 
g 



2: 

o 



S8S8S88888888888888888888 



CO 



Oft Ok 



CO 



CO 

o 



CO 



oo lo M CO eo 

^N w4 «^ ^4 ^4 

O Oft Ck Ok Oft 



CO CO M 

^4 fH ^4 

Oft Oft Oft 



MOOCOMMCOeOCOMMfO 

w4^NVi«»4r4Vi«Vi4«i4*4w4«4 

ttOftOftOftOftOftOftOftOftOftOft 



iiiiiiiiiiiiiii^iiiiiiiii 



Oft 



tococococoGOiocoeococococo 

OftOtOftOftOkOOftOftOftO^OftOftOft 



n 00 CO n eo 

Oft Oft Oft Oft Oft 



jmm^r^^^)f*C4jt9^f^r-*t^9Ht^m*^ 



*^ (O ^ »4 1*4 






90 00 CO M CO CO 

a Oft a a a Oft 

Vi« ^4 v4 S «^ v« 

» » » • • • 

00 ^ ^ to »« ^ 

I ss| JS 

K "^ "^ K I^ •» 




SI mill III in III 




CiiASBniED Civil, List — Ooitntibs 



601 



8SS8SSS8888SS 

§§§§§ii§§§iii 



8 



8 
S 

m 

C9 



SSSSSS8S8S8SS 






n 



ocfta»a»aia»oftCftCftCftCfto»a» 


^^ ^ •<> «<* t: « '^ « •« •^^ 0^ « •^^ 


imnhiiin 


r9ioeo^e9ior«oo^i0^aoao 


e»a»a»a»CkOioftOftCkO»a»a»a» 


-*' 8 2 ••' S5 • -"* 2 S '^' * 2 ^ 


UiiimnU} 












j 



s 



8 






I 



8 



I 



I 

00 



f 

9 



•-iciMoococD^etnM^o 



8-^2 



^ «; ^' 



S SiSl S--S as EJ s 9^ 



•O "O "O 

e e S 



glllllilllll 



11? 9 



o|36G 



•^1 



9 

c 



s^^ 



M M 







Ed U 



■» 5 S *© 



•S -S "i! 

*> fe fe 



■s 




tt 



S S| - « - 
I « "i rt -H 




602 



Report of .State Civii. Sbbvicb Coumission 



o 
u 

CO 

g 



s-s 



1 



^11 







1 



o 



S 






I 

iO 



Si 



g 



I 



in £ 



>» 



O 

i 



S8SS S888SSS8SS8888 



s 



^ CO CO CO 



MClvi^vietv^ «4^i4r4vi«p4»4«i4 



OO OO lO IO 
Ok Ok Ok Oi 



aooiO<-*ao^ioao<Deoioio<o<D 

00»0)OOIO»00»OftO»0»AAOi 



^4 v4 gt 9 



in »-» ^ 6c« 



a* a* 



IO 

^4 



>^eoiHi-ii-ii-ie««oaop«iOio^i-i 

e4 <-4 ^4 ^4 p4 •^ 

8^ 3 S 3 9 3l^ 3*8 -8 sl 



aoo'0»H«o^ioao«H{<oioio««o 

0»0»0»A0k0ft0»0l0k0»0kAAO 



Vi« 00 «H i^ •^ *4 



ei«oeo«^ii;^^pJ 

Ol <-4 *i4 ^4 Vi4 *i4 



asis 

•-» "n •» "n 



* * ■ 



a 



c 






o 
Z 



8 -i .a f u» 








5 

< 



SI'S 



OD Ok 



h < a -• "f 1 



II 




Si 

o 






9 

E 

<2 




«j ■«-• 4* ^ 
:§ .2 .a .S 
•C -C -9 TS 




I § ^ « 

s .a .a ^ w 
S Q. o. a*? 

a 
Q 



^ >H 







CuiBwmsD Civil List — Couittixs 



603 



888888 



£« M ^4 ^ ^4 



SSS8SSS8S8S8S88SSSSS88 
l§§§§§§Sii§§§§§§§S8§S 



M 



8 



<D 00 O 00 <o 1^ 

o o> O* Ok tt o» 

^ ^ — »^ ^ •^ 

<5 lo ^ 01 "^ 00 



r*a»a»aoaooo<or«ooQOo»^a»a»t«ooo»aoooooa»o 
oo»o»o»CkOftOftakCkOftofto»a»oftota»okOko»o»oto» 



f^ MM f-i M -^ 



f-4 v^ O «D 



sss-"-" 






a c d 
•-> ^-» *< »n »n 



lis 



2 


00 


O 


00 


<o 


1^ 


o* 


a» 


a» 


o 


0» 


a» 




«-t 


v4 


t-« 


^ 


*4 




•o 


f-4 


• 

0» 




00 


^4 


fH 




«4 






* 


4> 

e 


• 

3 


1 

-< 


1 


• 




o?843 





eoa»okoooooo<Dr^cooook^a»0)(Oooo)QOooaoo)0 
Aa»a»ckakoftaofto»ckOftoiO)Ofto»o»a»o»0)a»0)o» 

'"* '"* '"* si ^" 2 '^ '^ -^ 4 '^ 2 '^' -^^ §f '^ '^ ^ 2 8 '"' '^ 

IJJlllllll5|sa35s|i|sa 



I 



H 



tn 



$ • : • •? "^ < «" 



■s 






•^{i: 



ou ^ 0i 



•-» *n 



I 



||||^l|li|i|§ 



^ S -5 -S « :». 8 



^ X >» >» X >k 

"O "O "O "O "O 



•s 



^ M M 




III! 



S 






j 



U3 

9 

OQ 






604 



Rbpobt of Stats Oivil Sxbviox Coincissioir 






o 



I 




.1 



8 



1^1 



1^1 



i 



z 

o 



S8 
§§ 



1-^ 



^ 



■I 



t 

< 






M 



i^ j 



00 



- • 



8888S88888888S 
§§§§§§§§§§§§§$ 



88 

n 



M »« M M M 



r4 fH r4 e« ^ *^ 



• • • » 

00 •« ^ »^ 

I'll 



» • • • • 
lO *« *M ^4 «-t 

iiiii 

2 ^ »b i-» i-» 



<0 <D »4 vi^ 



IIJ^I 



22 2222222225S222 
*-*"8* 



lO M ^ ^ ^ 
v-i M 1-4 C« 

am 



mi 



»4 ^ »4 v4 1^ 



• 2 



•2 

»« c 

jl 




lull 






illilli 



! 



d 

^ 



9l 



I 



II 






ill 



a 



CLABSIFnED OlYIL LiBT CSOUNTDES 



606 



o 



s 



8 


8 


8 


sss 


• 

V4 


§ 


• 




• 


to 

Oft 


2 

• 


sss 

• • • 


i 


• 

1 


1 


III 


CI 






CO <o « 

M «4 ^ 

« » » 



^ I 



a 



I 



8 



0$ o 
n 



I 



i 



I ti 11 



i 

I 



88888|||S 



8 



ill 

Hi 

lo M» *e 



• 

I 

I 



II II? 



i 



8 



p 



AQIOIQOCIOOIOl 

iiiii9|}} 

ci»cioocioi»e» 

• • • _^ • • • » • 



j 



I lill jjlljllll I 




^ll 



I 



11 









5512 



^4 

^ ■< w 

"Sis g asgaSia 






{/J 



8 



Is 






J -3 ^ I I 



H 

a 

•8 



a 
I 



I 





8 



8 



606 



BePOBT of StaTB Civil. SbSVICX COICMISSIOK 



•8 -a 



a 

& 



i 



8 



•8-fl-B 

III 



I «* 




o 

CO 

£ 



8 



t 






1 

•< 



I 



00 

5 



Ji 



I 



1 

a 



I 



i? 

a 

9 

8 

5 

M 

a 



S8S 

oS r* K 



s 



§88 



8888 
§§§§ 



8888 
§§§§ 



Ct 



l§ 



lO lO lO 

w4 iH t^ 

a» o a» 



S » S S 












ill 

r4 fH fH 

* • • 

a . . 

9££ 



9 SSS SS;2S 



O 



iO M) lO 

f-4 «4 «4 

Ot Oft o 



s s 



lO iQ 10 « 

w4 *4 ^ *4 

a» o Ok o 



S3S8 

•-» •» "1 -> 



lO lO 10 « 

V« ^14 ^ M 

o> e a e 



M 



I 8|| illl 3333 







CuussixixD Civil, List — CotnrriEs 



607 



8 



8 



88 



888 



CO 



00 



< 



s » 






Ct 00 o 
•H »^ •^ 

a» 01 a» 



Ok OC 00 



'H III 






888S8 

o o S ^ n 



8 88888 

o ^ iM »H gs ^ 



eo oo 00 lo <o 

*^ OH ^ r4 vi^ 

Ok Ok Oi Ok Oi 

»H ^4 oH ^H l-< 

eo «-< p^ oi* C4 



9 






III 



CO 00 00 lO <D 

f>4 vH ^4 ^14 w4 

Ok Ok Ok Ok Ok 

^4 1^ ^4 p^ l^ 

» • » • » 

m M C4 1-4 M 



Ili2 









"I 



00 

o» 




00 lO 00 M9 00 

^H ^4 »H fH »-• 

O Ok Ok Ok Ok 

•M ,H •-) iM -4 


^4 






• 

s 


i 

5 
e 


S S 8 8 S 

•n in •-> "^ "n 


00 

f>4 


00 iO 00 lO 00 

tM ,^ f^ ^4 ,^ 

Ok o Ok a» 01 

^4 fH ^4 ^4 ^4 


a 


1 


83883 



to 



& 



•J 

5l 



>t >> 






5 

QQ 



-3 



P 



5 V £1 B s 



•as 



< 



< 

a ;3 ji B a 



£ CO 
"8-3 



^ .M 



11^ 



S2: 



00 



u 






'Ut 



> o e Si t 

* 00 tfe ^ 
«-<• ei (^ M eo 



£i 



« 00 fc r< 



a 

I 



ii 



i 



55 




608 



RbPOBT of StATB OtVIL SbbVIOS COUIOSBIOK 



1 

T 



o 






a 


'II 
1 

8-8 





o 

H 
tn 

S 



888S8S|8S888SS888 

|§§§§§^|§§§§§§§§§ 
8 

a 

aoeQoo«iooor«ioieioioaoaoooooaoeo 

w* w* 9-* w* w* ^^ .*^ «4«4«4*i4'^vi4'^*^i^»4 
*i4 »4 CI *i4 *i4 

ooooooiQioaotoioiOiOioaoaoaoaoooi^ 

1--^ 



8 8 



w* w^ M »i4 rH 






8 
8 



h 00 J 




.J 






< 
•«5 




till 1^1 



u 
Ok 



t % : o (s (8 fa e 

o o o e 



iilll 




10 

• 



3 3 



01 



a 



10 



3 



Bl 



8 i 



8 



ss 






I 

XI 
CD 



1 



I 



8 



9 
8Q 



1 

I 



Classified Civtl List — Counties 



609 



833§8S8S§ 8S88SS 



2g 
CI a 



P 

o 



^ s 






o 



o 



CO 



S3 



S3S 



i 



C "5 
^^ O eo o» 5, 

8 

O 



9 C) d d oi Oi Oi o> ct 

V4 •■<— «*N»H»ii<F^P^»* 



* • • ■^^ * • • * 

Oft O O Oft A O Ci Oft O 

• • • *w • • • • • 



•o 


•o 


iO 


•^ 


M) 


CO 


w^ 


W4 


v4 




«ii4 


•^ 


o 


o 


Oft 


o 


O 


a» 


«ii4 


w^ 


^4 


w^ 


w^ 


w^ 


*N 


-• 




w^ 




CO 


• 

c 


• 


So 


• 




u; 


le 


iO 


« 


lO 


00 


«-4 


«i« 


-^ 


rs 


t-4 


*H 


Oft 


a» 


Oa 


o 


CB 


Oft 


W^ 


t^ 


fH 


r^ 


«-4 


w^ 


f^ 






»H 






• 

a 

cS 


• 

8 


Mar. 
Oct. 







i 






8 



Oft O Oi 



• ■ « 

S S3 



O 



d 

m 






o 

r > 5-1 
♦* ^ 

w J 

fe w in 

^£r3 



^ 



*- o J! 








< 2 ^ «c >» s 



o 
&. 

1. 

■3 
•a 



S9 

*?T '3 



cS 

o 



C-; 




! 

;: 

3 

M 



u 

H 



»« 

o 

> 









O to C0 to eO t^ 
^^ »<»<»- pM »^ 
Oft Oft 0> O A Oft 

^^ w^ ^•* r^ 1^ f^ 

» » • • » * 

•M «9 lO O •« •* 



CO «o 
Oft Oi 



s i 



• 

8 


• 



m 

a 

cS 


• 

d 

flS 


• 

3 


IP 

-< 


•-» 


•-» 


-» 


•-9 


•n 


to 


« 


o 


r* 


«o 


»^ 


*^ 


VH 


v4 


-^ 


«M 


•M 




o 


o 


o> 


Oft 


O 


^ 


W^ 


>^ 


^M 


»* 


t^ 


* 


«J 


o 


• 
o 








•M 


1-1 


«i4 


>^ 


«-4 


6 


• 

e 


e 


a' 


• 

d 


• 


m 


as 


eS 


flS 


«8 


•-» 


-» 


•-» 


•-» 


►^ 



-5 

d 



o * 



I 



p P O 05 _2 



I 



•o 




© ^ CI I*. 



H M ^ 9 ^ Q ^1 

r 33 CI ^ CO el o 



^ •-• '-' CO 



Oi 

3 



^ 9 M 

« ^ 3 <3 P O 






Qi 



S C 



«? 5 5 s 2 « 

•« C '7 ^ X 4) 

;:) J ;:^ < -z. U4 Im 

20 



d 
o 

(i d 

1^ 



3 
u 



ii 



d 
d 



3 

d 



d c 

- 5 

ll 



1 



d 

9 

d 







■4 



H 

d 



8 

L 

— V 

•§■3 9 

« ^-^ 

•5. 3 h 

•^ S - 
2 >S 



rt 



»-3 

«-• 3 O 

t. o 3 



d 
o 

3 O 3 

- 8° 

d ® 



o 



- 2 c 
d § « 

-5^§ 






o 



<'^^- 



u^ 



610 Eepobt of Siatb Civil Sbevice Commission 



H 

o 



9 

§ 



§ 

6 



a 

111 




8 - 

PI 



§ 

m 
2 



o 

H 



8SS 

oo 95 oB 
o o o 



8 



8 888 



8 



C* '•^ ^ 



S88 



(O (O (O 

«H v^ «^ 

9 9 0> 

v^ t-4 t-4 

» » » 

10 ^ lO 






O (D O 

f>4 v4 «i4 

0ft 0> 9 

94 «-4 «-4 

* » » 

to 1-4 lO 



9 O 9 



■ ■ • 

ss s 



O 9 9 



s 



»o to t- 

o ^ »* 

9 9 9 

•N .IN — 

k • '*' 

6 C 0. 

§io r« 

9 O 

i-< -^ •* 

• • • 

*N .IN r« 




o o o 
M M M 



(3^(3 





I 



i? 



8 



_ k 



2' 



I 



Classifibd Civil List — Counties 



Gl) 



8 



M 



s 



8 



S 



o 
o 



M 



8S88888S§8o 
8SSQS98888S 



o 

I 



8 



a 

(8 



S 



a 
m 






o 
55 






M) «H w4 «M 



S 



•-I lO «f *N o ^ 






s 




S 



s 



1 



8 



• 



94 



o 
55 



oaakoaka»elkai909 

04 *N *N »4 «H 



l-» "n "n fe 



llllll 



3 

o 

I 



I 



! 



H 
► 

b 

& 

a 
o 



M 
O 



I 



s 
i 



S ^ 



I 



s 



d 

o 



n 



5| 



I 

IIS 

GO 00 Z 



iS 2 35 



S3 



O 

I 



|2 

Its: 



■5" 






.s 
S 

Q 



I 

a 



•s 
e 

u 
o 



- c a 

* *c 9 jQ — a 
^ •§ -^ J S 9 •S 3 M i t 

I 



lki . •-» M " 
5 ^ Ti f3 3 J i 5 13 i 




am 



^ 
^ 







9 *S i *S « -^ -S •& •S "tf •£ 



I 

i 



612 Report of Stats Civil Sbkvics Commission 



o 
o 

g 

o 

3 

3 



i 

a 
d 



8 



a 

'If 


as| 

8 



e% 






d 




>5 

O 

H 

»^ 

TO 

£ 



s 

f 
S 

1 

I 



o 

H 
H 



S8 



%888SS § 8 



8 



66 o 



ss 

00 O 



SS 









8 

■ u 

S. o 



CO O O CM 



eo 



eo n CI ^ 1^ *-• ^ 



88 



«0 30 v^ t^ 00 ^ 

on *i *<< *M ^4 «M 

OQ Ot 9 Ok O Ok 

•^ »i ^4 •-< ^1 p-i 

•N eg 00 o o O 



00 



0» 



• • 

O ft 

& I 



00 00 t« 00 ^ 00 

»^ O 1-1 p-i »i ^1 

Ot o o o> o o> 



•H CO iH 

^S3-S 



O CD O »H 



o 



^4 04 74 CI 7^ 



si 



«> 



I 



i 



55 



a 
a 

CO 



c 
o 

•c 



t3 
(3 

O 

E 



^: -e 



O 

On 



ii 



> 
< 



£ 

o 

I- 

^ £ <C o (O 



A 8 



I 

A 

o 
Z 

00 •*• . K 

S I g 3 

si"? 



» at 



II 



il 



I 

M 
CO 






V Si 

« fl 



S .2 

II 



= 8 






s 

.5 



m> 



« 

.a 

a 

o 

t: ^ j4 -^ ^ 







s S t: 

^ S 9 

Q w V w & w S 



^ pa «■ pa* ^ 

o « V & n 



8 

(5 

o 

e 
o 

eS 

2 



Cuka8iwa3> Civil. List — CJouktieb 



618 



88S 
M.I 

« « ^ 



S3 



S SsS SS88SS SSSSSS^S 

as 



r> c o 
Ifl -«♦. Q 
I* *0 CO 



91 Q ei n 
« -* « * o 



« rt O P C3 

o ^ ^ 00 

d ^^ ^4 vH «H ^ «-4 



s 



00 r- « 



09 «3 0» 

^^ •^ »-( 

•: • *i 

£11 

«-i t^ to 

^^ v^ ^4 

at o» at 

^m 9^ ^^ 

• 

III 



r 00 

«• OD 

•^ S S 

«D n oo 



j2 



.1 



« 




0» S 




CI ^ 



XI 
t4 



O 

o 



a 
« 



o 

o 






00 

o 



O 

00 

o 



O 



>s 



8 I 

■ — 

E 

s 

o 

g 
I 







E 



a 



« 


») 


GO 


Oi 


00 


r^ 


o 


•* o 


o 


s 


§ 


9-* 


s 




t-4 


§s 




* 


w^ 


f^ 


«-l 


f* 




• • 



f^ tM *N •-• r>B t^ 



o — ^ 



. 9 

c e 

«8 9 



C3 C .^- VI C3 es 



M >> >> >« 

■• « eS eS 



«fl « 00 

'^2 2 

0> Ok 00 



© on r* o o ic 
i-« o r5 -< c; f~ 
e> 00 o» 9 ^ r 



r4 v-l <H »M t» t^ 



o ^ ^ 



a a a 

dS 9 2 

•n "^ »-» 



tf 9 -; *e ^ *^ 

•-9 -» < « .«5 (^S 



• • 5 ^ • 






^"^^^ 


• : S J : 
















O . T" 


; c . 








o 






gl^ « : 






~ 




J 5 


^ 


2 



s 

o 

i 

H 
Ob 

c 
U 



o ^ 

Sc3 



s ::: »: 22 2 h ou 



is5| 

iJ tt -* S 

8 ►^ W ITS 



i ^ 






ZS i> q 9 

h *-« 9 o « 

° « H Q c3 

C » «■ 2 -2 

C X m 9> %. 



a 

(8 



> 

ha 



J) 

c 

T 

a 



a a 
c o 



■ zr •- ^ 



^ >« c n at 

o c «=• ^ S 





1-4 ^ 10 «« 

•M »^ ^H •i^ 
OB 01 oa 

,-m 9-* w* 9^ 


10 M 00 1^ 

V ^^ *4 vM 

a> a> 

«-« 1-1 •^ •-• 

« • » • 




v4 ^rt *i4 ^4 

^ 97 S V 


Jan. 1 
Jai. 1 
June 15 
June 30 


1 

•1 


— -i* « ^ 
•^ »« vi ^4 
c» oi 

I-4 •« 1-* vH 


If? *i ^? •^ 

•-• 1-1 "^ 1-1 
Oi o> 
-^ 1-1 ^- 1-1 



o 

■ 
o 

> 

flC 
H 



H 
OQ 



K 
fi 
BE 



o 

H 

■4 

K 






e 

e9 







« 

D 
CO 

H 
O 
SK 

a 

M 



:ii 



•I (3 

(K| (L pE( CQ 



5 

e 

a . = " 

si 

3l5 



d c 

S-'C 

"-9 Ph 



•r o 



.a 
>» 

§• 

o 






d 
x: 

s 



d 

9 

8 

d 

c 

a 

o 



dVjSjStS3 9 9 



614 Eepoet of State Civil Sbrvicb Commission 



O 

M 
»-) 

O 



CO 



i: 



.1 



e 
c 

g 

s 

S 

c 

O 



c 
o o 
"S - 

^•« s 

Q 2 5 
a S 

a 



8 



M 



8 



8 



888 %%%^ 



S 



e* -^ •^ 



2 ?: 



1^ 



c 



r* 

9 



e 

c3 






a. 



et 












:« O & 

Sf " t 



c 

e 
c 



y. 



C 
P. 



rt 






-3 
es 



> 



C 
H > 



2 

5 


<* O X 

c? s s 

^4 «.« IM 


n eo r* to 

«« *4 «4 O 

oa o 01 9 

v« 94 »« prt 


» 

^ 


r r -^^ 


» fl» * M 
1 1 - 1 


• 

S 


D«o. 
Jan. 
Mar. 


►^ O *» < 


CO 

o 


'<l« o » 

S o s 

V^ ^i« ^« 


« « — s 

•4 *^ «4 P 

o> 9 a » 

«M W4 v4 p4 




r r - 


MM 


e 


Deo. 
Jan. 
Mar. 


Jan. 
Oct. 
June 
AprU 









e i- 



Z 



it 

u 
C 






e 

O — r 

u 

« 

o 

c 



C 



s 



E q 



6 -2: 
o »< 

Cx3 






0S 



e 1^ 



o 



o 
9 

H 

b3 



o « c 

n cG CQ 






^ S * 

-2 "5 « 

5 -I J 

OQ ffl 4 



3 



e) 

c 






(^ 




!1 






111 

ax's 



e 
> 

X 






is 

a 






c 

-3 

M 



■3 




Classified Civil List — Counties 



S8SS8SSSS8S 



s 



CO 



O 

o 

8 



S8S 
8SS 

« 1^ »^ 



8 888 



615 

88 



CO 









« ? 



^ w w B Ok :j s 



coco«430iocoOainaoao 



I I I 2 -^ I I f I - -* 



11111111 

^ js M M 2 -o js ja 

k h fc, U3 M u 14 

c> B C u V o « 



.C J= 



^ ^ 




;3 ;5 '3 '-3 »? *3 '3 "#3 XI '^ \S 




8 









llllll« 




0» 

O 



e 






e 

<8 






c 



o 

w* 

o 



c 

<8 



qp «o t^ 

O »-• »^ 

d» 9 0» 

•N ^^ rH 

• » • 

eo p^ ^ 

•a o 6 



oo »o t^ 
S o a 

*N l-« ^4 

» » » 

eo •-• »^ 






ill ai 






o « - 

M 

hi 

E S 

o s 

e 
s 



3 

M 



« 



K A* O4 



?3 



e 



8 



9 od • 
^ ** '^ 



4; 



c 






c 



{a ^ 
§1 t 

2 5 S 

C w QQ 



00 

O 



e 






00 00 00 

•-• *4 ^4 

9 0ft 0ft 



c 5 



00 00 00 

VH ^K V4 

Oft O Oft 




c 
c 

■** 

^^ 
c 



e c 

C C 

•d -S ^ 

•- ♦* S" 

a c S 

« 4 Q 

I s » 







00 00 

Oft Ct 




ice 



a 
o 
O 



S 

is 



9 



X 75 



S fi 
c e 

a e 



es 

g 



616 Bepobt of State Civil Sebvige Commission 






•5 



S 

c5 



e 


o o 


e of 
ce in( 
posit 


-S c *- 


D 
cntra 
rcsen 


a 


2 • 




! « 2: 


^ ^ ^ 


cS? 


? *s 


«> 



o 

o «• 

coo 

t .5.S 
J- ♦* S 

« c. 



■! 




2!: 

o 

H 



8S 



s s 

o c 
o o 



c 
e 

I 



e 
o 

"i 



E £ 
E E 



88 



8 



iO o 


o 


QO 


^- "^ 


^i^ 


^< 


a o 


c: 


e 


•^ ^ 


** 


»M 


» » 


» 


«, 


»M ^^ 




*H 


^ 


• 


• 


a e 


e 


es 


3 ee 


e 


«5 


•-> •-» 


•t 


^ 


*n o 


c. 


« 


»— »* 


^i^ 


*4 


C) o 


e 


e 


•^ •-• 


^< 


»H 


^ ^ 


» 


« 


1-. « 




F^ 


>> 


. 


• 


C es 


c 


cS 




4_ 


s 



o 



c 

CS 






e 




s 



■5 



Ss 

E-T 



P 



s 

E 



,i< Jtf .ii£ 
fc> u b 

c c c> 

CC5 



I 

U. 



8S8888 
§ 8 8 8 8 ."? 

in ^ w^ W-* ^^ t^ 



o o o o o o 



CI 

-; e O « fj 

9 4 J5 G QG 

c 



e 



* t* !>. M t^ r^ i» 

J* »« 1-4 «4 v^ v^ vM 

9i o e» o o o e» 

^ m^ ^^ m^ m^ w^ rmt 

^ »H «-! I-J »4 .-• ^ 



Ji 5 5 o o o 

K 
B - 



•J 

E 
u 

H 

H 

-< 

& 

> 



> 



ee 

H 

(14 



7 

o 
O 



6 S 2 5 2 




ca 
CO 

& 
s 

H 

s 

A. 



O 

•C '3 O O C TJ 



« 






.9 

I 



^ J: -4 S 

c « = £ 3 

u^ ^ H u:c 



I 

as 

-3 

> 



8S 
8S 



Ok o 



2-< 



«<• et 

9 O 




1 1 i^5'llil sil 



a 

d 

o 

E 

a, 

a 
c 



ss 



8 





CijusimD CmL IjIst - — Coinmsa 



s 


s 


sss 


S8SS 


s 
z 

1 


1 


ill 


iiii 
illl 


1 


P.i 


iiii 


! 


s 


III 


ifii 



S3SSSSS %8SSS888 



iijiiji lliiiiii 



2"j 



i I 



J I: 



J 



ij i 



III! 


III! 


ilm 





.sllllll 

I i3 Jaix 2 = ta 



'. aasassss 



i i; 



Mi 






Hi 



3 iSBi 



ill 

III 
i i i 






II 



iMlill 



618 



Kepoet of State Civil Service Commission 



a 
'■*» 

s 

CI 

g 

c 
U 



s 



SSiS 

O « -* CO 



w •^ 






o s o 

o o o 

80 o 

S 2 

f~* O t» 



c 

2.2 



G 

9 



o c 



S p 

£ i S 



8 - 

_ a 

:s - 



1 •» 
81 



6 
2 





1-« 


00 


1018 
1007 
1014 
1018 





0161 
UIOl 


1013 
1900 

1018 


* 




>4 *N CO *-« 


9^ 


* • 


• • • 







►^Q -< 

30 1^ « GO 
-* •^ *.* 

S o» s» 

*H Vi^ v4 «-l 


• 

S 


■ • 

AS 






(O «D 

oe 


CO g X 

S S 




« 


.- *« CO ^ 
^^ 1-1 


*4 


» • 


» • • 


1 
< 


4 


fi 8*1 *i 


• 

1 


• ■ 

4o 


^S4 



-1 



9 



Sim 






H 



2 

O 

H 



I 



o 
o 



t 






o 



H OD 

ill 



a 

o 



g ^ 



•3 >» -*£ 
O -S § 



2& 



111 

tit 

M4 «*■ "^ 

K 0« tf 



^ a «; c 

c ^ ''* w 



a 

H 
H 



I 

00 

fid 

•a 







U 



hi 

*3 n •< 



B 9 






C 



3 
o 



f S 
"a « 

ISM 

e O O •*■. 



X <£ 



CQ 



n. 

(9 

i « 

O « 

u h. 

& JD 



.s 



c 
c 



• 6 

I- 

OH C 



8 

s 



Classified Civil List — Counties 

8888SSSSS888S8S88 
888S 






8 



619 
8 



N -^ C«l 



d 

m 



to 
o 



e 






a 

00 

o 



?5 




5 I 

6 1 

H 
M 



s 
H 

§ 

S 






I 
I 



V* 


1906 
1910 


lO CI o 

W* W* 9^ 9^ 

01 0» O 9 

,^ ^4 1.4 *N 






CI M O 

Vi^ ^^ ^4 

Ok 9 Ok 

^4 vi* fX 




00 




X 

^■4 


00 


• 




• » • * 

-S8- 


• 


»-( 


§3 §3'" 




m* 


^rf 


w^ 


^4 


• 

s 


u 




1 


i 






•S 




^ 

3 

^ 


"-9 


"-9 




S 2 
8 o 


O lO M o 

^K W4 ^4 vi^ 

o o o» o 

«i4 ^4 vH *M 

* * • » 


* 


1^ 

• 


M M O 
*H ffrt »H 

oe o» o 
»^ »M »M 

» » » 


t-4 
• 


00 


00 

• 


00 

^* 

• 


oc 



^ K o CI c« ^ 



|||ii^. 






m 



2 



B -a 



>.^^^ 



9 3 9 



1 

M 

& 

6 






S S S 3 is is iS iS S i2 S i2 S (2 iS ee « 



5 -s S J! 



a=3 .5 •- o 



■2 = 



";! 









iiii 






« 

o 



o 






M g* hi 

- ^ s I ^ 

c ♦* :a c 3 '2 

H << H iJ S N^ 



» 



ttj K .t; 

^ w I 

« I S 

{>< s: < 



.s 

c 









2? 

5 


i '■■ '■■ ^lilllllllllll 

i^-jiiiiiriiiiiisi 


u 


||||1111111111s1l 














s 



e 




a 

•9 

O 
















e 
o 
■*> 

& 

s 

t2 



y. 



3 5 

H 
M 

H 






I 



9 



689 



Eepobt 09 State Civil Servioe Commission 



IS 

8, 

T 



S5 

t) 
o 

CJ 

H 
H 
CO 



,1 



)i 



d 

•J 
I 

e 
d 



G 

ii I °' 

5 2 2 

e 8 



sssss 

§§§§§ 



■3 -ft 
g'3 



— e ec et «^ 
*-■ 9 v^ ^ Q 
o a oi 9 8 

*i4 ^4 ^4 ^4 *N 

t-T •^ e* ^ "^ 



a 

9 



II 1 1 



n 



M M ^ 
^« ^4 O 

9 a» S 



«o •N e* 

t-4 1^ 






9t 



^ ^3 a, 

Is a> e 

i S a 

S"" ♦- a, 



dS 



f 
ft 




^.^ jja 

>> . CO d r 

" I! - -* fi s 

^ ^ ^ o o e 
S '4' aa b> 1-4 ^ 



1 



a 
5 



•3 4? 






o 



^ 



o 



|i||g 

S 1^ 2 cs <» 



J< ^ ^ 




s 


-3 




• 


i 


1 


eo 


S 


8 




s 


O 

9^ 


on 

*i4 


^4 


^N 


1 


3 


^^ 


2: 


5 


• 

i 


00 


8 

^4 




r 


* 
^4 


• 


• 

7: 


1 


• 

1 




o 

fa 

c 

c 



s> 



c 



8 

S 



k!9 



8 
Q 



a 

08 



e 
2 
Gi 



I 
& 

a 










esi 



A. 

91 
O 

O 



s 

5 



3 



9 

J 



."4 
O 



u 
3 



e 


k. 


?i 


v« 


k 


c 


t£ 


o 


O 


s 


b 


k. 


« 


o 


^ 




c. 


a 


2 


2 


^ 


M 


o 


O 


e 


a 


5 


s 


CO 


OQ 



o 



•S 

4>> 



s 

CO 






a 

4 



a 

4 



d 



<3 



• 
d 
I* 
o 



9 

c 

I 

I 



Cl^ABBTFIXD Civil LiBT CoUNTIZS 



621 



S 

s 



o o 



s 



8S8 



8S 



CO 



o 



8S§8 

eo « 



1 


1918 
1015 


94 ffrt f.4 

o» e» o 

w^ w^ m^ 


»J 


1-1 •-< 


f^ fi w^ 


1 

< 


E5 e 

Si a 




w^ 


•O « 1^ 

1-1 ** 11 

Oi o o 

F^ •-< »H 


9-S 


»H pH 


» • » 

•N iM 1^ 


< 


ii 


all 



8 



a 
I 




I 



a> o 

G a 
c o 

s 3 

S E 

e a 
66 



us 



r/j 



« 



SE:s 



O **• 

Is 
SO 



o o 
5 a» 



5S 



o o 



d 
o 



I 



si 



sl 



CO 



c 



00 



a 



00 00 

O) Ok 









CO 00 o -^ 
r4 v« A *M 

Oi Ok 9 O 

^4 ^4 v^ *N 

• • • •• 
»M »M r^ I 

^ ^ -! 

I«s s ^ 

55S4o 



C — 



||S6 



GO 



GC 




C 

o 
C 

K 

CQ 



a 

I 

1 




622 



Report of Statb Civii, Service Commission 



S 



8 



S 



ei 



s 



s 





O 








• 

o 


o 


oc 


r^ 


w* 


>> 

1 


• 

1 



o 



e 

as 



o 



s 



a 



s 



•9 

3 



T 

o 

s 



^ 



H 

H 
Q 



a 

I 

CO 






! 

o 
2 



2 

«» 
2 



6 






I 



g 

e 

8 






I 
S 



3 



a 
S 

I 



o e 

Pi il 
8 Ss 



00 



P 



5 

1 



I 



1 

I 

o 

I 



i 



9 
X 



Ci.AflsiFiai> OiTii. List — Counties 



623 



8 



8888 



8 



8 



8 



888888 



O •-• CI C4 CO C4 



n »« P4 a 

»4 »4 O O 

a a S S 



I 



^ «D r» t^ 00 t^ 

o o> o> o o o 






nu 



2 h. g g 

a 8 8 S 



9 



i 



Sis !: fl -^ a 



^ CD o r^ r» 
o a a a 9 



•4 n 



I JIIJ 



I 






t 

a 

<3 



9 
O 

I 



"B 

s 




« fO «4 ^ p^ 





I 



8 



•8 



11 






P 



.& 



s 






i 



d 



CO 



o ^ 



Is § ^1 

■< ►? ►q < Q 



6 

QQ 






-.11 






: — w 



g I s llliss I 



s 



I 

o 



K 

p 



I 

I 



a . 
:3i 



in § bG J 

M h 8^ S S 
' £ o 3 ►■ c 




dd4 



KspoBT 07 Statb Civil. Sbkvick CoMinssioN 





SS8 



S88SSSSSSS8888S888S8 

s§§§§i§i§iiisi$99iii 



OD « to 

ri« «-« *H 

Oft Oft a 

P4 •-< •-< 

» • » 

IC f-i ^ 



aooor«aot^oDt^t^aocD»»»»ai^ioor«eeeoce 



2'"J5SS2S^2-'"2'^S8SS 



to lO 00 1-* >« 






00 « to 

«iH •-< *i4 

Oft O flt 

»-• ri« fH 

• » * 

lO «^ •-« 



oooor«oor«ao>cr«ooior«t^a»*ioor«aooo« 
a>eia>a»a>a>a>a>eaa>a>eiaDa>a»a>a»oioo 

iilliiliiiiiiiiiii 




s 



2 

o 

^^ 

H 

QQ 

2 




Classified Civil List — Coumrns 



625 



SS888888 



8888888888888888888888888 



o 

?2 



8 



8 



SI§I§IIHSIS§ 



^ p^ M t^ CO 






*4 v« ce 
■^ ^ -^ ^ 



r* •^ po «o o 








K •-» &3 




d6»3£(S(S(So 



00 

^4 


o 


00 




-^ 00 00 

*i4 *i4 *H 

a» o) Oft 

^^ 1-1 ^4 


00 00 00 

iM f-i ^1 

a> a» o 

fi^ ^1 p^ 


CD t^ 


00 00 00 

r^ w^ w^ 

o o a» 

fH *M *H 


00 00 00 

^4 pH pH 

a> o o 

ph M *H 


00 00 00 00 00 00 
*H ph ri« r4 p4 p4 
Ok Ok Oft Oft flt Oft 

P^ P^ *H •-< *M «-« 


00 

Oft 




•-4 


t-4 


»H 


» » * 
»•« «D r« 


* • » 

>0 VH lO 




w^ f-4 ri 


CO lO lO 


O (0 «o tC V o 




O 


• 

a 


1 


• 

3 


►?0<200 


sr g g g g 


•^11 

•-» OD ^ 


> ^ ^ ► ► ^ 

mill 


1 


oo 
o 

^4 


o 
o 


00 

i-i4 




•^ 00 00 

IM f>4 «^ 

o o o 

^1 ^1 f>4 


00 o to 

ri «^ ri 

o o> a» 

ri ^1 ^1 


*i4 ^4 


00 00 00 

iM ^1 p4 

o a» a» 

pH ^4 *H 


00 00 00 

f-l «i4 f-4 

Oft o o 

*H P^ rH 


00 00 00 00 00 00 
v>« «>i *4 ri* ^ (H 

Oft Oft Oft Oft a a 


00 

Oft 




IM 

»ii< 




^^ 


--■ 2 ^* 


CO CO o 

^ 5i 




*M ^1 *i4 


«D lO lO 


o (cT CO 1^ V o* 

»-» r4 vi4 ^ 




• 

S 


• 

s 


2 




Ill 


III 




III 




1 



1 



a 

I 

> 



:^. 



3^ 



aiii||ii^i.ij|.{iillllllilli 



3 3 3 s a s a 

U H U U W W M 









a 

c 






■^ ?^ 



a! 






o 

t 

o 
•a 
c 
o 

M 



3 

1-3 






Is 






•Is 



= -I &I H 3^ 
















T 

^ 2 ^ 



X c c c 
c o c! *« -i t 



c 



a e 

. 2. C 

c r • 

» E R 




jiiiiiiiiiiiii 



626 



Repost of State Civii. Scbviox C!oicicissioii 



I 

8 



o 









0* ** 



1 

in 



8 



8 B 




I 



2 

O 

H 
oo 



8 



00 

at 

* 

3 



a 



a 

o 



e 



8 s 

OQ 



I 



P 



i 

JQ 

(3 

•3 



a 
.S 



8 



C4 



8 



8 



00 

00 

e 



9 



3 



I 



i 



3 

5 



I 



8 < 

OQ 



I 



a 



M 



P 



5 



i 



! 



d 

o 

I 

e 
s 
8 



9 S* 



I 






e« 



00 lO 






00 lO 



O 



S 



8888 
§§§§ 

* • • • 

O CO M *4 



*0 CO 00 CA 

*M Vi4 P4 *4 

o» a 01 o 

^4 *i4 ^ *4 

^ t^ 00 « 



III! 



iO 00 00 oc 

•H *i4 v4 *« 

a» 01 9 o 

Vi4 f4 v4 *« 

M • • • 

<-« r« 00 10 

3 all 

•n •-• ^ h 



J 



fl|l 




Classified Civil List — Counties 



627 



sss 

» • • 

CO ei O 



888888SSS 



^^^^Ci»-»MW»-» 



8 



CO 



888 



ct w4 a 



rt 



s 



4i .'Z 







H 



1 



3 



'S 



c; 



o 



<3 




•H O »* ** CI ^ -^ 

^ ^ S 9 '&^ S o 2 



A Ok Ok w 

«-« «4 *H 
•i« t^ P^ 

III 

O90k OTOkOObOOOtOkOk 



»• to M »i^ »^ 






*H lO O "4 
t^ ^ -9 





o 
o 



0» 



CO 

o> 



s 



«D 
0» 



9 



CO 
^^ 
0» 



3 



1 

3 

M 






J 

«< 



a 

§ 

.a 

o 

s 
s 
S 



i 



00 

o» 



"S" 



g 

z 



s 



00 



u *« ^ 

2:S4 



^» 




628 



Report of State Civil Service Commission 



o 
u 

» 
u 

H 

CO 



c 


o 


•5 


21 


6 


o 


O 


c 


e of 
CG into 
positio 


eS 5 «> 




a 




o — > 


c t t 




'SS'? 


c -3 


& 


o 


c, ■»> 


C w. s 


0*0 6' 


rs « 6 




fi-i. 

5 « c. 


S « 


1-1 



8 



888888 



8 



8 8 



88S 






8 



lO lO CI CO C« 1-4 



o 



e 






a 



r« ^ o 00 r« 1^ 

^* ^^ r^ Q wt w^ 

O Oi Ok o o o 



^^ *M ^i* f-t Ct lO 

»ii< w ^ 



a e c d a a 
(8 <9 CS (S a .«s 



t^ -* o CO t* r* 

»^ ^< ».^ O '^ *■* 
O Ok Ci O Ok o 



I>4 VM tM l>4 C« lO 

t-i M »^ 



Q q d c e a 

c8 CB 08 (9 OS O 



S £ il 






I . 



5^ 

O 



2? 

c 




E 

o 

H 



•*< eS w .0) 

© '^ ts ej a 



c o 

3S 



1§ 

!'- 

1b o ^ 
L c « 

£ (^ 6 



>» 
b 

9 



e 
ae 



us 
c 

M 

O 

c 
S 



C 
^ O « 

ft c •» 
rt — C 

c c <c 

S 3 =5 



CO 



c« 

i 



c« 

I 



•«• ^ 



5 

< 



e 



S O 



lO ^ 



— 59 - 

w^ m^ w 

o o o 

*M *4 «« 



W M tt 

3 S 5 



— « — 

Wi« V4 «« 

o o e» 

w^ r^ r* 

or »** « 



e 

« 



<9 



g 



n J 






I 

el 



9 




CI.ASSIFIED Civil List — Counties 



629 



I 



S8 
8S 



SSSS 



e« M «! 04 



8 88 8888888888 



»H e* 



8 



8 



ci«-«fH*Hi-4eoe>ic«ciM 



00 



s 



M go ao 

sis 



00 



«D 



OOdOICOOOOOOO 

_a^ ^^ ■ _^ ^_4 - __d ■ . ■ a 



3 

00 



8S 



a» 






c% c% c% 

sss 



o 

a» 



^ 9 

_ 

a» S 



s 
s 



r4p4r4lO«-«tH«H«HfHr« 

S S S|| s S S| s 




•^r^O*^^^»-*r^'#*^»^ 



3 




e a g fe 



o S — 



s 



lid 






U 



9 
O 

3 

M 



a 








!5 

9 

09 



31 



H 
H 









^^ • • • • ^ • 

g S 9 § 9| g 9 



<2l 




3 

s 

A. 

a 



•3 



e 

-3 
ii 
eS 

a 
S 
.a 



e 



C3 

oi a 



.1 



« u 



It: 

n 



a 






c 



iB m iQ ita 

mm* tm* •*« "r* 

Im k. M L« 

0) « O C< 

^ j3 ^ .a 

■ « « « 

«* *> «J 4>> 

9 9 3 9 

o. Q. a a 



030 



Repoet of State Civil Service Commission 



3 



88S88SSS888S888888888855S8 



8 
10 



§§ 






e 
5 2 

HI 



I 



e 
o 



° 8 
r ^ 



Op 

e ^ c 

^ « e 

2 .5 .5 

- *• § 



s 

es 









M ^ N »^ " 



N ^ 



d 









7: 

c 



B 

a 
a 
o 



iOio«5eoM«o»'50oo*-«oe«opi*r^r^r^r*oo^«c>o»aio«D|5 



S^Si 









BdC7c3flS^diiaoC3--n 






^•0 




r. 



'r. 



I 



C 
2 



H 




>k >k >» 






>)>»>t>»>i>>>k>k 



3 S 

a a 



3 
o. 



3 
a 



3 



3 
C. 



3 3 

a a 



3 



SadSSa 



3393S3333P33999s 



Classified Civil List — Counties 



G31 



SS8888S88 
gggggggg 



88888 8 88888§88o3 



8 



^ CO CO 



M 



28 



8SS 

cs ec o 



rm lO 



iococ«cD«Dcot^r«eo 
lOeoMOOtei^r^eo 

f^i sa§«§-t 







f gil"?^^ 



I 




IB to IB te IB «: 

-S •*! •?■ ••■ •?• "* 

•al-s-g-g-s 



a 



CO 

O 

CO 

i 

CO 

O 



o 

OQ 



8 






r^ O >o CO 00 

^< ^^ fii^ ^^ «M 

O Oft Oft Oft Oft 

•H p^ ri« ^^ »H 

eo V «o "^ »- 

• • ^, • • 

6||6 ^ 



r^ o lO 00 00 

1^ r.4 r^ r^ r^ 

Oft Oft Oft Oft O) 

«^ *H fH *M *H 

c. ^ eo •-« »-« 

> > ^ > i 



§ 



a 



e 

a 
o 






s 

i 



.C ^4 (^ 

B3 'S '3 



? C3 



.Ilia 



t: 

•J 
•s 




O>ooo«0aaotocor^^ 
OftAOftftOftOOftfltOOft 






o*o««eaoo*Aon^ 

OftflftOftOftObOft90ftOOft 










3 



s 



I 



IsliJil 11 



I 



Ss 






c 



a %. 



■ft 










632 



Repoet of State Civil Sebvicb Commission 



8 



O 

o 

CO 



o 









a 



1 




^ ** ^ 

M « ex 



O 



O 



8888S8S88 o^'o'' 



8 



8 



§§ 



o 

8 



88888 

V n « •* H 






^ i-i ^ M M f-l »-i 

fcl ^^^ *? *? 



r^ 00 00 lO lo 

iM «H iM iM t-4 

0)000) 



M M M t« r^ 

•H *4 r4 iM •-« 
Ok O Ok o o 



•oco<Ot^^fHoooeao>ou3 

fH *i4 ^4 C< C4 iM v^ 

!« ■ • • * *p* ^ ^ ^ '^ •? 

^ c« u . 

.^ o o ►^ 






o 
o 






o 
*^ 

o 






O ^ O Q eQ 

•4 l-l ^ «« l^ 
O 0» O O 01 



•-> O "^ •-> "n 



o ^ o Ok eo 

^4 ^^ V4 »4 ^ 

Ot O O 9 A 



S«S83 

•^ O •-> "n •» 







OQ 



o 

p 

CO 



S S 

o o 

- ft. 



5 £ 



i 



04 



8 






3 

o 

H 
H 






ti^^ -6. 

#P ^ #P ^ •* 

On ti 04 e« lo 



CS 

55 
< 

k 

o 
c 

O 




> - 

u o 

CO »- 



§1 



o rt 



a a a Q 

OS g« el -g 

e s s 5 



o * 







2 -• 5 « « 



.s .3 ,= a «■ ^ 




2 2 
g 2 

c, u 
o o 

2 2 

«S rS 
> > 

pai2 



*■ 
3 



: 55 

5-2 



CQ 



■ o'o-S 2 
mil 



Classified Civil List — Coubths 



633 



ggSSSSSi 



8S 

<•• 00 



§ 



§ 



s 



S8 



88SS8SS 



§ 



8 



o 



O Ci Ci Ci Ci Ci ^■i Oi 



cs 



rt O 



o o 



« O "J^ 00 ^ •* 00 

•^ »>i^ •M Plrf »^ o »^ 

flt Ok o o o> S o 



p^(C<^^4C0>-i<-''H 







(8 



83 



a e 

•-9 »^ 






IiM iM N o ^^ 



s s 

Q Q 



»^ O •^ O 



eS 






a 






o e 

O Oft 



« o c^ 00 •* ^» 00 

w< pw «M »^ »^ C5 "^ 

e o n a> o o o 



iMO<^OC0»^<-4*ii4 





S3 



d 



eo 



{»-^ wii* M O »-f 



n o 



* « S o < "8 S 





6 

Ml 

£3 



(B 



8 



.a 



9 



a 

IB 
O 



o o 



E 



£5 J &a-S § 



M Dm 












e 

«3 






a 






8 



«) ^ M 






S-3 






x: 
c 




9 

e 



15 






e 
c. 

s 



00 



O (3 k. 

ca O O 



(m U h< k. h k U 

« Ci 0) 4« O O V 
0000000 

it? £ € £ e £ is 

o c o c o o o 

G c a a e e G 

.2 .2 .2 .2 .2 .2 .2 

c8 cS cs e0 eS e9 c» 

.£ J3 ^ J3 ^ ^ J3 

O O O O 3 O O 

Ph £ pl4 cu, (I4 cu CI4 



634 



TiKPOET OF State Civil Service Commission 




s 



r:i 




8SSSSS88S8 SSS' 



CO ^ 



8S 

CO ^^ 






of CO 



f-4 f-4 fM «ii4 Oi "^ 

C4 ^ 



« O « 00 ^ 

PI 1-1 1-1 



o • ff « 

O &t« aS [s« 



I 



M 

9 



a-g 



^ 



S? 



Q << ^£ << S A t^ 






■«!"«-J-^i-4»ii«i-7co«o«!>ad»-«o 

MM ^ M ^ ^ ^ 




1^^ . 

►^ ^ OT «^ •-» 



a^£^ 



c 



c 2 «:? 2 

M C r> O 

g t, § o 

O c o c 

- O tJ o 

•3 te R 08 



8 's; >. 



2 o © 

g o £ 

2. o o 

§1 i 



c 2 O 

9 e O 

o « d 

«-2 £ 

c 3 > 

3 O 



e 3 S c 
5 9 2 3 



'888 



lis I 



0C0O330O000C0O 

caecaccdaciaaaac 
oooooooooooooo 



^ I ^ JD ^ 



J3 .O ^ j3 ^ J3 ^ 



«8 « 08 



p O O C O O O O O 'o o c 



SSSSSii 



8 



o ^ « a «- « «« 

•M P^ »4 O »-• ■< ■* 

o a> cft o o o 9 




O •-« M 

*H vri f4 

o» a> o 









-i&lA< 




H 
O 

u 



.s 

8 

•s 
a 

9 



o _ 



a .d I S S 5 i 
w s ;r -e u: s z > 



"^ r^ ? ^ 




at^ 



^ s S s ^ 

^^ ^^ w* y^ s^ '^ "^ ' 
^ b »• ^ M k- k 

lllllii 

>» >» & ^ ^i^ 

d a d c e d S 
3 S I g 9 9 I 

OoSouCw 



Classified Civil List — Counties 



G35 



8SS8|8S8888888888888S88S8S88S888S88S 
8 



o 


*4 Vi4 


o» S 


N. lO l« 

«4 *ii4 O 

oi a» 5 

«^ *ii4 *ii4 


o» 

*i4 


r^ o o -* 

*^ *M vi *H 

Q o oa o 

•-« t-l t-l t-l 


o ^ 

*M til* 


o o 

t-l »- 

o ca 


a r^ (O 
o *•< -4 
S o o 

t^ ^4 rH 


a 00 
o •■< 
S © 
1-^ -^ 


o 
a 


a a 


O 

ti4 

ca 


CO 

*i4 

a 

^4 


o 

ca 


ti4 

a 

t^H 


S a 
-^ t-l 


a 


a a c> a 

,^ ,M i-l 1-4 


le 




g-o> 


1-i 00 r*r 


^ 


1-^ CO CO N 
W t-l 


00 g 


00 lO 


04^*14 


t-T « 


00* 


gf-" 


i-T 


W 


• 

1 






«* 


t-T r^ »o o 

«M d p4 


• 


II 


II 


III 


& 

< 


llll 


• • 






■ 

1 




Q 


4kJ 


• 

1 


3 


U 


a 


iili 


o 
o 

v4 


^4 IF^ 

Ok 0» 

»iH 1-4 




r* iO r^ 

m* r^ O 

O Oft S 

f-4 ^ *H 


oa 


r* o o ««' 

1-4 *M tH ti4 

o» o» oa a» 

ti^ p^ *M 1^ 


O t^ 

o oa 

t-l -^ 


o o 

oa o 

f-l v^ 


A r» o 

O •^ "^ 

ca oa ca 

»H —I «-4 


a 00 
8 a 


o 

ca 


-i4 ^4 

a a 

^4 (i- 


o 
a 

»i4 


a 


o 

a 


t-l 
-^ 
a 

«ii4 


82 

ca ca 

-^ t-l 


-4 

a 


c«i N> r» r« 
a a a a 

p^ fi^ rH «H 


lO 


t-l ^ 

^4 


8* 


«-? 00 r«^ 


^4 


-- CO 2 « 


00 g- 


00 «>" 

t^H *H 


M* -^ ^ 


t-i 00* 


00* 


CI 


^4 


« 


r 


ti4 




«d 


• » • » 

^ t^ lA O 

tH M p^ 


• 

1 


41 


II 


III 




iiii 


• • 


si ?: » ^ ^ 

o o o a is 


u 




09 C 

•- es 


• 


• 


• 






a 

< 


llll 



Wi 

I 

a 



QQ 



- ' .2 



a 



00 

a 

o 

•3 



S3 



> « ^ 




6 
2 






£3 
c8 



c 

Xi 

< 



« < d .t: o 

_ „ J3 ja o^M) -— . 



<> 



81 

.< » .? ^ 






'Ji 

o 



DC 






00 



ro -c •« 
f 3 8 



Ct« {> f-4 iM 



c 



3 

•-3 

G 



a 
o 

c 

3 

15 jS .S 

iad •? ■*< 



,? 



■< 



it «^ 



«s 

•J 

o 



g 



« 

> 

. o ® 



08 



as 

3 
-^ 

N iJ X 2 






a 

Hi 



S 

c3 



9 









I a o 5 5 s 

^ U = H »2 O 







J< A -3 



2 fl C •- 3 • ti 

C > ,E c w . . 



1:0 c 

08 JO « 
U r- C 






0) 



68 ^ 3 
.0 d 



9? 



13 

a S 



I 









I I- 



<i5 



. o 
3 « £ 

Ex^ ^ H 



J a 

11 

« .-a 













^ s§ § s 

c o 5 o o 




i§§ 



33391 § :i 



d a c 

3 S 



cS3aa533a<35a(5 



niiiiiiimisi 

acaeadddqcadddd 

333333333333333 
OCOOOOOOOOQOOOO 



o 



636 



Repoet of State Civil Service Co^onssiON 



w .5 





S 

t 

a 

IL 

B 

6 



« .s 

u S & 

Q I ^ 
g 



U u •) 
^^ S K 

^ a * 



c ^ e 

•Si ^ ^ 
3 4, H 



c8 
^c 

1-^ 



•* o 



o 

6 

eS 

IS 



o 



30 

O 



88S88SSS88888888S88S888S 



lOqeooat^r^aaaaoooaot^Aat^eei^aafoav^a 
eoooooSoSSookOoooSoSokoSoS 



o ec M ei <D «c » 

^4 Pi4 vM 1M C9 



>>>»>» 



S^ <o v-i e« ^ «-! o 

••2 



•2£3lp 9'^o.c.jP«,l^,Si3 S^J aag aao. 



s 






o o 



«acoo^•ee■^ao^•ooceo•«o 

8— S •-«oc«^oooQ«^o«-Q 



eie«<-it-«a»oaoe«c>i<De 



oaoe«M<D<oeo«^*i4CO<^« 

i-t w^ ,H *H C4 



O ti M •^ ^ O 



« !•* -M 



i ^ > >* riTxxx Oft d 5^b2^rt 5? «J**s^ ???? 
S S ^: ?£-<<<-< Q {£ C S S S 4 5s Q «?-< 5 «<'<< 






c c 

r 3 
c o 



ccccctdcec 

335339333 

cccccccSo 
UUwUOOOOO 



J 



C 

3 fl 

o 5 



c e 
9 9 a 



c B B e C " 





Classified Civil List — ConnrEs 



637 



Sii888S388356S883888 






o o 



O O Ol CI lO 90 



»i4?|<i4«-<C«*Mi-l*H*4.KC«e4 



*^ v4 VM P^ 04 (H ^4 



S83SS3388 
838333333 

elC4o•^s^la»s4^bC» 



LMllllillillllillll 









I 




.- ► ^ ^ fe 
/<^ • • ■- 



8 



S- 



6-' 



d S o ^ £ ;3 :; 9 ^ S ^ 



a 

«9 







o 



a u M 






^^ 



»i 



1^ 



s a fl o 
3 8 £ >i 







fill 

S §1 b ^ 

ct « O 9 o 
C ^ ^ ^ C 

w oQ cn cn w 



c 

9 



- 8 >^S 

8 § 2 

d o o 

« o c 

^ a a 

j J > 

•-^ 9 :s 

*i S 3 

Mi CO CO 



d 

" *" =» S 9 
._ " M « 

» jis d d o 

rt c. £ -a a 

?i Si ^ 



=5 C 

5 .= 



o «» 

o a 

d 3 

d jp 



6 d d d d 

o o « o 5 

"v n3 "O "O "tJ 

d d d d d 

5 S S S S 

d d d d 

U C fr« *M 

9 9 9 9 9 

• • c • • 



d 
o 

d 

s 

d 



9 9 9 9 9 
go a B a go 




£? ^ <3 

Si 4) t) 

-r; -rs "V 

s a s 

c q d 

•*^ m3 «^ 

W ^ *. 

9 9 9 

OB ■ go 






J 9 9 
6a 



d d d 



d 
9 



d d 

9 9 






d 

9 



666o 



d d d 

v a; 4/ 

•O -o -o 

d d d 

3 S a 

a c a 

f* ••« ••• 

C ft. u 

2 8 3 



d 

9 
O 

O 



a a 



CO 

H 
CO 



h4 

J 

■*> 
O 

d 

8 

JS 

8 



H 
O 

a 



us 



d 
d 

9 

o 



oe 


« 


00 


00 


00 


30 


00 


w 


00 


•i^ 


-H 


— « 


•H 


•>4 


*-< 


rH 


*■« 


p^ 




oa 


Wi4 










*i4 


•-4 


^ 


00 


*i4 


»^ 


c» 


gf 


rt 


«c 


o 










rH 


M 


p^ 


p^ 


• 


• 


Oct. 
April 


i 


April 
Feb. 


3 


• 

JO 


00 


o 


00 


00 


w 


00 


00 


00 


00 


9^ 


^^ 


r-^ 


•^ 


^H 


w^ 


^H 


w^ 


^H 


^4 




*i4 






•-4 


o» 


2 




^H 


• 

00 


P^ 


^< 


oT 


• 


n 


•« 


o 










•-« 


M 


M 




^^ 


• 

z 


• 


Oct. 
April 


:2 


April 
Feb. 







k4 

■i 



d 



> 

So 



•2 "C j3 
n d (Q a) a 

« O O ?? O 




V 



<»«; >5 



§ : d 

»J ^ .a w • 

^ ►S ^ S 

c ^ 2 d "3 

< « 5^ -«: cu 



a 



Is 



'T^ ♦* *» >k 

** - d d 

C 3 9 9 

9 S O O 

O " o o 

E d .2 3 

§3 w d 

•- o o 2 

C O O fa 

So G> e 

b u C u 

9 9 9 9 

S 9 d d 



9 -^ 

2 3 = ^ § 

>s d ? « o 

c g t^ 9 8 

«> o ** o • 

5 3 2 " a 

-< O cs '/: H 



S 



8) O 

»• H i^ C »4 

9 9 9 9 9 

d d d d d 



*2 'S "S *S 'S 'J •"* •"" '"^ 

.s .3 .a .s .a .a .a .a .a 
>>>>>> > > > 



638 



Report of State Civil Service Commission 



H^ 



c 
o 

a 

c 

o 

O 



G 

♦'8 
c S 
« C 



o 

o 

a 

Q 



is 



lis 

at 



.tf 



E 

as 
^5 



o 

H 

CO 



S8 
SS 



d c3 

•§'§ 

S if 
e a 
•n c 

CQ X 



8888S 



8 



88S8 
88SS 

CI t* I* r» 



1914 
1012 


»« "^i 00 <<• 00 

^4 ^4 «M ^4 ^i4 

a o» a 01 

*-4 ^4 «M ^4 *-« 




^4 


00 e w ae 

v« f>4 v4 ^ 

a o> 

»-« w4 ^ *" 


""S 


«-i N e« «-■ 


to 


*^ 55 e 
« ^ -* 


Feb. 
Nov. 


• >^ li >^ ♦* 

ts-8 s-g & 

Oh '<h aS 


1 

o> 

*i4 




llli 


1. 1014 
26. 1012 


»« ^ 00 "^i 00 

^4 ^^ *-4 ^4 f>M 

0» 0» 01 

^4 ^4 f>4 ^4 «M 

o» « o» « -^ 


1. 1918 
22. 1016 
10. 1018 
10. lOlH 


Feb. 
Nov. 


... 


. 1 


Sept. 
Deo. 
Nov. 
Dec 



^. o 




III.. 

•0m ^S *^* ^4 •*« 

n f-4 CQ «-i CQ 




*" fc 2 9 ^ 



& 




S^SSu 




a 



a 



M >M •>■ >« 19 

fc o > c c 



i 




S 

I 
•§ 

.2 




Classified Civil List — Counties 



639 



S888888 



8 



8 



8 888888888 



g o o o o o 

a» S uS >6 S 1^ 




3 S S H -< S s 



J 

i 1 1 1 i 1 1 



00 



rs 

Urn 

a 
< 



00 



ft 
< 



fli 



9 





o 
B 



lO 









O 



> 

> 
o 

5 

GQ 
? 

•c 



c 
a 



a 
d 

•c 
S. 

s 






»«a>Q0Q000O0«O»«^ 






1 



llllBll 



(»a><x>ooooootDt«^ 

-"■ "■ a -" a s "" *■ s 

o • «< «< »-. 




Ill 





OOOOOraOO 







I I 



I 



00 



S i 3 5 3 S & 
» ;e; Sz; ^ ^, ^ C 







^ 

3 
tf 



640 



Report of State Civil Service CJommission 



CO ^ 



CO 



dl 



•S 



K 



88388S3S 

8 
« N ^ •" o -r o 



< 



»« r« »« (». 00 

m^ m^ m^ ^-4 m^ 

0> O) O 0> O) 

w^ f-4 w^ ^-4 m-4 


00 00 00 

,m^ m* w* 

O 9 O 


Feb. 1 
Feb. 1 
May 27. 
Dec. 13. 
June 16 


f>4 14 f^ 

i " i 


,M f-4 *-4 ^4 VH 

o» a» o» e» o 

pH pH *-4 ^4 *-4 


00 00 00 

O O 9 

«-< t^ »^ 


Feb. 1 
Feb. 1, 
May 27, 
Dec. 13. 
June 16 


Mar. 1 
Dec. 6 
Nov. 1 



J 

€ • i > > > 

r ^ « « 91 OS 



V 






a « 
J? 



o 

Si 8 

-< « < 



1* 

HH W 4« 

« a S 



K 



$ 



0) 

2 
a 









3 

•a 



a 

Si 



2 O 



88 

So 
on 

00 ^ 



8i8 

SS3 

N - 3 



00 00 

00 |C 




00 v^ 



9 9 3 

m ti V 






O 9 9 

• - • 







R •■' 



00 "< 



>•? 



&:?< 



w:z;2:»!:z:?<o 



c 
C 

CO O 



8 



*?1 

3 s 5 



Clasbifibd Cirii, List — Couktibs 



641 



S8 
§§ 



S8SS8 

O c o o o 
cS 00 — ^« SB 
o 'V lO ^ n 



8 8888SS8888 



8 



8 

to 



§1 



S S M 

"* ^ ^ 



O 

O 



1010 
1010 


^ «n 00 -^ OD 

m4 m^ '^ mm ^* 

Ok ea O o dft 

fm* mm mm mm ^m 


^4 ^4 


t^g^R 




Feb. 

June 

Got. 

Deo. 

Feb. 


1010 
1010 


mm m OO mm tK 
^^ ^4 ,^ ^^ mm 

o» o» o» o» O 

^^ mm m4 mm <m* 


mm mm 


t S g ^' s 


II 





m4 



1 

mm 



2 2^22 
•jj *S) *«5 "S "S 

;c: c: cc tq «: 
e S e 1 S 

^ «rf «< «i< «* «< 



« 


oe 


9D 


t^ 


1*. 


CO 


« 


00 


00 


^ 


^4 






mm 


^4 


^^ 




mm 


mm 


*i4 


0» 

1-4 


o» 


e» 






3> 
mm 




0» 




c» 


- 


Ok 


S 


^* 


^4 


w 

^ 


• 

^4 


d 


^4 


t^ 


U 


• 

< 


• 





• 


• 


• 


^ 


$? 


^ 


£ 


* 


o 


s 


66 


P. 


S 


O 


•0 


•0 


•0 


^ 


1* 


eo 


« 


00 


00 


^ 


1M 


94 


mm 


mm 


*4 


*-4 


^4 


^^ 


^4 


w^ 


0» 


0» 


2 


s 


s 


o 

mm 


0» 

mm 


2 




w* 


- 


» 


S 


• 


^4 


eo 


^4 


d 


mi 


m 
m* 


• 

1 


^ 

-< 


• 

<5 


s 


^ 
s 


• 


1 




^ 
S 


m* 

3 




I 



c 

3 



^ 00 

(-4 >4 



£ 



1 






tJ TJ "^ 



•O T3 -O T3 t» 

c a e C fi 

JZ ^ JZ M M 

p^ i)( S K K O O K iS s 



a c „ 
a s» j ^ j« 

^ ^ JS "Z JB 



u u u 



a 
c 
U 

y. 

o 



H 

H 

o 
O 



09 



C 

•r *" . -d J* 

* c a so 

o ^ =: < 3 

08 #j M S 

< O - < ^ 



o 




B S « 

^ » 2 



a 



•3 S 

Otr i* 




3 

-I 



a 

o 
a 



a 



S 9 a 



e 
o 

at 



u 



as 

o 
o 

o 
o 

a 

CO 

o 

(0 

O 

CO 

>! 
o 

H 



1 



¥t 



i 

s 




21 



642 



Repobt of State Civil Service Commission 



«) <€ 



a 



•s 



1 




§§§§§!§§ 



8 88 



8SSS88 






N I* 



M M 





o 

H 



lliliiil 

Siiiiiii 



00 



is 






r« 00 « « <o X 

V« ^^ W4 «« *« M 

» 0» OB o o o 

^4 ^i4 ff^ «« ^ M 

«^ 09 ^ lO ^ "^ 



00 



3 



§5 



M CO 



t« 00 « 00 <0 

v« VH v4 *4 *« •« 

9 9 

V4 94 f^ m^ r* »4 

•- « •^ « •< •< 



I & g g i 1 1 ^ 




• • • • ' * B 

! ; ; i i •• jj 



(U 

»• 



g 



•i 

e 



11 
11 

JO • o © 
^ JB X .S 

dS S £(S s 




1 



♦ 
S -*■■ 
I ^ 




X 

I 




8 9 9 9 9 3 



Classified Oivil List — Counties 



643 



8SSS8S88 

§o o o e e Q o 
9 s f^ 5 w 00 00 
« S »• e« I* ^ 9 



8 88888888 



888888 





« »« 1* M ^ 

s s s s s 


00 00 
Oft » 


• 


to *^ CS fi rS 


• • 


1 


July 

Oct. 

Nov. 

Mm. 

Oot. 


Feb. 
Dec. 


a 

^4- 


to »« 1* e« ^ 

«M «i4 «i4 «4 vH 

a 01 a> » 01 

^« •-« f^ «i^ f^ 


,1918 
,1018 


eo 


ti wi C^ ri ri 


<«) ^ 


• 
e 


July 
Oct. 
Nov. 

Oot. 


Feb. 
Dec. 



00 

0» 



c 



Oft 



a 

9 



00 


« 


00 


a> 


00 


00 


00 


« 


<^ 


^^ 


<i4 


^H 


^^ 


.M 


m^ 


ti« 


0» 


Oft 


a 


a> 


» 


» 


Oft 


0» 


.M 


<^ 


<i4 


fi* 


9^ 


.M 


.M 




<^ 


• 


iO 


<^ 




• 


^^ 


lO 


• 

9 


• 


• 


■ 

1 






• 

5 


• 


^ZZ 


oz<z 



ooxoootoooooooo 

090^0^01909 

^^ ^ s S ^ ^^ 



t« 00 9 00 00 C9 

<^ w4 94 ^rt ^rt M4 

9 9 9 9 9 9 

^4 ^4 ^i4 «i4 ^i4 «M 

^* 00 9 00 00 CO 

<^ Vi4 ^i4 ff^ ^rt VH 

9 9 9 9 9 9 

^4 ^rt ^4 ^14 ^14 VH 

•H o •^ »i « O 

Q fa J5 < ^ < 




m 



§ «n 



d 

e 

« « M 




H 



o 

9 

o 
Z 










till 

S e d 
S g ^ 



«■ -d « « i S 
H ;:: H h hH 






.5.d 









o 
Q 



IB 

9 



M S -2 



f 



ir 

V 




o • • . « 



S3 "^ -, 



& 



6 B 8| s e c 



» 



it < 



„ .a 

*£ u ^ :h s (£: 



i 



22 




e 
o 

c 



3 
CQ 



08 

!? 

c 

B 

d 



9 

d 



d 



-o 

d 

9 



9 

d 






11 



9 9 






9 



3 

I 

S 



\ 



644 Kefokt of State Civil Sebvice Commissiok^ 



to 
o 



o 

O 

< 



c 

o 



S 

o 

O 



o 
© 2 

"■"I 



5i 



<s 






^ e .s 
o — ► 

• S b 



& 



t 

c 

I 






fd 
t« 



at O, 
5 



o 
g 

:2 



5?: 

o 



O 



M 

o 
a> 



E 6 

•5 ^ 



I 



|3 



a 



O C9 



oc « 



OD 

s 



O 



O 



cd 
H 
OB 



a M. 



a cr e a o a 
o 5 a o a o 



■■ •mm. »^ »««- •«* v^ •^ 

g P? w C? S5 I— S 



u 



® 3 « 2; 9 o 

O GG » J3 1-3 H, 




I 




99 « 




o 
o 

O 5? _ 



H 
K 



a 






.8 
•5 



•9 



<<< b U U Im 

11 s s s s 



>» &; ^ 
V £ s 

p S 3 

Ifi 



a 



H 

It 

S 

o 

o 



I' 



u 




II 



CliASSIBIED CrVVL LlST VlLLAOES 



645 



M M M J4 

t z t z 

> > » ir 
h k fc« h« 

& a a S. 
5 « 8 «-• 



Ik 

9 

O 

M 

i 

s 



I 






8 



88S 



8 



888 

o o o 

5" ^ CJ 
»^ ^ CO 



«> ^ 


« 


o 


ce 


o 


o 


wm — < 


pi^ 


■i^ 


l>4 


•M 


^4 


O O 


o 


o 


Ok 


e» 


o 


9^ »-* 


pi^ 


<-4 


vH 


<^ 


fM 




• 


•• 


M 


^ 


» 


»-• eo 


«o 


»>. 


e» 


e 


^H 




M 






»-« 


CI 


It 




• 

2- 


1 


fr . 




< cu 


^ 


OLI 


<< 


A 


« ^ 


« 


o 


«o 


o 


C9 


v4 i>4 


^H 


-^ 


vH 






o» a> 


o 


o 


a 


e» 


O 


i-< «-« 




»-« 


vH 




^i4 


V • 


• 


• 


« 




^ 


iM eo 


»o 


»>. 


o 


«o 


•ii< 




C4 






iM 


M 


April 
Sept. 


• 


• 


1 

-< 




• 

as 



00 CC (D 

^^ w^ t^ 

o» o» e 
iM v4 ^4 




O «0 TO 
^4 ^4 v4 

O » Ok 

^K «M ^4 


1-^ «o *o" 


r 


00 00 oo 


Nov. 
Nov. 
Nov. 


• 


Mar. 
Mar. 
Mar. 


X CO iO 

m- ^-4 r^ 

o o e 

«i« Wr4 ^4 




o o « 

^^ ^ ^4 

o o o 

V4 *-4 Vi4 


-^ •« -lO 

^4 ^N 


• 

1 


■00 00 CO 


Nov. 
Nov. 
Nov. 


• 

St 


Mar. 
Mar. 
Mar. 



CO 



d d e a 
o o o Q 
a :s ;s ;si 



H C 

t: .2 



d 



d P Q I 







s 




2 



d B d 
o o o 

« 2 2i2 

»^ ^^ ^N pM 



t: 

a. 

a 
c 
O 



111 

Ef am' • 



d 
« 

d 
« 



2 

« 

« 

a 
o 

is 






3 

d 
«e 



■d 
•;3 



e 



OD 



d 
o 

d 



d 
oo 



> 

c 

o 
d 



C at 



6l4 



8 

9 



^ 



jO 
- ^ d 

)s .a 2 



646 



Report of State Civil Service Commission 





a 




.S 




*» 




i 




K 








^ 




g 




-2.2 




e of 
DC in 
posit 




Dat 
tran 
lent 




a s 




o S. 




Cl 








's-s-? 




Date 

trance 
vil ser 








V 


t 


£i *» 


i 
1 


1"^ i 

Hi 


8 


- - i 




M ^ a 




Q< « 




M 


tBi 




O 




»H 




d 




ps* 




o 




H 




O 




< 


o 


h) 


s 


h) 


eS 


> 


^ 




7: 




o 




N^ 




H 




CO 




O 




&< 







88S 

CO m eo 






« CD 00 

^4 ^4 v4 

O Oft Ok 


11 


vH *4 v4 


w^ w^ 


00 oo -^ 


• • 

OC 1 


M 


1 


Mar. 

Mar. 
April 


Si 


SJ? 


<o «e oo 

m4 m- ^m 

0» O Ok 


85 Oft 


^4 «^ V4 


•M »* 


00 OC -^' 


« 1 


M 


1 


Mar. 
Mar. 

April 


• • 


StS 



t2.000 00 
1.200 00 




April 14. 1914 
May 1.1011 





9 01 



•"2 i 



1-1 

T ^ 

I 8 

H a 
* 3 



c c e 



m 
> 






O 31 



s 



»5 
O 



o 
o 



H 



a a 
o o 



o 
O 



•3 

- ^ ^ 
•3 t: a 

K < O 



S 

« Of 




^ •*■ •^ "2 "2 ••• ••• ••■ *•* '•* 'S '^ "^ "S 



a 'a 





'Sees 

I3J1 



s 

9 

c 
a 

08 



« 

9 



1 



a 



Sis 



c jg 

»^ £ »-s < 0L4 3S 



-<« 



a 
c 

'3 

a 



8 

c 



. e 
2 J 



-a 
K 5 



•3 



X 



c^ 



c 

< <» i 



Ji 

e 

eS 



%• b ft. b b 



U < 



•SSPPSSSCCQBS? 



•g a -f H E a £ E B a a a & e s 



OiAssiFiBD Civil List — Villaoes 



647 



N 



8 



8 



SS8SS 



ii 



8 



88888888 



n 



§ 



M 



1 



01 



a 
< 






s 

9 



6 



9 2 ^4 8 o> 9 S 



I 






_ s 
^ IS 

til 



H 



|l 

if 8 

•I I 



o 

& 

c 
c 
o 

«3 

e 

eS 
Ji 

e 
.S 

I 



8 

s 



•O -^ Pf lO lO 
• ►» -i • 

^ M 9 e O 

i^S < fa o 



S S S S S o s 

»<4 *i4 «i4 ^4 1-4 ^4 r^ 



lo »>4 e9 ^ lO 







Ss S a Cb eo 



6 




a a a c a 
«« 3 « « es 

6 E S a E 

si's!! 

It «i «a « d 

£ £ 0* £ f^ 






3 

-a 
I 



• 
> 



H 

CO 



S 

o 

H 

S 

a 



& 



.S 



oov4QS»4«^S 

99A9aOOlO>OT 



35« 



»n «-» "n •* 



Mcot^foaooooo 

99990OOia>O0 

iiii III 




■c . fl 



M S 






i 



.^4 



1 1 - 1 S 



ft48 Report of State Civil Service Commission 



3 



o 



CO 

O 
O 
O 



C 
1 



£ 

o 

O 







8 - 

e ^ c 
.Sob 

'a ti i 



r. 



C 



o 

s 



o 



II 

8S 






o 



CI 



[f 



04 



CS 



CI 

o 



>» 

« 




1 



i 

CI 



6 







H 

ci 






s 

o 
•3 
1 



6 S 




88 



CI 



o n *Q n ^ t' • 

X ^^ ^^ *^ _i ..4 

S o a a o: 9 ■ 




O "»r CI V t-^ C ; 

. u b kl u L 

*t a 0* < «8 * 

jy »— v* tart ^ *5 


• • 
la U 


O er « « ;r r^ 

o r« «^ *« v^ *« 
O O 0> 0k o o> 




o '^ CI <* r- c 

. u u kl u u 

•^ 08 « n a a 

^ Mi* ^4 «P« M V^ 

O <« << «Q li^ •'^ 


•a o 



m 

s 



CO 

a 



S9 CZ 7? SS .^ .^ '^ «• MS 



<2^ J j^ 



"ife 8 « 

& pu £ 



I 




g-« 



& 






c ? « - 



§1 



w a ki « .s w • fl ■ 

" '^ ^ W .« f S o 



»4 «-» 



llliJilli 



•8 rz 



C 9 



<>»!:C^a:as>H 






3 






e 



mill 

sssxxs 



ClsMSSimS> ClTIL Ll9T VlULAQtB 



649 



^1 

8 



3 






I 1111 



s 



1111 
S88SS 

-< «tf ^ 00 X 
04 d CI S ^ 



M 

S 



8 



S8 
8 



t0 e« 

M 

to e« 



9 



I 



td 



__ o 

s 

n 



o CO >o r^ 

,i4 M4 *i4 >M 

o» o 0» O) 



kf> «-« O 00 



o <D >o r^ 

^i4 Vi4 vH VH 

Ok Ok o) o> 



9 



CI 



O 00 



^ 



<< b* •< ?; 



^4 

9 




« 
^ 



3 5 a 

o V 

. ^ J3 S 

w a h < 



I 



lO O O 00 00 
»^ •H •M ^* -^ 
« » 01 o o 



«-• tp ^ lO t^ 



9 

G 



i 



ID O V 00 00 

»H WH •H ^^ »-« 

Ob 06 01 O) O 

r^ r^ f^ r^ w* 



11 



S3 



to 



I 



sliii 




Si 

Si 

H 
O 

£9 



o 



4 
I 



0. 



f £^:i:s» 



I 

a 

o 
H 



S 




III! . 



In IB 

3 3 3 



a 

I 



CO eo 

O) o 



ss 

n CO 

01 a» 



00 



650 



Report of State Civil Service Commission 



•3 

I 

I 

o 
« 

< 

d 

> 



a 
o 

i 

I 



•8-S 



s 



si 

iSll 



S 8 



e <_ a 

r-i 



z 



z 

o 

H 

2 



SS88S8SS8S| 
i8§888888i ^ 

8 

28SS88S22 22 
^'«a«22888«s 

§8S2S822222 

55«a"22gfa8«s 

iiiiiiiiiii 



888888888 



a 
7J 

T 

H 

I 

M 
U 

3 
o 




: 2582 

4 r^ «>4 10 a 






c 
SO 



IllllJIall 



£ : S S 



s 



a 
m 



•5 Si 2 "S I III 8 




S9 






5X00000001^0 



50000000000 
0*i4«i« v4g«>4^»« 
00000*009 



O *^ *^ v^ 



«^ v4 lO *4 








Classified Civii. List — Villages 



88 ::::;: : 

9m m4 

• •••••• 

® "^^ r r r r r r r 
^llllllll 

» -*' r r r r r r r 

So aaaaaaa 







§S S8 



888 
III 



888 
S88 



« 



00 QO 


^ r» 


CO <<• to 


v4 v4 


.i^ <i4 


^4 f^ .i^ 


a a> 


» o» 


01 « a 


^* .^ 


^ f-« 


VN »>4 *i4 


eo « 


• • 




June 
May 


Deo. 
June 


iii 


00 00 


^ t^ 


CO ^ « 


»-« •M 


r^ •M 


m* r^ w 


o a 


01 0» 


o» 01 a 


1^ •M 


«M .-« 


Pi« »<4 li^ 


eo tf> 


•s 


• * • 


S >> 


-i • 


• •! • 


5 * 


II 


*^ Q •* 



n e ^ 

IH fiM ^4 

a a a 

*M firt *M 

bT « « 

•lis 

MO"-* 

Vi4 pi* ^4 

a a a 

t-4 firt aiM 

* » • 

t* to n 



S S 

66 



3 CQ 






o 

e 
o 

•s 

U 

O 

O 







ll 



1 

u 



11 




651 

8 



a 

P4 

CO 

a 



a^ 



s 



91 

H 
M 



QQ 

I 



i 



652 



Report' of State Civil Sattvicn Coxmissiox 



I 

m 

a 
o 

O 

o 

i 



s 

o 
U 



9 S 

° « 8 

si 

a. 



^ S 

••^ S -r 

o •- > 

o S § 
g'8 



8 S| 

eS -e 0.. 



:s 



OS 



E- 

£ 



S9 



S 



e« 



8 

CI 



SB 



M 
O 

-a 



SSSS88 



^-^•| 



in 






II 



e «4 



« 






GO 


t« 00 M» 


^4 


v-4 


V4 W^ 9^ 


O) 





01 o 


f-« 


'^ 


•^ w* •H 




1^ 


• • • 
ua «^ t^ 


>k 


>» 


^ :; >» 


« 




«« it- 


s 


3 


sz:s 



o 








00 

o 



3 



h> oe kQ 

o a a 

^i4 VM v4 

O -* 1^ 






I 



> 



•s 



00 



T 3 ll^ 




9 g 

\J JS. 

m, ^ 



I 

SB 

a 



s. 



^ 


•3 


00 


s 


«• 


» 


J 


8 
a 


S 

-3 


> 


Cd 









c 

M 

o 

« 

C 




2 

> 

i 

o 



'i § 






s: 



B 

tf3 



■ C 

■o 
a 

a 



1^ 

as 

JS. 

O 



J 
3 

8 .t 8 

w '2 iS 



§ 



le 10 CO CO 



2 M CI e« g n 
S S S SS 5 S 

^4 ^« v4 vi4 *i4 *4 

P? W CO CJ J» I* 

CI CI •x ^ 

iiiiii 

w* mm w* w* 1^ w* 

g^ r| Ok -^ k: N 

mill 




as b"52 

§iia 



-*<2 5 



0. df 




k 



ClJL3SIFIED OlVEL LiST VILLAGES 



6a« 



S5S8SS888S 



8 

o 



8 

n 

8 

CI* 



•o •§ 

88 

n CO 



r? Q <- o 
c o o o 



is 



o o o 

„Bsa 

^"888 

•^ « lO 

►• I* r* 



'i O ^3 "tj ^3 O -i^ w^ »« "^ 

o «i O fi ^d o ot o o> o 



o»v«»«~'««<iir<-coo 






8 1 



§■© "O 'O o O "^ "^ •^ •"• 




•X •^ iM eo 



E 

4 
t 






ij 

a 






•J 



o 
O 



a 
a 
o 

O 



o 

OS 
JS 

o 



9 a a a a a a 
2 3 « «9 (Q rt 
! fi.sj s s i a 

iS4!iC22-C A* £ £ £ 



s 

n 

"3 



o 



9 



3 



o 



1 

•8 






e 

3 



o 



o 
d 
3 



s 






ft 

o 



-pu 



£ 






o 



H 



M 



fa 



D 
O 
O 

o 

H 






H 
O 

O 



e t^ 

^5 »»5 




SI 



a 9 A m CO CO lO 

c a o ^^ '^ "^ "^ 

A A O O Ok 0> Ok 
*' ^ V «o V V « 

C« A M 

ijimi 

ft a ic eo eo lO 

2 o '^ '^ •^ '"^ 

in O O Ob 01 Ok 

•-» "^ •-» ^ < ^"< 





^ 

m 








654 Repobt of State Civil Service Commission 



1^ 



I 



II" 

6 



5 , 

•g .9 -j 



6 



'8 S J 



I'l 



Z 

o 

I 



if 



S8§ 



s s s 



S Q» S 
«i4 *H IM 

A » A 

I 



III 

% £ £ £ 

AAA 



Ik 



M 




S88SS8 

S n eo CO 00 



«i4 lo e v^ ^ 00 

8 5 01 Q» Q» O) 

• * • • • * 

<D M OQ CO O ^ 



mm 



«i4 lo e •^ '^ 00 

SQ tut ^14 t-« *^ 

9 01 Q» o e 

<D Ol 00 «9 O ^ 



mu 








Ifllll 



SSS88 



«i« ^ e« lO lO 

8 Ol 9 9 



liiii 

2 2 e« 10 « 
8 8 Q» 9 » 



III 



99 



mn 





Classified Civil List — Villages 



655 



SSSS8 

<D as e^ 1^ o 



O CO ^ <D 00 
vm ^m ^^ w^ ^* 
Ok Ot Ok Ob O) 



•-> >n S S qS 



Ok Ot ^ CO 00 

8 9^ mt wm 
O Ok Ok o 





n 
o 

e 

I 



S|SS888 

W VM vrt WH 9^ wm 



8888SSSS 



C3 »" 



SI 

o 



s 

Ok 



I 





^4 ^14 ^4 


»H 


8 












00 r» h> 


r» o o 


00 


mm ^m wm 


^4 *i4 ^4 


•H 


Ok O) O) 


O) Ok Oft 


Ok 


mm ^m mm 


^^ •^ p* 


mm 


-goo 


«0 «H (i^ 




2^h 9 

2ll 




a 


— I* I* 


t^ o o 


00 


mm mm mm 


— — (i^ 


•i< 


O O) 9 
^4 (H ^4 


O Ok Ok 
»^ »* »i^ 


O) 


ss* 


«0 (H «i4 


1* 


May 

July 
Dec. 


^ ^ -; • 



M t4 k 

&&& 

888 




b 



t1« 

•^ «a a o *^ *§ j8 



a 



S 

J 

a 



•3 K ^- I O 



H 

Ik 



55 
a I 




S i - & '= 




I 



a e a 
«( i « 

B § e 



'^£££ 



1 1 8 § 1 1 "S 

^a -3 3 ^ ** 



a 

O CO 



4 cs il 4 

O CU (&4 (&4 (I4 





JQ a 
8 6 
"e "S "3 
^ ^ -& i 

A4 £ £ £ 



•2 

o 

•a 
s 




656 



Report of State Civil SER\acE Commission 



O 

< 

> 

g 

< 

CO 

o 

CO 

I-) 
O 



§ 



u 



^^1 



c 



Is 

lis 

OS? 



§ - 

M « a 



i 



7: 

o 



.M .M J< 



111 

^ |( > 

•4 b b b 

8S8S 

M CO — 23 

CI M M ?« 



« 


CO 


e 


«0 


»^ 


*ii4 


»^ 


vH 


o 


o 


o 


a» 


»^ 


fM 


*i< 


^4 


• 


» 


• 


• 


0» 


^^ 


*•• 




ha 


••2 


& 


> 


^ ^ ;? 5?; 



CO CO © ^ 
vi^ vH *4, o 
OB 0> O' O 



O) ^ ^ o« 





S8S888 

o S 8 S 8 8 

c^ o o e e e 



888S8888SS 






8 



o c 



ic h- «2 <c cc m 

liH O ^1* •— pM »i^ 

O Ok o* o o o> 



O i2 H «< < S5 



CI t^ ^ «S ID >0 

o o o *i< — •- 
Oi O Oft Ob O Ok 



c«tDr^onc«oeoacx 



^ lO ^ ^ «o 



«o O — «« "C X 






co^«aoc<«ocoocx 

0»C?0**^«**'*-^ 

aoa»ooooio9 



w ei 



^ 00 ^ "* 



•^s 



•1 N •ft « 



c 

a 



8- "S. S" ^ o 
tfi J!J < < as 







§ 



A M 



S 1 s s 

a i £ s 

M M JB JS 



o o p o o u o 



8 ° 

a « 



1^ tf 



1^ fl 1^ b < (Q 



fi2 
III 



2 2 I « ;^ X -i 

4o h ^ JS o(>: 



c 



U 

e (g 



. ^ j: ^ ^ "S 

«M o O O O -S 

S ^ i: is :: i 







^ Gk Pk (ii OQ 






Olassifixd Civil List — Villages 



657 



S888S8SS88 

^r ^F ^ ^ ^F ^ ^ ^ ^' ^f 



88888 

p o o o c 

(i. '»! ^1 X| »«| 

^ o o o o 



88888 

fifi r58 S 

CI C« M Ci O 



Ji M J4 M 

s S s S 

> > ^ > 

U Ut tm U 

c^ S S 

oc « ^ -^ 

•^^ C« N M 



8 






^ ei v^ «-i ^ -^ .- 

il'lilil*'^ 



I 



e« 6i fH ^ f-i ^ ^ 




c» 



s g 

it 



s 

a 
o 
u 

B 

«s 



o 

s 



I IS s 






*;.<►» 



ej fi 5 "O «8 

2 S - S •£ "S: 5 






3 
u 



I 




a 



e 

P 



«•<**<** •^ *4 ^ dj 



c 



o 
(!« (!« A4.At »t m m A4 



CO 


n 


w 





►- 


Virt 


^rf 


-^ 


r^ 


9^ 


0) 


© 





© 


a 


w* 


1^ 


^4 


•-4 


t-a 


• 


»f» 


t^ 


CO 


b- 




•>rf 




1-4 


tH 




a 


c. 


? 




< < < < 


ro 


w 


PO 


(O 


t^ 


^M 


t-< 


t-< 


■W 


«i^ 











© 





v4 


^4 


rH 


•^ 


*^ 


•^ 


<i« 


t^ 


CO 


t* 




-^ 




-^ 


vH 


- 


^^ 


^^ 








■«« 








W 


h> 


li« 


K 


«• 


a 


c 


0. 


3 


U 


<-<-<<: 



*^ ^ CO >0 QO 

Vrt V4 .4 «i4 ai^ 

o o © © © 



O Q -^ t^ '-'5 
« PI — 

5 5 ca e rt 



^ ^ CO »o 
•^ ^N — — 
© © © 

*4 ^4 V4 «i4 


© 


*^s;;^ 


»-•; 


Aug. 
Nov. 
May 
June 






00000 
o c c u c 
OD n n 2 n 

uj £ t^ uj is: 

c c "3 "S c 

3 9 3 3 3 
06000 



So 

SI* ■ 

ei t 

^6 



S r 

£ C 

H ^ S '^ ^ 

T • • o o 

c e^ 0. ^ ^ 






bC 

S • *; 6 7^ 

^ C eJ *r« tj 

^ •* S" "^ *S 



M 



W 55- PQ 



2 J 



* rri R 



fc U ^ :^ O 



o > r: 
S S == 

E 5 i^ S :2 
^- Q d a: t: 
• H >. s s 

5SCD C ^ H 



ft* 



© . • • • 

o s e s i 

•5. "o "o "o "3 

Vi *^ \* u u, 

•9 '«* «» «j «> 

^ «t « « « 

U (I4 &4 (U II4 



Sfl a a a 

CS (9 < d 

fi fi e Jl 

"5 "S "o o 3 

•a *• M l« Ii4 

<« i> i* i" J> 

fri lU A* (U &4 



2 8 S ** 
© 8 8 8 

«i^ i>4 *M *H 

CO CO <0 CO 

III! 



CO to CO 

C« M 



CO 









> » » 

0000 

:i Si S S 

JA A A ja 





658 



Sepobt of State Civil Sebvicb Commission 



o 

CO 



of 

IBS 
09 

I 

H 

H 

CO 
H 

3 



3 



s, 



1-5 
III 



III 



V 

S's S 
3 e a 

5 S o 

■5:1 

s - 



o 

S 



J4 J4 ^ K K ^ 



S88 



SS8 

M M CO 



e<i e<i 



<-i <ti o e« e« <D 

^4 f^ fM (M ^14 S^ 

Q» Q» O Q» Q» » 

«i4 «H «i4 »i4 fM »i4 

• ••*»• 

«-t ^ S u) a o 
e« !■- S -^ 

llllll 



II 

ss 

CO CO 



is 






^ ^ O C« M « 

«i4 *4 «i4 *ii4 *i4 «4 

Ol Ol Ok Ok Ol Ol 

^4 *ii« *4 ^i4 fM 1^ 

pi wS ^ yS gi o S 

C« f-4 III ^ «« 



ti 

S 



'8 



a a a a a a 



3 



III 



^1 



Hill! 








1 



go 
II 



J 

11 



SS888S 
!§§§§§ 



88S 

lis 



lo M <o oo 00 e 

WH 9* mm w4 w* m^ 

Q» Q» Q» O Q» 01 

«i4 »i4 *<4 ^4 ^4 »« 

• • * * * A 

•f ,4 00 ^ ^ M 

•n *n »> •< < < 



« »» « 

858 



in 

<<< 



§t» CtflDt^OOOOO S^^S 

o S88S53 SSi 



^-.--g 




*4 n ^ 

til 

•<<4 



; ZSSSKZ 










Classified Civil List — Villages 



659 



888S8SSSS 

8iSSS88S8 



sss 

CO o o 



88888888888888888 



8 



■Ooooaoooooooaooo^ 



^25*2222 2 

§^^9000000000 

.*< Q a ■<■<■< ■< 












§s 



CO 



•3 go. 
»> "n < 



lis 






§^epoooooot^o*ooco«aoooooaot» 

-"" s s s g5 s 2 i n ^ •*■ t: * ^ 2 s -^^ 

§^flpoooooot»0!9oe9coooooaOQOr» 

^ S S s a' = 2 S «' !: •** t; * • 2 S -^^ 

iijiiiiiiiiiiiiij 




s 



: p:p:p: 



«>»••• 



• • • 



KnKK06o6o6KKX 



« « 



(^93<g 



I 





s 
mm 

o o 

-a -a 






3 




660 



Report of State Civil Service Commission 



d 

o 



a 
3 



e 
o c 

c c 5 

^^ mm 



5g 



^ c .2 

Z ^ V 

& c. c 



r o 



a 

^ «»- c 

^ O t; 

^ ^■^ *^ 

— ** '3 

« ei c 

►J 



s 

2 



o 



-A 

o 



11 



3 

u 

CO 



8888888 



8 



go o p 
o o 



ao to M » e le «3 

So .l* »-« •— w^ "^ 
O 01 tt O) Oft c> 



•c 



M 



til 



<S5 



o 






a 



00 M 90 fl) lO (C 

O a^ «^ *^ v« ^4 

e» o» e» o e» o 



-^ •< ^^ n wi* »-M ic 
e« N •-• 



^2 i 

< 2 



5^ 



e « a 

•-J S ro 






fc 

a 



c9 



t> O O O ffi V 

•a -a -^ -^ '- -^ 




o 
S3 



c 



V 



^ CO H ^ cc«^ 







s e 



O g g £ £ J J 

i f "c "o "o "S "S 

tf at « «e «C It «8 

O QQ Pk tU Qi^ 0>4 Qh 



^ ^ "O "O "O *0 •'fl *0 "O *?3 "O T3 ^ V 

11 ^ S. I ^ 8. & S. 8. & II 1 

ooSSSSsSoSSSSSct 

*''^C9COC0COC0COCOW5OWC0 o 




CO 


CO 


eo 


eo 


eo 


eo 


eo 


eo 


CO 


eo 


CO 


CO 


eo CO 


•-• 


^mt 


^4 


^< 


tH 


w^ 


*4 


f-* 


»-• 


P*^ 


f«( 


v4 


«4 «« 


0» 


^4 


o 


o 


^4 




a 

vH 


0» 


a 




o 


9 


o » 
*« «* 


•1« 

C4 


ml 


C4 


'f 

M 






• 
^ 
N 




• 

-* 


• 


• 




C4 c» 


• 

cS 




• 


• 


•9 


a a s 


ti 


s 


• 


• 


\i^ 


SS 


:g :§:§:§ 


s 


sss 


^ 


s^ 


CO 


CO 


CO 


eo 


eo 


CO 


eo 


ro 


eo 


eo 


CO 


CO CO r» 


^H 


w^ 


1^ 


ViN 


^4 


vH 


w^ 


Vi^ 


m^ 


^^ 


w^ 


w^ 


*M «« 


0» 


at 


^4 






01 




^4 


O 

» 


1-4 




Ol 
• 


9 » 

• • 



^ ^ ^ ^ ^ ^ ^ 

« ■•>••■• •• •••• 

eSeS«S«Sc9«l««l«el3««e 

s s s s ;g s s s 2 s s ^ s :? 



apaadGaacaaaa 



m 




HO*<^a 







Classified Civil List — Villages 



661 



8888 

e p o o 

■* N CM M 

%^ CO CO CO 



O ^4 liH 

O Oft Oft 

■Vi4 fM 1-4 iM 

CO V « ^ 



CO ^ O >o 

S S a a 



CO ^ eo "^ 







•n •< 




•8 

o 

S 

a 



NOTE 

Extract from State Printing Law, Chapter 667, Laws of 1917: 

" If it shall be found that the report of any appointive 
state officer, department, conmiission, institution or board 
transmitted to the legislature or delivered to the printing 
board as herein provided cannot be printed within the appro- 
priation made by the legislature therefor, such report shall 
be returned by the printing board to such state officer, depart- 
ment, commission, institution or board with a statement as 
to the quantity of matter which it will be necessary to exclude 
in order that such report may be printed within the appro- 
priation made by the legislature." 

In order to comply with the foregoing provision, it has been 
necessary to exclude from this publication certain data which 
heretofore it has been the custom of the Commission to print. 

[662] 



APPENDIX A 



List of open competitive examinations 

List of competitive examinations to which non-residents 

or non-citizens have been admitted 
.List of competitive promotion examinations 
List of non-competitive promotion examinations 
List of non-competitive provisional examinations 
List of non-competitive examinations (rule viii, sec. 10) 
List of non-competitive examinations rated at albany 
List of non-competitive examinations rated by institution 

BOARDS OF examiners 

List of employments under rule viii, subdivisions 5 and 10 
List of transfers, competitive class 



[663] 



Open Competitive Examiwations 



665 



11 



S2S6*2a*S8'"*22sSarrRSS22=2-*S*-a2;**R''S''*5 




o 



•c »•--« ?i o « « « « ss "C "C « w ^^fj-* o>--fc «o «•• ©go gj— ♦rofi-Ji o P ® 15 5? « -^ 









-^ <<•«"«*• »-» 



<NC»««»^.-O=52Cj^glg«0. 



s 



ft- ti 

Si C 



Z 



COM' 






00 

M 

CO 

O 
H 

s 



> 
H 
H 

s 

D 
'J 

D 



1^ 






eo 



00 CO 00^ Mao CO ^ 



o »•• «r-t:P S ^ * 2! ^ " 







666 



Eepoht of State Civil Sebvicb Commission 




3 

O 

H 



-I 



2Sl5a::2§22'-'^-§2«S&2**-^2»28 S &SS-aS»«8S 







>t >i 



XX-C" 



»> k 






C2r*-5««jj;^«««^^-eg2;25igg-,«g5C3 ^ oooe^aoaos^;:;:* 



^4^4 • -^nOI • -^^ 



^ . .^cocooQeo^«e«co u) <d .^^e*iM>^ 



'288 



•at 

1 

I 

00 



c 

S 

-< 

K 

H 

U 

> 

P 

K 

CU 

o 
o 

u 

PU 

c 






mm 



e<i^c<3c« 'CI 



■ »-«w«^ 



«o -o^ .^ eo 



Nrt • WfJ 



MMi-* 



• <*« 




^N 




^^ 











•^t:::85 Si '^-^* 



^rt 



lOM 







£5 ^aoot^eo-^n^on 
00 W f^ f— •■•* 



::3 



o 

as 



lis 

(But/ 



S 

ua 



3 



C 08 b 

§82 



11 



lil|-||fl 

c 2 2 c> flS C S<N«. 



c 

O 

3 

e 

o 



i 



a 

o 



U 



iili i 

^ S a P * 






?.ei-i 



o 



c S Z 



•9 >>>>^ 

c c ilia's 

^ 2 « 






II 



B O 



OS £ B MC f T b c 




P 

g . 

is 
•81 
II 

— c ^ o 

15 P ei » 

•c 
;l 

B 



c-C 

e 






o 9 P 3 o 









P o G 








S 



e: 

a 












^ 












Open Competitive Examinations 



667 



ciooefOtoioiogkMMfiN 



go«2-.g«g5j2a g^^s-^^ss^gjg^^^^^is^sgsssisz^ssssssss 







^ ,.H r» 1-4 isi 0) (O ^ a» 00 oooe^eo*^^ 



w^wmw^ •!>» 



M»^M .1-1 . -NC* • '^.H 



^4 f-4 *o t«> t^ fM ei .v^ 



^^c* 



£2»H»H^4 



•.* WW 



w>^<-t5re9Wfi4 



w»i*c«wc« 



CtCOMAO .WC< 






(Op^CIM 



M -t**© 



^^e* 



^«ow 



eir-i^eciO>-;«oa^aoio^w 0)c^^«wiQ«owMr«9«*aMw*o^^M^«o«ow«oe4^«^ 



^ 00 w 




:§^ J J I llllllii 






illl 










8§§ 
x8fc 






o 8 ^ 



'"< ^ Ti ••-••• 



|8|8i8i 



o ^ a 
58 




o o o p o 

— ft* ft* u £• b 

aaaaaa 



||||i§§§l§§§§§§§§ 



^s; 



N 






« 

c 

9 



-- Em 6 — -- _ 
«* >k2 « >iO 



M «W 



'^•^•-•^ gM 5 — N« 



668 



Report of State Civii. Service CoicicissiON 



It 







o 









•^^co 



• «« 


tM 




^^•-"^i* 




— f CO 


*S 




«co 






• eo ■ 




•^w • 



e«M-*or« 






•^•-e>»^ -N 



e«w •e*5«i'N«-> •wto»->^«t^»o ••^ -co 



« • t* 



■s 
I 

00 



CD 

o 

K 
K 

H 

P 
H 
Pu 

o 

H 
Pu 
O 



'I 



•*e» '^iCffO -^ • •«•* ••^oweo .^.-^o ..^ao^i^co 



^^ ^ *H •-< li* r* s< 




•• a" e ^ 

gEEEEEEfiSEgEEEgEiEgSglgelgiE. 

OUOOOOOOOOOOOOOOOOOOOOOOCJOaoafrf 



e 
o 

c 

*i 

OS 
M 
& 



5 



e 



w 



« mm 



»»« 






c 2 >v'» 



W*-*-*'...,*" 









Ofbn Coufktitivi: Examinations 



669 







lOwci^MWW ^1-4 viNviN *-i*-^ 1-^1-^ el«"#l t« 1.^ •-« i5 ^ N rt 



OaC?4»->C4 



^wm .^MM 



©••- '^aOM^ 



COW 



^ 1-1 »«p« 



■•-I •cc«-«^aocQ -.M^^esi 



-c« • ••o«^«o«ocio 



^ »i^ 



ei 



^4 lO CI «C i-«CO y^ •-4 «0 



»* .^ -eiio 



■w 



•OCMiOvi* 



J-g«^tN 



^-C1^4 CO 



»*»4^eiMeoeo^«^*o«<4ieeoo<r<>t«^«^«<4ioace««<4«eco»* 



i-« vi* e 







670 



Repobt of State Civil Service Commission 




w^ ^4*14 w^^»tri C«^4 CO «^ <-4 «-4 «ii«vMCI«i4M ^^M el 



«<S!Si^^ "SSSS oSSS6SS<SS«<SsM6 s« s« 






3 

o 



"8SS582'-* ^^'^^ S;8SaS2s-2«r2''a2*S ^''S «gr: 



I3 



^oo>o<^ 



ei •<-4«o oeoQOM^vi^eo • •i-ivi^co '^^mc* «m 



is 



Oi ococo^co 



c< 



Mcoei^f^o • -i^^ • 'lOio 'C^ ^ 



I 



00 



to 

as 

o 

2 






lOOQOOM^i-i • Mi-m^ 00 -d-teOf-^iQ •co^eoc^M^-^p 'to 



« -^i* 







H 

H 
Pu 

o 

H 
6. 

o 



M4 



a 
§ 

I 

•o 

U3 



2 

^ 



•J .9 



a 



6 

ST. 



n ;| 

.Sf :8 



s 






§ 

o 
u 

a 

« 

t 



"S 



te »; ot .-o 5 P^r 





iiiil 






c 
o 

«3 

cS 

C 

s 

« 

H 

& 



Q 



If 



c 

9 



P3 






Open Competitive Examinations 



671 









^'^ '^^ '^3! 



»-» • .i-<.^K5 •M^^COdOiX -^ . .^ .^ . .«hC« 



S8 : ^J^-" 



CI 



CO . .^ 



eo»^N 



r^co 'Oooeo • 'W 



ec • '^f-i • •ioao<-<a» • ©ec -"^ 



esir^o 





M'«»0'« 




»o 


»iH • 



«-i •^cD^<-i«oo^e»o 





>♦« 






« 






*M 


9^ 




r* • 






^.-i^ioo<CQO<-mc«c« 




WW -P* 



^ gal S oo 
2j|||||l 






a 



& 



c ^ S Sg - 



d 










*1 




.mil 



W 



3 

■§ 

1 

3 

-SI 



c 



a 



«.s 



^s 



1 tills a il III 



-2 

Ob Si *" •*» '^ .ii^ 



I 

O 






S 






>>g5'g|-^**^ 













o 
S 



CO t* OOCO CO ^^ 
CO 



S' 




I 

u 

o 



OiQiO 



67S Report of Stats Civit. Skrticb Commisbiotv 



Open Competitive Examinations 



673 



r* r« o ^ JO 00 o o ^ CO o lO t« lO 00 9 3i> 1-4 a» CO e« r« 9 a» a» o) 9 00 00 00 a o ^ 

z22o2Q4ooo|ooSa4oiS4Qao44444QdiS44iS 



•-• o CO «o CO lo « le e« e« io CO <o o CO lo lo 



•Qeocooeoiotooooffoo^aioo^to^ioio^^^^ 



«( 



eo 





*Hcoio«eo 


• ^* 


CD 


M 





r«c«cDr«c«iH 'r^iH 



»««^iH 



s 



CO 
9 



1-4 









«e«co 






-OOiH 


;« 


la-^s-* 







00iO-H^CDC« 



^^ 



^ioc«eot«a»ooiOf-if-io<H«oocoes|e«a)Qt-<-4<-ieoc4eo^^e«iO<-ioo-H 



00 

1-4 
^^ 



19 




G74 Report of State Civil Service Commission 

OPEN COMPETITIVE EXAMINATIONS OPEN TO NON-RESIDENTS 

AND NON-CrnZENS, 29x8 

(Admitted under proviuons of Rule IX, Subdivimon 2, and Regulation X) 

^ . Date of enmina- 

Pontion tko. 1918 

Aasiatant bacteriologMt April 27 

Aasiatant bacteriolosbt October 5 

♦Awistant ohemiat December 7 

♦AaBJBtant chief statistician April 27 

♦A—istant examiner April 27 

Assistant laboratory dianiostieian December 7* 

^Assistant physician, regular or homeopathic February 23 

^Assistant physician, regular or homeopathic March 30 

♦Assistant physician, regular or homeopathic April 27 

♦Assistant phsrsician. regular or homeopathic May 25 

♦Assistant sanitary engineer Februaiy 23 

Assistant serologist, grade 7 October 5 

Assistant serologist, srade October 5 

♦Assistant superintendent April 27 

♦Assistant supervisor April 27 

Bacteriologist-pathologist Octobor 5 

Bath attendant • April 27 

♦Chief of division of industrial accidents August 3 

Clerk and stenographer (secretary) June 29 

Cost accountant March 30 

County or visiting nurse Augunt 3 

Dietitian May 25 

Disinfector and policeman June 

♦Engineering assistant (civil) August 3 

♦Garden matron Apnl 27 

♦Gas engineer or chief gas inspector October 5 

GenersI matron March 30 

Guard January 26 

Guard August 3 

♦Heating and ventilating engineer March 30 

Hospital orderly March 30 

♦Junior accountant May 25 

♦Junior accountant October 5 

♦Junior aiisistant engineer October 5 

♦Junior electrical engineer October 5 

♦Junior engineer, grade 8 June 29 

♦Junior engineer, grade 8 November 9 

♦Junior statistician May 25 

Laboratory apprentice April 27 

Laboratory apprentice Oct^ser 5 

Laboratory assistant in bacteriology June 29 

Laboratory assistant in bacteriology Octobor 5 

Laboratory assistant in chemistry June 29 

Laboratory diagnostician August 3 

♦Library assistant May 25 

♦Library assistant November 9 

Matron January 2« 

Matron February 23 

Matron March 30 

Matron April 27 

Matron j^fay 25 

Matron June 29 

Matron August 3 

Matron August 31 

Matron October 5 

Matron November 9 

Matron December 7 

Mechanic and repair-man May 25 

♦Medical expert on tuberculosis May 25 

Physiologir^ chemint October 5 

Principal or assistant principal January 26 

♦Principal keeper June 29 

♦Sanitary engineering draftsman October 5 

♦Senior statistician August 31 

♦Specialist in drawing and industrial training June 

♦Specialist in vocational education for girls June 

♦Statistician March 30 

♦Superintendent April 27 

♦Superintendent August 3 

Supervising nurse, class B June 

♦Teacher June 29 

♦Tractor expert May 25 

Water analyist (.>rtobcr 5 

♦ 0|>cn to non-residents. 



Competitive Pbomotios Examikations 675 



•8« 

I 



'I 



0000 2eS*^'^eSS!S'^'*^^^'^^^°^^ eoci«'4«ao«^>o^iet«r«r*iOM9uaM£ae« 



cs<o ^ •r»e9er«^^eoe»^aot«^e«<-( a»<-ito^io«^Q0f-i^iOfHC«eo<H 'Mar^ 
eo«^ 6« • f^ *H » c« ^iH ,.4 .(i| ^ 



5? 



<-•« 



•M 



O 

M 

o 

< 

5 



IS 

in 



coco 



0» 



..^ •« 






•oeo ^ 







0» 






e« 


^eo 






s <^« 




•M^^ 





















C0»-iC9 




D 



2: 

o 



O 






S« cS 



■ 1^ CO CO t« »H <-« ^ o CO to r^ <-« e<i o r*o)(0^ece<i'^t^«^^^<-<e4co<^ 



I 



S5 ^ 
o o V 

Ti 

ill 

111 

OK) $ 

11! 

. s 






J- 



O o «> 



s »Sa» § fi # 




3 ^ 3 5-g 5^" 

*»* .J s ^ .-^ 



i^co C 



l^lll 



5 



73 

B 



a 



a . 



a 




a 

9 

8 
& "8 -fil 

fljalll 



ills : 

■ ^ UM V 2 t* ki b 

Ici^.gSooo 



QOt^CO 






a a 

9 9 9 

888 







•I 

>>^ « d {3 S 

\ a'^-ii R-s ^^^ §IJ |ii JSeS-- 




^ fl 2 w 2 k u 



^-•a.S'Hoo 5'^;i^ooo» 

*|££l 

OMJCM 



«» 

JQ 



s 



o 
CI 



OS 
9 

e 
•s 



W C5 W CC 
C4 C4 f-i 

b 



U4 



CO 
C4 



^^g 






«o co< 



CO 









•o 



676 



Report of State Civil Service Cohmission 



s 



g5S»*=S»SJSSS«22SSS8S"S 28Sa88"a'""'aSSS 



Mao « 






i 



1 



iomeo«^«Q<-i^o<-i'4««D^e«iH<or*r*«^r*e« ie»i4<oi-«iOi-4^^a»^9io^^apio » 



v4 « 









r-t '^O 



>« 



>l«><0 



^ • 10 






00 



OQ 

o 



ll 





Sg» : 




IH 


•-«« • 








T-t 






















:-a-. 










^oQcoc«r*«o^^ai<-ic«ooi-icif-itDr*«Df-ir*c« iO<-iOfHio*-4^^e«^<pie<-i^oio « 



d 



eo^ 



c« 



S' 



M n 



2 
O 



O 
OS 
Pk 

H 

o 



If 



2 
O 

pi 



3 



& 




iliimiliil 




-J »-" 1*8 5*a"§rC 8 § 9 S * 3 



ihiiiiMliiitt 

^- i^ H H u *fe^ 5*** Si:'* 










iiUlMI 



Ot Ot Oil . 
5 «— s a 2 §-S-?<'t3-«-« « 2'^'9 8 



15 II III? 







(BQO»-» 






0000 oxooo 

o 

c 



j>.o» go S2g52S888 



'^SRSg 



CI 






I 



COUFBTITIVE FbOMOTIOS ExAUINATIONS 



miumimimmiMtUi t auuMMmm 



m 



ililftijljf 

alls': s'shIiI 




lllllllllllllliljillllflllFl^illfeJi 



I #■ III ill: 



I ||S 



C78 Repowt of State Civil Service Commission 



<S 



00 



CO 

O 
< 

3 

K 

H 

O 



o 

At 

H 

P 

P 
K 
At 

o 



1/ 



r 




is 







o 



TO 

o 

a 

H 












eo^ioco^<-i«^»H^eit,A,^,-i^^^ aoiOp4i-iMc«<-i 



to 



CO 



«-< -^ . 

• • . • I ! .' ! ! #[ 






5 



eonudCQi 



C4 



iN«-i 






8 



^ri 



a 
« 

e 

la 

-I 

c o.S 

lit 
>^':s <u ° 9 5 ^^-^ 






o 

.S o 2 







|-s„-|"s-stS. 



Si*. 



I 

» 

c 
o 

I 

6 

c 

s 

8 

H 



si's?; i 

o c S 






5= 



« 



«-5 







Sii S^' 



O V 6/ c.^ *; 



3 



'tlSili|j§"s 



a c c* 2 c 
C.S.2 S ^-2 



2i{*» S^-TJ S***** 



Z2 



c 

3 

8 



c 



a 

3 

8 

h 
O 



Hi 






0.8 SS^s 



= 23 




,s.a3T 

(30 •.3, 

» •^^ • • 

v ot; « 9 e 

llfsli 

la k S h. b > 

a> &< g & «/ 2 



3 

o 



Cs 



It 






CI 



eo C4 



«mK 



I OaSo 






Non-Competitive Promotion Examinations 



679 



NON-COMPETITIVE PROMOTION EXAMINATIONS, 1918 



KIND OF EXAMINATION 



Qualified 



Not 
quAlifiad 



at. Binghamton State hospital 

Dt. St. Lawrenoe State hospital 

Dt. State food oommission 

sistant in serology, psyohiatrio institute 

ditor, department of excise 

insurance department 

ing as food expert, department of farms and markets 

arge of New York oflBoe, department of farms and markets. 

baotoiologist, department of health 

derk, supreme court, Richmond county 

court clerk, Munroe county clerk 

engineer, Bronx parkway oommission 

engineer, Erie county penitentiary 

engineer, conservation commission 

engineer, industrial oommission 

engineer, trustees city and county hall, Buffalo 

manager, insurance fund, industrial commission 

in public records, university of the State of New York 

in visual instructions, university of the State of New York . 

tnd chief, department of public works 

ogist, department of health 

indcxer, prison department 

of police.Pclham 

ir examiner and clerk, secretary of State 

rk. Kings county commissioner of records 

rk, custodial asylum, Rome 

rk, reformatory for women, Bedford Hills 

Ttrioal engineer, Manhattan State hospital 

lineer, board of water commissioners 

;ineer, university of the State of New York 

clerk, highway department 

police, Peekskill 

»bation officer. Kings county court 

>alth officer, port of New York 

ew York county clerk 

ueens county clerk 

cretary of State 

vil service commission 

»mptroller ; 

ith knowledge of typewriting), industrial commission 

surance department 



easurer. 



d stenographer, tax commission .... 
I>urchasmg agent and stenographer. 



Monroe county pu ''chasing 



r, civil service commission 

ndustrial commission 

}rk, insurance department 

istant physician, Dannomora State hospital 

istant physician, Matteawan State hospital 

istant physician, hosoital for incipient tuberculosis, Raybrook . , 

rsician, custodial asylum. Rome 

engineer and machinist, health officer, port of New York. . . . . 
r of grade cros sinn. public service commission, second district. 

ktor. Erie cou ^ ty ooard of child welfare 

Schoharie school of aip-iculture 

ppraiser, tax commission 

lerk, department of health 

!erk, department of public works 

erk, fiscal supervisor of charities 

erk. public service commission, second district 

erk, commission of highways 

erk, comptroller 

erk, conservation commission 

erk, department of education 

erk, hosoital commission , 

erk, industrial commission 

erk, prison department 

erk, treasurer 

erk, imivorsity of the State of New York 

»ry assistant, department of health 

it, Onondaga county penitentiary 

superintendent, prison department 

er, department of health 



2 



BSFOBT OF StATB ClVIL Se&VICE COMUISSIOS 

oH-cOMFETinvE fbokohom EXAHiHmoNs, 191S — Condvdtd 

KIND OF EXAMINATION 



Senior uai) SUMhoqiiUI . . 

Sciuor sail Stata hiapiU . . 

ScDior anil irlum. Rome 

8p«ci&1 ctep UDty eJefk...... 

St«nognph E of tvaab . ,.. ^. 

Stenogrsph tion anmniuMnn 

8l«nogr»pher 

Wwt Bavemmw 

Stenogiflpfaer uul clerk. ooEuerrstioa a 
8tCDD(i>pher Mid Uh clerk, departman' 

StdDOffraptur. department of public woi . . - — 

fitflnoErapher. Kin^ county court. . - 

Stenogiapher (male), Manhattan State honpital. . 

ewntwmphir. uuHio k — ^ :—:.- 1 j 

Btenogrspher. 



id bookkeeper. hoipiUI for crippled and defoRoed ohildnn. 






KON-COMPETITIVE PROVISIOHAL EXAMmATlOHS, 1918 


KIND OF EXAMINATION 


Qualified 


Not 
qualified 


.^•potted 


Ant 

is. 

Ar. 




\ 


































A-i 






aT 


S! *i";utaS;r";i.r^"»^!u,. m 




























Aw 

is 


s;:i-szi:^^ssrssiSs-2z-Si^ 




AhI 

Aaw 






irtant medical officer, health officer. Port of New York. . . . 





KoN-CoMPBTiTTVB Peovisional Examinatiosb 681 

1, leiS — Conitnued 



KIND OF EXAMINATION 




Not 
qiulifiwl 






10 


















































































s>S.tas,S«»:iss^ii^ 
























laSsliir^^£s&- ■ ■ - 




CouulUntioTunlinaldiHUH.depBrtnWDtofbeUtb 

County niui«|.Staub.n«.unW 
















Director of Uboratory. b«1tb offioer. Port of New York 
























\^SSX^ii.i^ 


! 










TiUaceofPeekiddU. 
























t.Q«««n«>UDty.... 
































Foramu in oharie of r^n to SUto iiUnd at Lake George 








Forenun. deparUncDt of hiRhaui'i. Ooondun eounty 












H«»] ovpenter, Home cuatodiaj iq^uia 





Rkpoht of State Civil Sebvice Commissios 
L EXAHiNATloNa, 1918 — Continued 



KIND OF EXAMINATION 



Qukliflcd quti^Hl Appoint 



Eead fUQwr, Cnig oolony for epileptiaB . . 



{Md larniot, fum tor ■" 



nduBtriAl iDuwetor. Clinton priflon . , 

'— ■" — rtmuit of hsalth 

ilahta uid aauurts, deputment of (■ 

napMtor. dapirtiiiBiit of fvmi uid mkrkala . , 

nyMti^itM- liiatricit BtlonHr,^uceni 

Looountuit, public i 




n, fint dirtriet. . . 

t mttonwy, Richmond county ..,.-. 

-in deportmrnt 



-. jutljtiiuui. dspartmcat ol hemltb.. 

KMpvT, Erie oounty penitentimry 

Keeper. SuDolIc lUunty ■JmabouK 



KMper. Uliter o 
Laboratory tf— 
Laboratory at 
l4borat4>ry at 



«, dapartment of health 

in baaterioioffy. department of health . , 
-^^«..»., -_.o».u. in chemistry, dep^tmeat c^ health. - . . 

laboratory dii«nogticiau, departinBat o I health 

Laborer and iratohman. SUte ooUe^ for teacher*. Albany.. . 

IdundryioaD. Oneida county hoapital 

I«w ■teoDgnipher. diitriot attorney, New York oounty 

Lecturer on social dueiHS. department of health 

Ubnuy aaaiatiuit. oomt of apoesli library, Syracune 

Library aeBiBtant. education department 

Loelf oiKrator, department of public worlu 

Lunacy clerk, auperintendent of the poor. Renuelaer county. ■ 

Market inspwlor. food oammisaion 

Matron. Onouda^ county penitentiary- - 

Matron, Suffolk oounty chitdren 'a alraihouie 

Medical expert on tuberculoflifl, department of health.. 

Medical auperintvndont. Chcnao^ county tuberculoaia hoa- 



pital.. 



Meel 






rt of New Y. 






rtof New York... 



Non-Competitive Pkovisional Examinations 683 



NON-COMPETITIVE PB0YI8I0NAL EXAMINATIONS, 1918 — Concluded 



KIND OP EXAMINATION 



Safety inapeotor, induatrial oonuniMion 

Seercrtary to county judge and surrogate, Richmond coiinty . . 

Secretary and bookkeeper. Long Uland school of agrictilture, 
FVumingdale 

firHing agent, commission for blind % . . . 

Senior assistant physician, Rome custodial asylum 

Senior market inspector, food commission 

Shipping derk, department of health 

%>eoial service worker, Bingham ton State hospital 

fi^Mcial agent, industrial commission 

fi^Mcial deputy clerk, county clerk, Onondaga county 

^lecnal investigator, industrial oonunission 

Statistical clerk, industrial oonmiission 

Stenograi^er, Binghamton State hospital 

Stenographer, Bronx Parkway commission 

Stenographer to chief probation officer, Erie county 

Stenographer, commissioner of jurors. (Queens county 

Stenographer, Craig colony for epileptics 

Stenographer, department of health 

Stenographer, board of child welfare, Erie county 

Stenographer, Great Meadow prison 

Stenographer, Kings Park State hospital 

Stenographer, military training commission 

Stenograi^er, public service commission, first district 

Stenographer, Kome custodial asylum 

Stenographer, food commission 

Stmiographer. hospital for crippled and deformed children, 
West Haverstraw 

Stenographer, industrial commission 

Stenographer, normal school. Oswego 

Stenographer and clerk, superintendent of highways, West- 
chester county 

Stenographer and clerk, Erie county lodging house 

Stenographer and storekeeper, Thomas Indian school, Iroquois 

Stenograi^er and typist, commission on new prisons 

Stockman, Erie county purchasing department 

Storekeeper, Great Meadow prison 

Storekeeper, Letchworth Village, Thiells 

Storekeeper, hospital for crippled and deformed children. West 
Haventraw 

Sub-librarian, education department 

Superintendent of construction, department of architecture. . . 

Superintendent, county agricultural exhibits, fair commission. 

Superintendent of highways. Dutchess county 

Supervising addressograph operator, secretary of state 

Supervising carpenter, Hudson River State hospital 

Supervising derk, department of health 

Supervising nurse, department of health 

Supervising nurse and social worker, department of health . . . 

Supervising officer, vocational training, military training com- 
mission 

Telephone operator, department of charities and corrections, 
Erie county 

Topographic draftsman, commissioner of records. Kings county 

Tractor expert, food commission 

Traffic officer, Nassau county 

Transfer tax assistant, comptroller's office 

Transfer tax assistant, Oneida county 

Tjrpewriter copyist, county auditor. Onondaga county 

Typewriter copyist, public service commission, first district . . 

Typewriter copyist, county clerk, Oueens county 

Typewriter copyist, county clerk. New York county 

Tjrpewriter cop3rist. health department 

Underwriter, industrial commission 

Vocal instructor, school for blind. Batavia 

Voucher and treasurer's clerk. St. Lawrence State hospital. . . 

Watchman, agricultural experiment station. Geneva 

Watchman, university of State of New York 

Water analyst, department of health 



Total. 



QuaUfied 



10 



2 
3 
1 



2 
5 
1 



658 



Not 
qualified 



Appointed 



10 



2 
3 
1 



2 
5 
1 



658 



684 Rbpobt of State Civil Seevicb Commissiox 
koh-compktitive examinations (rule vih, section lo) qis 



it, dflpATtmaot of tMrun u 

''-It ohuniat, DubU 

_Jt fllBotrio*! on^ 

Anistuit slMtriesl anni. ---- 

A»lit»nt swoiner of duou. SUM induitri . 

* ' - nt farm luperinMwhat. SUM iodiutrial comnu 
□t iiupeotor phvBical trmioinfl, mjlitAry traiiuDA 
at medienl offioer, bMltb offioer. Port New Vorl 




Batb »tUnduit, «, . .^_ , 

Bookkeeper, itnts induathiJ oommiuion 

Bookkeepar ftod itorakeeMr. wdmea's relief coipi boi 

Bookkeeper, womeo'i relief ooip* home. Oifoid 

CarMkkeTi chiklreoB borne. Newburih 

Chief nurae. Cruc oolooy for epilepticB. 

Chief nurM, Stute ■grieultiml uia indiutrial •chool 

Clerk, eouBty elerk't offiee. New York oounty 

Clerk, dietiiet attomer. Queeua eountr 

Clerk. Homeetewi •ustonum. Sumtpn county 

Clerk, Siste tanculturmi Knd indiuUiiJKiliool. Indiut 

Clerk, lurroEBte'B court, Btoni oouoty 

ClottiiM clerk. Brooklyn 9uta hoipitlll 



H clerk, diitric 

Copyiit. Queeni couoty clsrk'e offi 
County phyaiiuAn, board of Auperv 
Day cuaid, agiioultunl and indiut 
Drafteman, reciater'ft office. Bronx 
Eleotiioal euueer, (lade 1, Muih. 
Eliaineer. BuBalo State hoapiUl . . . 
Enijiieer, ehaiitkB and aorrectioiu 



,te hoepital. . 



Fireman, Oneida oounty hoiDital, Rome 

Fireman, ODOodi^ sanatorium 

Fireman at pumpuw itation, board ol water 
Foreman of pubUTworka. commiggion on dc 
General clerk SuBolk county clerk's oSce . . 
Guard, agricultural and industrial school. In 
Head nurse. State hoapital lor crippled a 

Haverstiaw 

loflpital interne, western houae of rcfun, Albion. .- 

loapital malronl wstern house ol'fefjge'. Albion! '. '. 



1 deformed ehjdreti, Weat 



ID tailorina and drManiaklDS, refor 



Dvestiiator, State 



iXl; 



hoepital, Rome. . . 



J attendant , 

or usistant. public service commission. Girt district. . 

uiiior clerk, oouoly elerk.' Queens coun^^ ."T^, ."'.' 

unior clerk. New tork oounty clerk's office 

, uDJor olsrk, public terrioe oomniissian. fint district 

' u- eleetrioal enffueer, pubUe anvioe DQaumuion 



Employment Undeb Eule VIII, Sub. 10 



685 



!f-0OMPETrnTs sxAifiNATioNs (rulb vm, SECTION 10) 1918 — ConHnued 



KIND OF EXAMINATION 



derk. State industrial oommiaaion 

(urten teacher, Thomas Indian school, Iroquois 

> and watchman. State ooUege for teachers 

jrman, SuffoUc sanatorium 

assistant. University of the State of New York 

|OT, district attorney. New York county 

|OT, d^Mtrtment of health 

|OT, treasurer, Erie county 

cer, food commission 

aph operator, industrial commission 

ai^ operator, secretary of state 

reman, board of water commissioners, PeekskiU 

uard. agricultural and industrial school, Industry 

urse, women's relief corps home, Oxford 

ratchman, conservation commission 

loldiers' and sailors* home, Bath 

traininjK school for girls, Hudson 

sostodial asylum, Rome 

ndostrial commission 

rbomas Indian school, Iroquois 

iromen's relief corps home, Oxford 

isistant, Montgomery county sanatorium 

isistant, Niagara countjr sanatorium 

■istant, Suffolk sanatorium 

oy. district attorney. New York county 

, Erie county home and hospital 

Bpsrtment of architecture 

tate food commission t, 

tate industrial commission 

iiUio service commission, first district 

irrogate's court. Queens county 

lan, police department, village of Rye 

auditor, industrial commission 

1 culture director, house of refuge, Albion 

1 instructor, Letchworth Village, Thiells 

in, hospital for crippled and deformed children. West Haverstraw. 

il, training sdiool for nurses, Oowanda State hospital 

il, training school for nurses, Manhattan State hospital 

t i^ysician, house of refuge, Albion 

assistant steam engineer. Central Islip State hospital 

issistant physician, Craig colony, Sonyea 

istnictor, Letchworth Village, Thiells 

investigator, industrial commission 

il^er. Central Islip State hospital 

sf^er. State board of charities 

ipher, commissioner of elections 

if^er, food commission 

spher, Gowanda State hospital 

ipher, department of health 

ipher, industrial commission 

ipher. Kings Park State hospital 

ipher. Manhattan State hospital 

ipher. Military training commission 

ipher, superintendent of poor, Niagara county 

ipher, Oswefl[0 normal school 

ipher, commissioner of jurors. Queens county 

ipher, Rome custodial asylum 

ipher, western house of refulge, Albion 

ipher, women's rdief corps home, Oxford 

ipher and typist, food commission 

ipher and typist, secretary of state's office 

erk, industrial commission 

Bper, Brooklyn State hospital 

nng nurse, women's relief corps home, Oxford 

lor of music and physical culture, Newark State custodial asylum 
■, kindergarten and primary, Syracuse institution for feeble* 

k1 children 

■, children's home, Suffolk county 

, Thomas Indian school, Iroquois 

, training school for girls. Hudson 

ne operator^ health officer, port of Ne^ York 

isistant engmeer. Utica State hospital 

isistant phjrsician. hospital for incipient tubei culosb, Rasrbrook. . . 

nurse, Craig colony, Sonjrea 

iter cop3rist, food commission 

iter copyist, Gowanda State hospital 

iter copyist, industrial commission 




Qualified 



1 
2 
1 
2 
1 
1 

12 
1 
1 
2 
1 
1 
1 
1 
1 
7 
1 
1 

10 

41 
1 
7 

10 
2 
1 
1 
1 
1 
1 
1 
1 
1 
1 
1 
1 
1 
1 
1 
3 

35 
1 
4 



Not 
qualified 



1 
1 
1 
1 
2 
3 
2 
4 
1 
1 
1 
1 

1 
1 
3 
1 
2 
1 
1 
2 
3 
3 
2 



1 
5 



12 



1 
3 



21 
2 



6 



686 



Report of State Civil Service Commission 



NON-COMPETITITB EXAMINATIONS (rULB Yltl, SECTION 10) 1918 — Conduded 



KIND OF EXAMINATION 



Typewriter copyist, county clerk, New York county 

Typewriter copyiat, county court, Queena county 

Typewriter copyist, secretary of state 

Typewriter copyist, comptroller, Westchester county 

Underwriter, industrial commission 

Underwriting clerk, industrial commission 

Watchman, Schoharie school of agriculture, Coblesldll 

Watchman, hospital for crippled and deformed children. West HaveTBti]pi 

Total 



Qualified 



505 



2 


• 


1 




14 
1 


S 


10 
1 


2 


2 




1 









Not 

qualified 



105 



NON-COMPETITIVE EXAMINATIONS, 19x8 

Rated at Albany 



KIND OF EXAMINATION 



Addressograph operator, tax department 

Assistant agronomist, agricultural experiment station, Geneva 

Assistant bacteriologist, agricultural experiment station, Geneva 

Assistant to borough chairman, food commission 

Assistant cook. Pleasant Valley sanatorium 

Assistant engineer, institution for feeble-minded children. Syracuse 

Assistant engineer and electrician, reformatorv for women, Bedford 

Assistant engineer and electrician, training school for girls. Hudson 

Assistant engineer and electrician, western house of refuge. Albion 

Assistant horticulturist, agricultural experiment station, Geneva 

Assistant janitor, Jefferson county sanatorium 

Assistant matron, commissioner of charities and corrections, Westchester 

coimty 

Assistant matron. Long Island school of agriculture. Farmingdale 

Assistant matron, reformatory for women, Bedford 

Assistant matron, training school for girls. Hudson 

Assistant matron, western house of refuge. Albion 

Attendant, Auburn prison 

Attendant. Oneida county almshouse 

Attendant. Oneida county hospital 

Attendant, Onondaga county sanatorium 

Attendant, farm for women, Valatie 

Assistant nurse, superintendent of poor, Rensselaer county 

Assistant nurse, Oswego county sanatorium 

Assistant resident phjmician. Monroe county tuberculosis hospital 

Assistant steam engineer. Rome custodial asylum 

Baker. Albany county almshouse 

Baker, Oneida county hospital 

Bank messenirer. State comptroller 

Bookkeeper, Ulster county farm 

Bookkeeper, Ulster county almshouse 

Bookkeei>er and stenographer. Pleasant Valley sanatorium 

Butcher, training school for girls, Hudson 

Caretaker. Suffolk county sanatorium 

Caretaker, Summit View hospital 

Carpenter, agricultural and industrial school. Industry 

Chauffeur. Albany county almshouse 

Chauffeur, commission on new prisons 

Chauffeur, conservation commission 

Chauffeur, health department 

Chauffeur, fire department, village of Peekskill 

Chauffeur, fire department, village of Port Chester 

Chauffeur, hospital development commission 

Chauffeur, public service commission, first district 

Chauffeur, commission of highways 

Chauffeur, fair commission 

Chauffeur, reformatory for women, Bedford ^ 

Chauffeur, training school for girls, Hudson 

Chauffeur, superintendent of public works 

Chauffeur ana coachman. Auburn prison 

Chauffeur and laborer, purchasing agent. Erie county 

Clerk to the treasurer, soldiers' and sailors' home, Bath 

Co^hman and chauffeur, training school for girls, Hudson 



Qualified 



1 
1 
1 
7 
1 
1 
1 
1 
1 
2 
3 

1 
1 
9 
48 
3 
1 
1 
4 
1 
5 
1 
2 
1 
3 
1 
1 
I 
1 
1 
2 
2 
1 
4 
1 
1 
1 
4 
2 
2 
1 
1 
6 
9 
1 
2 
1 
5 
1 
1 
1 
2 



Not 
qualified 



Non-Competitive Examinations 



687 



NON-COMPBTITITX BXAMINATIONB, 1918 — CoflHnued 



KIND OF EXAMINATION 


Qualified 


Not 
Qualified 


rV>miTiiinitv ivAlfftrA lurAnt. IS^nnmA nniintv iiA.nAtArium 


1 
1 
2 
1 
3 
2 
3 
3 

2 
11 

3 
3 
2 
10 
2 
3 
2 
6 
3 
2 

51 
15 




rVwik. AAfnini«rinnAr nf rh&ntifM and flOmntioDB. Eri6 COUntV. r . r 




rVwik. Jtkttmrann nniintv ■a.niLfnriiiiTi 




Onnk. TAlcmviAw BftllAtoriuni 




Oook. MoDtcomctrv BftiiAtoriiini 




Oook. Mountftin nnAtoriurn Broorno oountv. , 




Oook. Niagara nnnnfcv iiani&toriuni , 




Oook. Onfllda ooiintiv hnanitjd 








Oook. Ofrwmro rountv iiani&torhim ^ , 




Onnlr. PlMimnt, VaIIav MLnRinrJuxn r , ■, 




Oook. Rookv Omit Bftnatoritim 




Onnk. Rnffnlk nniintv ■a.niLftAriuxn , ■, , 




Onnlr. Stimmif ViAur hofinitfil r , 




Ouiitodian. Ncnrtown bftttlefield rMffrvation commiiHioii 




T>a.v niinM. OHaII mAmnrial ■anatoriiim 




T>iLV niinM. OmvAim raiiintv ■•.natorillRl r . r 




Dffntal intMmff- Rmnlrlvn AfjitA hofmital 




rWinfftl intArriA. OAntml Talin Rta.tA nmmitAl 




rVntal intMrnn. Manhifcttiin RtatA hoftnital 




TkriirAr m.iui nhiuifTAiir. r>AnnAmnni. Rta.tA hnanitAl 




Driwtr uid ohaulT6ur. Bins ftinff oriflOD . - r 








l^fUTn^r. hoArd of minArviiinni. Niiurftni. nniintv 




VfLrmttr. Avrif*iilfiir«.f And indimtriAl aphnnl. IndtUtrVr 




Farmftr. traininff school for irirlfi. Hudflon . . . r , r 




'FArmAr. hotiiK) of rf^fiiirfi. Alfxion 




'PSrAm An . Olintoii oriflon . . . , , 




'PSrAmAn. OlAnridvA mUiatorium 




irirfiniaii. NiAffara MinAtorinm 




liSrAmAn. hmmital for incioieTit txihMfrruloBif. RAvhrook 




1!SrAniAn. rAfnmiAfrtrv tar wnniAn. Rndfrtrd 








PSpAmAn. rAfnmiAfrtrv fnr wrnmAn. RAnfnrd 




IMraniAn. trAtnincr arnnnl fnr Hrlil. Hudson 




T^rmnan. school Tor thn blind. BatAvia ..... t r r 




liSrAnnAn. ivAatAm hniMA nf FAfnirA. Alhinn 




Foreman of laborers, secrctarv of State 




ITnrAmAn. nainter. health officer. r>ort of New Vnrk 




FnrMrt ranker, conservation comTnission , . r . - - r 




Oardmi matron, traininir school for irirls. Hud«nn 




Oraduata nurse. Erie countv home and hosoital 








riiiArH . training schftol for ffirli. HtiHiinn , 




HArhor master sunerintenoent of oublic works 




Head laundryman, hospital for incipient tuberculosis, Raybrook 




Head nurse, tiakeview sanatorium 




Head nurse. Niacara countv sanatorium 




Head nurse. Osweiro oountv sanatorium 




Head nurse. Pleasant Vallev sanatorium 




Hnad nurse. Rockv Orest sanatrOrium , 




Head nurse. Suffolk sanatorium 




HaaH mirAA. Hiimmit ViAvr hrumitAl 


^■•■•« •• 


Housekeeper at guard's quarters, commissioner of charities and corrections, 

WAafi»hAiifAr nniintv 




Housekeeoer. Monroe county almshouse 


• / 


Hoiisekf^Deri New York State reformatory, Elmira 




Houaekeener. Ulster countv farm 




Hoaaekeeoer and cook, reformatory for women, Bedford 




Instructor in laundry, reformatory for women, Bedford 




Interne. Erie county home and hospital 




Interne. Erie countv Donitentiarv 




Interne. Manhattan State hosoital 




Interne. Monroe countv tuberculosis sanatorium 




Tnteme. Utica State hosoital 




Interne, acting as third assistant physician, hospital for incipient tubercu- 
loais. Ravbrook 




■Tanitrir. .Tenerson countv sanatorium. ...,,,,-.,,, r ,,.,-- , ... 




jAnitor. Homestead sanatorium 




Janitor. Oak Mount sanitorium , 








Janitor. Rockv Orest sanatorium 




Janitress. 8ui>erintendent of DOor. Erie county 




LAboratorv beloer. health deoartment 




T jLiindress. Oneida county hospital . , , ^ , , , , 




Laundress. Osweao county sanatorium 




Laundress, Pleasant Valley sanatorium 





CSS 



Eepobt of State Civil Service Commission 



NON-coMPETiTiTX EXAMINATIONS, 1918 — Continued 



KIND OP EXAMINATION 



Laundrew, Rooky Crest sanatorium 

LaundresB, Suffolk sanatorium 

Local examiner, civil service commission 

Male nurse. Monroe county hospital 

Male nurse, Oswego coimty hospital 

Marine engineer, department ofpublio works 

Matron. Oswego county sanatorium 

Matron, Long Island school of a^culture, Farmingdale 

Matron, agricultural and industrial school. Industry 

Meatcutter and assistant storekeeper, commissioner of charities and cor- 
rections. Westchester county 

Mechanic, institute for the study of malignant disease 

Medical interne, Albany county almshouse 

Medical interne, Binghamton State hospital 

Medical interne, Brooklyn State hospital 

Medical interne. Central IsUp State hospital 

Medical interne, commissioner of charities and corrections, Erie ootmty. . . 

Medical interne, Clinton prison 

Medical interne, Dannemora prison 

Medical interne, Erie county home and hospital 

Medical interne, Erie county penitentiary 

Medical interne, Hudson River State hospital 

Medical interne, Kinfn Park State hospital 

Medical interne, Manhattan State hospital 

Medical interne, hospital for incipient tuberculosis, Raybrook 

Medical interne, Middletown State hospital 

Medical interne, St. Lawrence State hospital 

Messenger, health officer, port of New York 

Night fireman, Niagara county sanatorium 

Night nurse, Niagara county sanatorium 

Night nurse. Oak Mount sanatorium 

Night nurse. Odell tuberculosis sanatorium 

Night nurse, Oswego county sanatorium 

Night nurse. Rocky Crest sanatorium 

Nurse, Clinton prison 

Nurse, commissioner of charities and corrections, Westchester county. . . . 

Nurse, Craig colony, Sonyea. 

Nurse. Edward Meany sanatorium 

Nurse, Erie county home and hospital 

Nurse, Glenridge sanatorium 

Nurse, Homestead sanatorium . 

Nurse, Jefferson county sanatorium 

Nurse, Lakeview sanatorium 

Nurse, Monroe county tuberculosis sanatorium 

Nurse, Montgomery sanatorium 

Nurse, Niagara county sanatorium 

Nurse, Oak Mount sanatorium 

Nurse, Oneida county hospital 

Nurse. Oswego county sanatorium 

Nurse, Pleasant Valley sanatorium 

Nurse, Rocky Crest sanatorium 

Nurse, Saratoga county sanatorium 

Nurse, soldiers' and sailors' home, Bath 

Nurse, hospital for incipient tuberculosis, Raybrook 

Nurse, hospital for crippled and deformed children. West Haverstraw. . . . 

Nurse, institute for study of malignant disease 

Nurse, Suffolk sanatorium 

Nurse, Summit View hospital 

Nurse, commissioner of cnarities and corrections. Westchester county .... 

Nursery foreman, conservation commission 

Orderly, commissioner of charities and corrections, Erie county 

Orderly, commissioner of charities and corrections, Westchester county. . . 

Orderly, Oneida county hospital 

Painter, Erie county home and hospital 

Painter, health officer, port of New York 

Plumber and steam-fitter, health officer. p>ort of New York 

Practical nurse, Mountain sanatorium, Broome coimty 

Pupil nurse, Erie county hospital 

Physician to Onondaga county Indians, board of supervisors, Onondaga 
county 

Senior interne, commissioner of charities and corrections, Westchester 
county 

Special attendant-stenographer, Manhattan State hospital 

Technical assistant, health department 

Technical assistant, institute tor the study of malignant disease 

Temporary night nurse, Montgomery sanatorium 



1 QuaUfied 


Not 
Qnslified 


3 
1 
6 
6 

3 
2 
2 
2 
3 
1 
1 
1 
1 
3 
1 
5 
1 
1 
3 
2 
1 
1 
1 
2 
4 
1 
5 
5 
1 
7 
2 
7 
9 
2 
3 
5 
9 
8 
2 
2 
1 
2 

10 
1 
1 
7 
1 

11 
4 
7 

17 

1 

1 

1 

2 

I 
•> 

2 

1 

11 

1 

1 
1 
19 
2 
1 




• 


















































































































• •••»•«•* 


« 





Non-Competitive Examinations 689 



NON-coMPETiTivz sxAifiNATiONS, 1918 — Conduded 



KIND OF examination Qualified q,,^^ 



Tmined aUendftnt, Erie county home and hoopital. 
Trained nurse, health officer, port of New York . . . 

Trained nurse. Erie county home and hospital 

Waitress. Pleasant Valley sanatorium 

Watchman, Onondaga county sanatorium 

Total 



NON-COMPETITIVE EXABilNATIONS, 19x8 
Rated by Institution Boards of Examiners 

KIND OF EXAMINATION Qualified 



Batavia, State school for the blind: 

Head laundress 1 

Fireman 1 

Bath, soldiers* and sailors' home: 

Attendant 65 

Musician 2 

Firtfnan 2 

Binghamton State hospital: 

Attendant 381 

Housekeeper 1 

Sbedal attendant 13 

Head cook 3 

Nurse 8 

Fironan 7 

Herdsman 1 

Brookljm State hospital: 

Attendant 167 

Lineman 2 

Carpenter 1 

Stearafitter 2 

P4«e. 1 

&)ccial attendant 21 

Head cook 6 

Fireman 8 

Night watchman 1 

Nurse 2 

Head laundress 1 

Launderer 3 

Housekeeper 2 

Gardener 1 

Buffalo State hospital: 

Attendant 152 

Nurse 1 

Fireman 8 

^^eeial attendant 4 

lAunderer 1 

Medical interne 1 

Housekeeper. 3 

Central Islip State hospital: 

Attendant 133 

Barber 1 

Plumber 1 

Head laundress 1 

Watchman 2 

Launderer 3 



Plasterer. 



•^ 



1 



P*«e 11 

Soecial attendant 16 

Fireman 8 

Nmve 1 



690 Rbp©kt of State Civil Service Commission 



NON-COIIPETITIVE EXAMINATIONS, 1918 — CofUiflUed 



KIND OF EXAMINATION QutliSed 



Dannemora State hospital: 

Attendant 57 

Fireman 1 

Elmira State reformatory: 

Houaekeeper 5 

Fireman 6 

Gowanda State hospital: 

Attendant 101 

Nurwj 2 

Barber 1 

Fireman 1 

Gardener 1 

P«ige 1 

Special attendant 3 

Health officer, port of New York: 

Trained nurse 2 

Hudson River State hospital, Pou^hkeepsic: 

Attendant S3 

Fireman-plumber 1 

Launderer ,. 1 

Fireman ** 

Special attendant 30 

Head cook 1 

Painter ' 

Nurse , 2 

Carpenter 2 

Industry, State agricultural and industrial school: 

Farmer 1 

Iroquois, Thomas Indian school: 

Attendant 5 

Housekeeper 1 

Assistant engineer 1 

Fireman 2 

ICings Park State hospital : 

Attendant 414 

Watchman I 

Nurse '» 

Plumber 1 

Fireman 2^ 

Assistant electrical worker 1 

Farmer 1 

Launderer IT 

Baker 1 

Blacksmith 1 

Page 4 

Head cook 3 

Special attendant 16 

(Jarpenter * 

Meat cutter I 

Letchworth Villago. ThicUs: 

Attendant 29 

Head carpenter 2 

Fireman fi 

Supervisor 1 

Fanner • 1 

Plumber 2 

Dairyman 2 

Chauffeur 4 

Dormitory matron 1 

Manhattan State hospital : 

Attendant 362 

Nurse 3 

Fireman 29 

Plumber 1 

Launderer 13 

Watchman * ' ' ] 1 

Lineman " ' 2 



Non-Competitive Examij^ations 691 



Nox-coiiPETiTiVE EXAMINATIONS, 1918 — Continued 



KIND OF EXAMINATION Qualified 



Manhattan State hoepital: — Continued 

Carpenter 2 

P4«e 6 

ftMcial attendant 10 

Head oook 4 

Painter 1 

Barber 1 

PUot 1 

Matteawan State hoepital: 

Attendant 80 

Launderer 1 

Nurse 1 

Head oook 1 

attendant 2 

in 2 

Tinsmith 1 

Blacksmith 1 

Middletown State hoepital: 

Attendant 208 

Special attendant 14 

Nuree 3 

Watchman 1 

Housekeeper 3 

Launderer 2 

Head oook 1 

Blacksmith 1 

Maaon 1 

Fireman 2 

Monroe county hospital: 

Attendant 4 

Nurse 4 

Orderly 4 

Fireman 1 

Laundryman I 

Laundress 1 

Interne 1 

Monr -e county tuberculoeis sanatorium : 

Attendant 10 

Nurse 14 

Housekeeper • 1 

Launderer 2 

Pastry cook 1 

Montgomery Sanatorium, Amsterdam: 

Nurse 1 

Newark State custodial asylum: 

Attendant 78 

Fireman 15 

Assistant engineer 1 

Oneida county hospital: 

Attendant 9 

Nurse I 

Cook 2 

Onondaga county home and hospital: 

Nurse 7 

Onondaga sanatorium : 

Attendant 9 

Nurse 3 

Watchman 4 

Cook 2 

Oxford, women's relief corps home: 

Attendant 17 

Housekeeper 1 

Cook and baker 1 

Ray Brook, hospital for incipient tuberculosis: 

Fireman 1 



692 Eeport of State Civil Service Commission 



NON-coMPBTiTivz EXAMINATIONS, 1918 — Conduded 



KIND OP EXAMINATION 


Qualified 


Rochester SUte hoepital: 
Atimdftnt 


163 


Supervieor 


1 


Meat outter 


1 


Nune 


10 


Rpmnal attendant 


5 


Ijineman 


1 


T Aunderer 


1 


Fireman 


2 


Rome, State custodial aaylum: 
Attendant 


125 


Caipenter 2 


Painter 1 


Fireman ' 


Nurae 


11 


Anistant mipervieor 


23 


Head cook. T. ..'/.'.'.' 3 




Anistant matron 


15 







Attendant 

Soecial attendant r . . . 


177 

7 


H^HM^ Immdrfm t 


1 


fireman 


7 




1 


Page 


1 


Carpenter 


1 


lAunderer 


4 


Sonyea, Craig colony for epileptics: 


97 


Wftt^rhman , t , . , - - r t . 


3 


Dairyman r , . . , . 


1 


fireman 


16 


Head cook 


1 




1 


Printer 


1 




1 


Apmriial attendant ^ ....,., r 


1 


Syracuse institution for feeble-minded children: 


27 


Farmer 


1 




1 


Housekeeoer 


2 




2 


Shoemaker 


3 




5 


AMtiHtiLnt enirineer ,..,,., r r - r ■, ■, t 


1 




• 2 


Attendant .....,--, r t 


138 




1 


Printer 


1 


Nurse 


3 


fireman ,.,--- - t t 


4 


Special attendant 


2 



West Haverstraw, hospital for crippled and deformed children: 

Nurse (orthopedic) 9 

Shoemaker and brace repairer 1 

Willard State hospital: 

Attendant 

I^lreman 

Head cook 

Nurse , 

Dairyman 



Ward's Island, psychiatric institute: 
Laboratory helper 



Total 3,823 



BUPLOTMBNT TJlirDEB RuLE VIII, SuB. 5 



G93 



o 



CO -rs 



pa 

i 

CO 
CO 

;3 



o 

t 

a; 

2! 



^a to 



CO 



CO 



§^5 § 

•4-1 ,S O -Tl 




oi 

p. 

08 



I 
J 



o 

9 
I 



CO tcH ^H tcH 




CO CO CO lO 



131 



1-3 S.E 




694 Report of State Civil Service Commission 



CO 



CO 



2i 5P 



c« 




a I 



01 

-a 



^H 1-H ^H Q^ 



00 



s s s 



» 



o 



o S 



s 



^ lO 1-H Ci 



l>. ,-H t>. 1-1 1-H Ci O CO 05 « 11 



^t>.i-Ht>.i-ii-HOoeo 



S 3 S 



is 



M m 






x s a « , 






a 

08 



o 



n 

I 

08 






O 



>^ 



SO 
1-1 



e>PQ 



II 




I 



•Is 






O 



e 

o 

C 



1 


Robins 
Smith 




c5 


» 


• 

►-9 


^•iis 


Pi^ 


1 


b^ 




fc: 


»2 O 


tm 


eg 


08 O 


a> 


teo 


K 



& 



2 




>> 

h 



It I 



.s 

> 



08 



OB 

§ 

08 



G 
O 



H 
(J 

O 

o 

o 

p 

CO 

O 



B 
B 
2 



a 

if 



^ 

o 



C3 
Q 



o 

•5: 



a 

a 



I 



Q 



g 
g 

8 
•5: 



Si 



.2 



o 



B 
B 
8 

V 






.2 

B 



000® 




c.^ c.'H cS a c 

**^ *cs * *c *^^ *^ ** 

5. 




1^ 

nils 

"""^ 8,1 
si ® 

a> • o 9 



Empi-oymext Uxdee Rule VIII, Sub. 10 



695 



CO CO CO 









^ CO 



£ 



•^ ''"51S-'2a*2?JS2 8 88-"-- - 






ii 






hi 

£ 

B 





1 

I 

Oh 



I 



3 

d 



o 
h at 



S 
S 



2 § $ S^ 
9 S^pu, d 



5 



u^im til 



o 



o >»s» 



gill 

\ «iiit t 



Sq^?39(S^5Sfi«£s'K S Sfi^SSlS « 






H 



d 

I 



8 



c3 



-I 



d 
S 



«? 



Ii 



0) 






a o ^ J5 






^ d 






:S^.JJjg?&^ 







S 



J 



;S 


Ii 




• S : 


:i 


:.r 


:.g 




;l 


•1 • 




^1; 


;1 


■^i 


• p. 


a . 



if 




696 



Repobt of State Civil Sebvice Commission 



•a 

CQ 



fiu 

08 



8 



iz: 

o 

iM 

00 

> 

CQ 

a 

> 



PS 
H 

iz: 

B 






O 



CO 

So 



888888 

r* r* r* t>. r» r» 



CO 



MS*.-; 



C<^ 



COi-t^'* •H 1-H •H •H »H r» »H '^ C^ CO « »0 »-• »H »H I-* »H »H *-^ CO «-l 



Ci •-• ,-H 1-H •-••-• •-• 





M h &< 

III 

6 a a 



-I 



CV| 



iliiliisiis^li. 



8S 



oa!io'(S' 







«8 







is' 

1^ 



OQ CD 

0) -S^ 












fi^fe-^tf 




O 
hi 

o 



5 

o 

CO 

o 



// 



^ 



: :^ 
a'S. 

w( O O ;2 

to g d 

•• •■ •> •• © 

B 



.2 .S *^ .2 

«d .4 ,d -fl CO 
Q< Q< Ol O4 



R 



: a 

d^ 



l-a 
11 



''J 

^ d 
d-P 



6 






d 
o 



S d d d d d 
d o o o o o 

^ •*irt s^^ •m^ • «4 •«« 

O *" ^ 

§ § s s § s § 

*" d d d d d'g 



d 

Q 



u 



00000 = 

.«d .fd ,«^ ,4^ ^^ B 



B 
B 



•S'S 



888 




I S S ? g g 8 

^ QD n n o) 

*S o o 

^^ (b8 08 08 08 08 
•^^dddddfiv 

^ tf 4 e8 e8 e8 y S 



i'liil 

01 O 0} ^ ""^ 



d 
o 



^3 ^5 «3 _ — *< O 



•S j» j« ^« ©3 

liiill 

" "^ J»d Jrf "^ 







EupLOYMBHT Undbb Buus YUI, Sub. 10 



697 



CO 

So 



s 






33 



S 
Si 









I 



•->l^>-i 









S 

s 

Q 







.a 













s 

0^ 









tf 



W^4 



s 






^ ^ ^ 



ajB^a 










£ 



.2 J5 5M 



6 



6 

O 



•t3 






6 



•s :88 




s>5 



8 



•c 
I 



M d .9 

ill 



sl-lljll 

*» Q, flJ S J3 ST is 



c 

apH 

3.2 



I 



"« 
S! 

^ 






g§-p* 






>.8 






8 9 < ^ 



d 
o 



s 

hi 



1 






d 

•i 



I 



tilltlilllllll 



»ji 



8:i(§<!iiil-"' 



d 

Q 



•^ d 



Pui a 




m, •k •* •k ^ ^ ^ ^ m, ^ 

SSqOwwMQOwQBw 




3i> 

-O nc3 nc3 -O 'O -O -O 'O "« -O is 

.a .a .a .a .a .a .3 .a .3 .as I 





s'l'l'l'lill'lll 




oooooooo 




Bbpobt ok Statb Civil Skbvice Commibsion 





Emplovmist Usdeb Kuli VIII, Sub. 10 


60 


s . 


SsKaSEKgS§gs|sg 


s s 



S||-Sa-tts|lll||-;ii 



S " I J I '^ ' f " I 6 J I I a o 

^. S I S Ij: ^- 1 S I ^: ^ 1 1 1 S 
i s i 1 I i 1 I M i i 1 I I i 



i 






i » i IJ i 1 2 1 ^ ^ I i ^ 
jl |t fijli I 



I I 



Rkpobt of State Civii, Sebvici Commission 



2| 



i i a i 






I a "- z I i « 

1 1 1 1 1 1 1 

X o I « iS J <5 



11 



II 



s i 

I 



1 ^ 



I I I 



J 1 



* E 

I I 



Employmknt Undee RurB VIII, Sdb. 10 701 




1^ 

1 1 






I < 1 1 1 1 3 i 



j •<■ s 1 s 

lllllll 



I ;| ;l ;J :l ;l ;l !! 11 



702 



Report of State Civil Service Commission 



w 



80 Q CI C4 
O^ Oi t^ t^ 



8*^ 8 S S S S 
t^ 9 w r<" t^ 



SCI 




00 



00 -^ ^ 



•g £ 

S I 

S 5 



s s s 



M -^ 



s s s »; s 



mm 






I i 



•I 



5? 



to 00 






9 



o 



is, 
2 

OD 

> 

Q 



OD 



E . 00 






H H 



a 

s 
a 



55 



CO 



do 



I i 

.^ i 






I 2 






eo 
»o 

CI 




H 
1-9 

K 

tf 
U 
Q 

OD 

Ed 

in 
O 

Or 
?) 



c 
o 

z 

< 

o 

p 

GQ 

o 






;a 






M % 



fe 



N 

OQ 



•2 I 



a 
Si 
4 



Si 

I 















.a 

O 

.59 

9 



o 

6 

M 



o 



s 2 



■s 



a 

OQ 



e 
S3 > S 



I 



II 



o 






Si 






Q 



B 
8 

8 

a 



Q 



O 

o 

8 






M 



a 
o 



B 

o 

8 

'E 

• * « 



d 

Q 



o 

8 

•5: 



.A 






1 



d 
o 



8 

hi 
Si 



3 
p. 



1 



d 

Q 



8 

•E 

V 

3 

a 



§ 



E 
E 

8 



S 



3 







s 

8 



d 

Q 



a 

8 



8 


:8 


g 


•.•5: 


S 


• 





• V 






^ 


:jd 


§. 


■i 






a 
.S 



8 

8 
E 






Employment Usdeb Rule Vlir, Sub, 10 703 



s 



II 



If 



II 



" o " '^ ^ I I 

"' z z *: s" « ! 

iii| ill 

S a « § ■§ 5 I 
S '! = - I S I 

S f S S g S » 
S g a S s 9 § 



'lis 

8 I * 5 

OQ n ^ K 



nil; 

t il ^ I 
I -^ K <» £ 

S i I S 3 



i 

£ 

I ■= 
■ J 
# 4 



i 5 



<■ I a « -^ f I 

^ 1 1 .^ 1 11 

X s -S (s a £ (S 



t -t -t 'I -1 -E :| -E :| -t -t -t -g -I :| -I :| :| 
<e -.•3 :<c :ia :<e .•s :<d :ta :ia :ic :<i: :ie ;« :<c :<o ,•3 ;ia ^iS 



704 



Kepobt of State Civil Sebviob Commission 




Employment Under Rule VIII, Sub. 10 



705 



9 w o> o> o> oS t^ 



N 

r^ 






c^ 



c< 




r-l iO O l^ 
f-4 C) rH rH 







JJ 


ii 






a 


a 


^ 


1 


s 


s 


p. 


^ 


J? 


<J 


Q 


p 



1.^ M t^ U *^ ^ 

^ I I J ££^ 

gjs a a a a ax 

® J5 o-g o S-g o o tS "g o« 3 




1 « 






to 

■3 










I 

I 

I 

ft 



CO 






^ 



i 



S H 



s 






o 






I 

it 

o 



e 
d 

a 



s ^ 




g e| 



4 



P^^bs^I^iSjs 




d 

Q 










I 



a 
o 



B 
E 

8 

> 






d 

GO 






^ «« a^ 

aa a 

3 3 3 
333 g 



d d d d d 
o o Q o Q 



I 



d 

Q 



E 

E 

8 




„ a a a a I 

888888 



*C *C 'C 'C 'C *c 
»4i3 »4i3 mis ki£ ^13 ^^ 

<5 'S 'Ii 'H '"^ 'H "^ '^ '"^ '^ 'rl '^ 

d-d d-o d-d d-o d-d g-o 



3 :3 - :j 




CO 8D OD 

J3MM 
Oi« O* Q« 




d 



E 
E 

8 
8 






g. 



Wi ki M ki 

Q O O Q 

• ^ apirt vpi* •*■ 



•-9 "-a •-»•-» 



M M »4 M M lU 

Q O Q O O O 

• pad vw^ •*a4 'M^ a*^ a^^ 




706 Repoet of State Civil Sbetice Commission 



1 1 ±- 4 4 4 






S I 



i I ^ I if 

1 1 1 1 1 » 

n 8 8 " » s" 

s « « S it 

ts 5 - . <e a ? 

_ g -g ^ -a S * 

i i I I a : ? 

^ S a a I § J 

P, ft. ^ U fS 



s g 



a s = 3 J 



3 I 



1 I 



I s 



I I II I 



S s o 

i i ^ 

^ E S 



Employment Under Rule VIII, Sub. 10 707 



s SI 



I .8 .s 
i % % ^ 

O O O K 



I I 



11 



I ^ s 



lU 



I ■§ I 



Is 



i '^ i 






I I 



J s 



I 5 36 ^ l§ ^ 

"= - >= "^ S 3 s S 



§ i 
i I 



J 

1 1 - 

* <■ I 

I 1 i 

S S i 



J -s 



Ji 



S I 5 

III 



tS :<3 :m ;<a :<H :<§ :M :J itS :J itS [s [£ [& [s Jtl 



ll 



? State Civil Seevick Commission 



s, % 



X 1 t' 

I I I 

1 I t 

iS a I 

» s ; 

^ s 2 



Employment Under Rcj-b viii, Sub. 10 



709 



SB 

O 



I 



8*^ 8 S 
o o 



eo 






S 

6 



t 










rr" N 00 






a 2 






i 

o 



CO 




00 00 Ud 




I 



5" 

5 

M 

In 

s ^ 







2 <i^^ 

^ fcQO 

*-< CO »-t 



• 



I 



o 



08 

d 



a 
2 



r pQ 



CO 



d 
3 



O 
?5 



OD 

d 

i 

S3 

a 



ffl 2 



O 

eS 

o 



d 



O 

d 

c3 ^^. 



d • 

^; 

.3 : 

1^ 





e 
d 



< 



8 



£ 

d 
*d 

J3 



d 

S 
d 






C9 



i -I 



d 

I 

d 

a 

d 
P4 



d 



-a 

o 



I 






Jg 
08 

.d 
O 




I 



I 

8 

B 

E 

8 

•5: 



1 



4J 





.1 


4^ 

1 ; 


• d 


■ d 


d • 


• c 


• 




•1 




1 






• E 




a 


E 




: E 




'6 


E 




:8 


•8 


8 : 


:8 


-S 


8 • 


:S 


•5 

1 


•g ': 


:S 


S : 


• 


> 


V 


•;=: 


» 




i-fi : 


jO 


^ • 


s 


d ■ 


d 


. Q* . 


a . 


a : 








. »4 . 


li* 


(I 


•JJ 




-S ■ 


^ 





8 

o 



8 

§'g 

00 

£3 

d d 



J3 

d 
a 



^^ d ^ 

d d ^.2 
3 d .-« C 
O ^5 a; M 



« o 



o 
o 

8 

l« 



d 
a 

u 

J 

bj) : bt 
^— '*- — *c 

•C T3 -C TJ 

■*3 ^ "" 



.2 

B 
8 

I 



d 

a 



d 

d 4a 
^ .2 

S.2 



-4 PW^ '^^ ««4 '^ OT^ 



t4 

^1 



^-g ^-g ^-g ^-g 



5"^ 



.2 

a 

o 
o 

.1 



d 

I 

to 
d ♦> 

si 

V 

"Scd 



I 

.2 

g 

B 

o 

8 

> 

CO 



J3 

3 

a 

J 

rj ^ 
^ .2 

o .2 



a 

o 

8 

CO 



J3 

d 
a 

u 

.1 

^« •. 

^ .2 

■3 1 



I 

.2 

a 
a 

o 

8 

a) 

CO 

o 

d 
a 



I 

d 



03 

a 
a 

o 

8 

Si 



d 
a 

i« 
8 

.a 

d 



O C V o 

L^ ^ ■ 1. 

S.2 S.2 



00 

"b 
a 

o 

8 
V 

u 



•§ 

d. 



.2 

a 
a 
8 

8 
8 

o 

i§ 

d 



i 

d ^ d 

I— *C _« 

u .2 o 

■^ *> "** 
w w w 

a5<d a? 



g-g ^-n g-e |-d 
»^ •"» "-» •-» 



(i* »« ft4 d 

0005 



2§ 



2 0.2 0.2 C.2 0.2 o 

doodaoHoodaaCoo 
"» *-» *-» *-» "^ 



Li ^ It r« fc< r1 

i. '* 2 .'^ .2 o 

•J CO £2 « S ao 

d d d 

>^ •-* •-> 



»- d ^ d 
o ?: o § 

"" SM ■"* .S 

d 'oD d 'eo 

d d 

Hj 1-3 



Repobt of State Civii. Sbbvice Commission 



Employment Undeb Rule viii, Sub. 10 



711 




ooo 

S(NOO 




OOO ceo Q«C 
Q0Q01(N(NO(M^ 
TT O: t>- l>- l>- O I'. I'. 







»o 



^•— ti— i»^t««»»H I— (r-i 



O ''f to C^ -^ CO — I 



I— ( Oi lO M^ CO ^ rH 



f-ir^ooocjc^woc^ 

1— 1 I— I f-1 I— ( CO c^ 



«>4 









e3 



a 



B 






>4 

B^ 
S3 



OQ 



^ h Ih »^ 

q5 S S; 4* 

fi s fi a 



M C/j O; (< 



a 

> 



h4 



V 




K *~9 3h Z'. ^ HH 



U.^U 



.2 

a 
a 
8 

> 



.2 

a 
a 

o 

8 

t 



o 

r, 

e3 




u o 

08 08 
Ki b« »N 

«w c* c* 
« o a> 

bC bC bO 

.2 JJ ^ 
'o'q'o 

O O O p 

CCaOD § 

d d c: S 









6 s;!! 



a o 

o >» 



i^^ 



o o V 

♦* -♦* -♦a 

03 08 eS 

> ^ E( 

TS T3 tJ 

d d d 

rt o8 c8 

Wi l« ki 



> 
d 

d d ^ 



cJ d.2 



d 
o 

IS 



d 

3 

JO 

'53d 
o 



o 
o 

o 



>> >^ >> >> >» 

■♦J •♦J -iJ ■•-» ■♦* 

d d d d d 

d d 3 d 3 

o o o o o 

u u u w u 



. d 



tc. 

3 

2 



d d d 
ooo 



en 

CO 



d d 
o o 



< bc.2.2.o.2.2 

a a 
a a 
88 

o o 
o o 



a a 
a a 

-, o o 



g C r- «- (- ^ 
85 

«>4 



- rt d g o 






o 

o 

,d 

d 
o 

lu 
08 



a 
o 

d 
o 



ooo 
ooo 



O O 

d o •^ » 

5? 1" «^ =0 
-d -P 'T -TJ 



1^ l« u 

OOO 

^ ^ ^ 

O 0) o 

•^ *s »« 

O 0) 0) 

d d d 

lU »N b 

-*» •«J ■«-> 

OS 63 c9 

U U 1-^ 

■^ -^ -^ 

30 W CD 



d 
o 



5.2 :S 



l-i lU lU ki k< 

O Q; 0) O V 

bt. tc tr. tc tc. 

d d d d d 

^ ^ I S^ 8^ 

so QCi OS CO CD 

V o 0/ a> 0) o 



& 

d 



b t4 ^ 

a; & v 
tr bf Lr 

d d d 

0)0 
* V3 * 

SO oc oi 

OOO) 



u kl kl 

cot; 

M f^r bc 
d d d 

OOP 

m w cr 
V) CO en 

ooo 



08 _ _ _ _ 




08 
O 

>» d d d d d d 

^333333 

00 CO OO 00 

• ^« *^m v*^ •*4 

tc to bC bC 

Wi »N k4 M 

o o o o 

u^ *f* **•* **i« 

o o o <» 

00 CD 00 CO 

bQ bO bO bO 
d d d d 

• ^m •m^ c^iO C^M 

d d d d 

• ^irt SpHri a^i* c^ 

s s s S 

^ >4 » ^ 

S^ 8 $" $ $^ 8 
;z; J?; 5? ;? ;? 55 ^ 



712 



Refobt of State Civil Service Commissioh 















|>»QC^0000C000»P*^»H»^Oii-i00'-^»Hf-sCOr-n-Hf-«T-t'^Q'-^>O»-<00^^CI 




<<j<:<cS<o*^< 



.s 



o 

M 

02 

M 

M 

g 

OD 
M 

s 

H 

M 
H 



OD 



i 










l|l^lltl-i 



d 



« o 






.fl8 q8 c8 oS 

<C ic (c to 

:3 9 p 

PQpQpqpQ 

■» a^ ■» OT 

.^ .«» .«j> •*» 

up 

■t 09 CD QB 

• SSI'S -^ *^ < 



©^ 








0Q0QSn 



I 



s 



00-2 o 
d «^ 

SSwS 






d 

s 



QQ 



d 
3 






14 S 



S.7J 



•J 

o.b d 



tf« 



oc3w 



o 



^1 




^ d S' ^•^ S 



£5 



w I- 



o 



J 



d d d d 

llll 
p d d d 



CD 00 CO QQ 00 

Wi i« h« M 

.2.5.2.2 
\t^ ...I .»4 .»4 

'o'q'o'o 

o o 5 o 

.d j3Xua 

o o o u 

00 (D QQ CO 

&« bC &« bC 

d d d d 

• 1-4 ••M 'ffM '^ 

d d d d 

o8 oQ c6 gS 




C ki 1^ 

0.2.2 

ooo 

•s ^ ^ 

o o o S 

00 00 QQ /%> 



? fl8 r« d 
O) O d -d 

g" g^ 3 S d 

^S bd rt 
*5.'ft a> o d 



o 
o 

o 



^^S^^SS 



d. 

00 

o 
d 



a> Qj .- 



888S 

«*. taM taM d 



«Si§ 



•> 08 



d dvr«:r d 



o3 .>» 



00 00 -" ^« ." c9 

d d d;g 

o) a> O) ^ 
e S S -2 



o o 



o o 

bC bO e^ oS e8 
•'; •'^ -ti •** "♦^ 

?s Co en QQ en 



&d, p. o, o, o. 
00 CD 00 ao 00 
Q Q O O O O 

T3 '^ TS "O *T3 "O d 

d d d d d d -^ 

08 «8 e8 «8 e8 e8 g 

gS S S SS 2•- 
u3.d.d.e^.d ^ d g 
^^ >» >» >* >^«s-i g 

3 ^ i g I dgj^ 



c 





oo ?? s? s 

^ - c3 rt 03 

g g 8 £ 8 

d d £ £ £ 



^ § s^ ^ M 

C L, k< ^ M k. 

d d d d d 9 



•Si 

oo 



HH[aq»l23H|,-ad 



OOOOOOPU^fr* 



Employment Under Rule vui, Sub. 10 



713 



ss^sssssssssssssssssssssssssssssssss 

•^<^^<^5^<^<^^^coeoeoeoeoeoeoeococoeocoeoeoeoeococoeocoeoeocoeocococo 



^ 



gQOOSCO^COt>-OOU3^iOU3QOCQ^^^C^OO^^OS^Q^C^OO»OCOCO»-<OOb«C^iO 



.a 



a 



Id .4 











>»>» 






J^ * to 



o 



I 






CO 



?; 



zSSSzSg 






^ CO t* ^ 



^ o » 

ScSq 
St I 



N 

00 '^ 

''^ 'd "^ 

^ S O) 

^ o 



o 



g 

d 

> 



V 



Esi 



k« V c! 



00 

o 

.s 

< ^ 
• v« 00 






d ^ 



> 



d 

S)d 
- S^ g 

(o -^ 0} .d 



O '2 9 »^ 



:5j 



o 
«*§ • 

T*^ d 
^ a 5s S 







d d 



C C C C C C C C C C C C C C C C C C £ 'I -c C c -g c -c •£ 

."S 1 .22 .a .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 5 •'S .S .2 .2 f ' 



ddddddddd 
22922. 2 22® 

• ^i4 a^^ •P' *^ t^ v^M s^i* 9m^ •m* ** 

■ - - ^ s a " 
a a 



.^ ^2 *^T *^ '^ .^ .^^ .^ .^^ .^ .^ .^ .^ .^M .^4 .^ .^ .^4 .^^ .^ .^ .^ .^ .^ .^ 

"73 'O 73 "O TS'T^'OT^tJ'O'w'O'OT^'O'w'w "O 'O 'w "O "O 73 "O "w 



.4^ >» 4^ .4^ -fA 4^ 4^ 



-6 



■•»■»»-♦» 



d 
o 



d 
o 



d d d 
o o o 



d 
o 



d 
o 




(Ctdtdtd(dtd(d(d(dtd(d(d(d(d(a«d(d(a(a(d(d(d(d(d^ 

d" d" d"* d d" d* d" d" d" d* d" d" d" d" d" 

OOOQOOOOOOOOOOO 
S *^ *!2 * *C\ *St *^ *^ *^ * *S! *^^ *^ *^ *f^ 

928 9 9]S2SS9 

a i'l'i'E'S a a a a'i 
aaaaaaaaaaaaaa 

S88S88888888888 



S2 2 9 S 
00 GO n 00 

a'a'g a'i 
a a a 

88 



a 
8 



o 



d d d d 
o o o o 

• m^ •mm .w4 .*^ 

"> CO 3 9 

SOO OQ 00 

a S a 
a a a 

888 





88S888 



QQo8SI^8888888888888S88888S8$S8 



QQ 00 00 CQ OQ 00 

d d d 3 3 3 

^O ^3 ^3 ^3 ^3 *0 

d d d d d d 



.3.3 

03 X OO 

n3 '^ "^3 
d d d 



■^ *^ ^2 ^^ ^2 *^ *^ ^2 *^ *^ «^ '■^ '^ "^ •^ •^ '^ •^ •pq •^ '^ •■^ •^ •^ •^ •pi^ a^ 

333333333333333333333333333 



S)S)g^8) 



bObObCbCbCbCbOboSfibCbCbcSoMhD 

^B o8 o8o8o8fl868o8a8o8o8o8o8o8a8fl8o8o8o8.w-^-..w-..^..w'^.^'^.^'^'^.«.v.«.« 



bQbObObObObObOhDSoSobOMbObOboSDSo 
j384o8o8o8o8o8o8o8o8o8oBo8o8fl8o8o8 



714 



Report of State Civil Sekvice Commission 



JS 

CO 






COCOCOCOCOCOCOCOCOCOC00500050000'-^0^^ 




a 

o a 

efi '"^ 

c8 



OOcOiC^CO'^OOgOMOC^h«Q»-i»COCOOOCOOoOQCOCOi-iC^O*-<^ 



b- 



00 



2 t 



•X5 

o 



s 

I 
5 



55 

o 

1-4 

00 

k 
Q 

n 

p 

00 






0) 

a 



OD 

g 
s 



b>'>?S) 



a 



08 






s g| g g js a 

•-9 »-3 C/J OJ O OJ C/^ "-s O C#- *^ 0- 



O 



00 . 



5 : 

n . 
1^- 



d 



00 

.a « 

CM O 






-8 



c^ 






O o 

2 *^ 



00 

C5 Ci 



08 

PL4 



00 



00 



-C-f CO 
O CM CO 

!•: "^ »c 

^^ »-H »-H 



o 



2 -^ • 

^ > 0) 

£ =5 S 
-5 -^ t^ 

OQ gj OQ 

= ^ . 

CM QCi 
rc CC C^J ► 



00 

.a 
o 

PL, 



00 



«l 



0) V 






a 
o 
a 

;2; 



08 
08 



a 
>^ 

33 
o 

2 



w s flj 






d 
>» 

PQ 

9 

d 

08 

I . 

eoK»-i 



d 

!S 
o 

2 



■ CO 



00 



2 

as 

£8£ScS 



SJ • '/- 

- a^ 

.9 2 
I* d 



M 5 



K 



55 fc- d 2 05:2 
•2 a* =3 3 d r; 

3 i» <-< •"" !_^ '^ 



n CO 
3 3 



3 

-d 



02 

CO 

3 

x: 



N 






3 3 

1-3 1-5 



083; 



53 3 

^- d 

3:d 



o 

d3S 

§^ 



d 

•^35 



bO 






II 



-<s 



g 



N 



<< i-H 00 H 



CD d 

3 1^ 

O U 



« -.3 



00 
0) 

B 



^H<&^ 



• ^^ 8? ^ 

Oi ^-« •TJ "d 

2-*r ^ * d . 



fc-c 



d 

P=5 00 

00 t: 



^8 



fx 08 

00 



f3 fc .^ 

4k< ■-*'' 



£S 




Employment Under Rule viii, Sub. 10 



715 









SS8q8S88888S8888 



fH v-4 f-4 N 



iQ^ ^H ^ lo •-< oa «o 00 •-< ^ 



££ £ 

BB B 
o g* o 



f-HO00^CN10»<0QC000C0C0(;0iCC0C0QQC004C0<0C0 




Is 



J 

6 



II 



O 

d 

00 






^ Ok 



o 3 






<2iS 



.2 '2111 



u 

^5 



i 



4 



IS 



a • 

e8 to 

Is 



pq 






08 



S » 8 • *r 



00 



tS 8 



00S*g;3J<5 

v^ ,-4 0q _i u5 




GQ 






•4 



51 



S) 

H 

i 



OQ 



d 



s ■ 



I 



I 










3 



5 

a 






» 

3 






0) S efi 1^ 

nil 






Is 





s s ^ ^ 

0000 
'S *s *s * 

.|.2.S.S 

BBBB 
BBBB 



d 
o 

'I 
6 
g 

8 



"to "g »J* tT f-T vT fcT wT fcT vT 




dddddddddddd 

OOOOQOOOOOQ 

.3 .9 .S .2 .9 .9 .9 .9 .9 .9 .9 

BBBBBBBBBBB 
BBBBBBBBBBB 
888888888888 

*"■< P"^ ^"^ ^b4 *ia4 ^1^ ^Btf ^M^ ^Btf ^1^ ^" 

.g .3 .g .3 .3 is .g .a .a ^ .j 
.9.s.s.s.a.fi.s.s.a.s.s.s 




tJ '3 o o o' o o' o' o" o 
>4g desaadddd 

3QGQGQGQaQQ0GQaQCQaQ 



b ^ ^ ^ 

^^^^ 

a a a a 

0000 
d d d d 



u 

O 

d 



OOOOQOOOOOQO 

dddddddddddd 



716 



Repoht of State Civil Service Commission 



I 



O 
00 



n 



> 



oo 
H 

o 



S8888SS 

tN. t>. c5 r^ t» t» t» 



«OQ CO 

ooi>.25 -^ 






as 



00 



»-l 1-t d .-«.-« .-« C^ CI 1-t f-< »H 



»4 M 

ilillllll 



M •« 






'O "O *0 T3 
d d d - 



o 

3 

a 

«8 



Q C8 l-H HH M 



to OB 00 






llllll 







iiiil 



►SooSo^^ 










eg 



ao .T ^, 

\3 d^ « 



d d 



^ „2 



i Pe!!- 




.d 
-S " 

S jB "a -s ^ o 
5 2 >»o 9 3 d 




// 



U 

o 

O 

P 

to 
o 

P-. 



sssss. 

•^ -^w •^^ •^^ -^rf 



d d d d d 

o c o o o 

CC W rfi Tf5 55 

CO QQ GO CQ 30 

d d d d d 

M tert »ia ^ tert 

g g g a g 

O o n o o 

v u o u o 



d d d 

o o o 

a g g 

g g g 

ft o o 

u u o 



a a a 

00 CO 00 

O o O 

sss 




tn fc< fc< 

■«J >* ■*» 

D S S 

T^ "C Tl 

.S.S.S 



.^ .t^ i3 a .^ 

QQ op n OD OQ 

3 3 3 d d 

TJ "C3 T^ '^ "O 

d d c: d d 



-5^ d d 

^ "S "S 

5f d^ 



c^ d, „ ^, 

CO « d $ 
O O d j3 

MM 2^ 

CCCQ.d d 
J ^-3 g 

oS C8 *— 3 Q« 
^ ^ S 09 



»i< ki »i« »i« 

OJ o o a 

O. O. Q, Q< 

9) 93 4 oS 

bi C »« H 

be bC bcH 

o o o o 

d d d d 



O.Cl.C4CuQ<Q<d.Q< 
ri4a3o8c3e3c9c3 

So ND H fcC R) K •■0 R 

OOOOOOOO 

dddddddd 



Wl M »4 

0< O* Qi 



•« •« ^ 

o o^ 

OOO 




fi«O.C3uC3uCitCl«0« .„ 

d&§)&)S;§)5i§)3&) 
|§§§SS|S| 



. o . 


o : 


:i : 


i : 


:8 : 


S : 


:.-§ : 


•* • 


• o. • 


e. - 


:§ ': 


8 : 


:-S : 


% ■. 


:| : 


I: 


ili 


li 


;l 


ili 


il 


il: 




Employment Under Rule viii, Sub. 10 



717 




88S 



S 8 S 




iiii 



SSSSc^i c^o 





OO '^OCO«-Hf-H ^ ,-4 <^ 



J5S'"'^?SS'-"^'^22222aS5:;'^'^a 



NrH 



s ij s 9 § i 

o & o o ^ ^ 



»4 



3 



»4 

U3 



•4 

J! 

a 






M l-i Ih Ih M 



U3 _ s -a^ J£ .£ .S ^ .S -§ >§ 4 

o^?^?<:cgSo<5SoooooSSN3<: 




I 






0.2 



-gcS 



W 08 P op 






»4 

J 



rt o 





o «5 5;oo 0^0^,3? c5;5i>^co ^S5^3?5 



8 



il I 



_^ a 
© '^ ^ 

2^ 08^ JJ 



a 
o 



08 



.3 




"iiS 



c 

c8 



»4 

Si. 

o 



:§ 









J 



I 



I 

O Q O o 

P cr cr cr q 

M ^ u u **^ 



a :;3 




l<a3£M 




' - »« ki ki Wi M 

» o o u o 

0808080808 
d} 0} 0} (D 0) 

HHHHH 





^ 

.*> 


^ : 


tn 


55 


^ . 


• 3 






•cc 


Ui 


••I 







• 


• u 


t 


t : 


: 1 


a 


& : 




■^ 

M 




:^ 


8 


8 : 


• -tJ 


£ 


m : 




■ 


. 


•«^ 






: 


••s 


-B : 


• -♦» 


'08 


"3 • 


■ d 


' 0) 


0) 


:•« 


:jd 


'•^ : 


• d 


•ik 


■» • 


■■S 

■■■§ 


■^ 


■s ■ 


£ 


s • 


■K 


S. 


S. : 


: 3 





: 


> ^ 











« 


* > 


•>cs 


d . 



^3 J 

a a c 

CQ OQ 00 

gCCCCCG 



dddddddddd 

OOOOOQOQOg 




• •^ w*^ "^ •^ •^m tm^ *^ ^5 ^S ^5 ^5 

I i I I I I |^^4S J 

8S **4 **4 «*-< «M 
O r> rt rt « 



88 



o o 



0000 



a 




PBMM P>*" ^^^ ^^^ ^^W ^M^ ^^" ^^^ ^^" fc^ fc^ fc^ k^ 

.2 .a .3 .3 .S .S2 .3 .23 .3 b b b b 
-^ -§ 1 1 -§ ^ I -§ 5 5 J J 3 

.B.B.B.B.B.B.B3.B UUUU 

.2 .a .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 



8Q00O0000r)00OO000Or)0 



iiiSSSl 



h kl 






d "S *- 
5 cv, o 



5^ 



^ l; ^ g ^ g g g g g g g ^ ^ g ^ ^ g g g 

&&&Q,0,a.&0.Q.0,0.O«aiC.O,0.C.O«Q.Qi 

>» >> >% >» >» >» >> >»>>>» >»>»>»>>>»>>>>>»>>>» 



718 



Repobt of State Civil Sebvice Commission 







oooooo 
SooSoS 



s 



I 




COf-< 



f-«CO 



O CO CI CO ^ v-H O) t^ O) Oft CO O O) f-H Oft iQ iH 




m u 



V Q) ^ 



'-9'-9»-S 



h Id Id b 

So 






•4 

I 






mm 



i 



o 

i 

n 

P 

CD 



3 

S 

H 

O 



i 

s 

s 

SI 




3U _Q . . 



CsiPQnciPQ 




28 

CO "^ 






o^sagsasj^ 



CO 

6 





n 



,£3 



^55.2 






m.S mS ao^^ 




l.^lll 



o 



.9 
a 
a 

6 

cS 

d 
o 



H 
U 

h 

o 

Q 

< 

O 

P 

OQ 

o 



II 



««p^ t^4 ««>^ «*M <4>4 4*4 *^4 «*M «,^ «*^ «*M 

ooooooooooo 

ee2££eeee£e 

UVOOUOOOOUC) 
oidQaadQnaiaQaDSwQQ 



ki I* Wi ^ 

O O O CD 

^ ^ tH d 



.2 .? ."S ."§ ."S .2 ."S .3 % % .2 

Q,04UiQ<O.Q<0<0<Q,D«P.O. 



■t 



o 



o 
o 



88S8 



o 



o 



o 



Wi u 



ii ^ i^ ii ^ ^ 4S ^ ^ -2 ^ ^ 
fi«P«0<p<0<p«p«p<0<04 




ki M wi r 

^^ ^*^ ^"^ m-\ 

o o o 

I ^ 

O o o P 






^ 



Tkansfees 



719 






B 



00 00 00 00 00 00 00 00 OC 00 00 00 00 00 00 00 00 00 00 « 00 00 000000000000 

""^ ""^ »-^ •^ ^H 1—1 f-^ r^ 1—^ 1—1 f-^ 1— 4 F— t F—t 1-^ »— t 1— i ^H 1-^ I— ^ f^ 1— 4 »— t »— t 1-^ »— t t— < »-^ 



iC-i CO O »-t 00 «-< 









1— I iC »-^ »o O l>» 



CO 
CO 



8 
o 

§ 

o 



(2 







c 

8 

DO 

to 



03 

pq 



CD 



-2 
s 



a 
o 



QQ 



o o a 

Sb d 



T3 9, 



d 0; Q 
O C5 w, « 






8^ 8 ^^o 

fc; '^- 

3 O 

OCX 



> ® « v^ 

^ a o .^ 



• -- c8 c3 
O O 



" s a § 



^ _* _^ a, 



s-§ 









s. 






CQ ."S -5 § 
. r »- S .r 

S 3 « 



d 
3 
o 

Co ' ' 
6 j^ o . 

'5 

d OQ . 

0-0 

31.1 



S8 



ir.-sS 



03 

3 



fy-j 






2-^ d-o::3.w Ob' 






a> 
f-i 
u 

^ . 

S 9, 
- c 

•r* 3 

^ ftd 
CO o O 

e d I 
-s8 

o 2-Z 

• «^ ^ «^ 

« — .3 

S 2 
o « d 

00 



.20 



4) 



1-1 d 



d 
3 






3 O 



d-Si 
• -. o 

d i« 

c3 O 



-I 



Ji> 



^ ki 

« O C3 



►^ ^ O ^ K "^ ^ ^ O P4 



3 S ««M 
O. ,► O 

2 2-**! 
2 d h 

2 o « 



as ^ 
-Is 

^ 05 08 
5*C I. 

^ 00 jg 

23 3 

d **< •— ^ 

•a o o 

§^| 
^- -^ g 




u 

d 
.2 9? « d 3 

o o 5 »3« 



.3 ►- 



u 



d 

c8 



3 



" a Ete o 

•^ o 2 d -** 
o v 



O C3 

.2 d 



,§.2 

I* 

2 2-^ 
d d h 



1,3.2 



■a S^-s s . J^ 

,d;2J? g S d 



0) 

lu d sQ eS 



CO S 






C3 



P:: 



Sdl^^fi 

odd 



O 



o 



4 



05 '2 O 



&- 



o c n d w. -^ 



§§ 

M hi ki h 

pqpQpQCQ 









d d 
15 "o 



d 






2 



H^^^^^W 



M 
p o 



^ 2,d 






.^3= d 



OS Co c8 eS O Q 

ooouoo 



cS 



a> ^ ^ 3 ?> 



»- »- 3 o 

o 



) »i« kK ? 



720 



Report of State Civil Service Commission 




•45 

<5 



OD 

% 



09 

SI 



I 



QOQOQOQOQOQOOOOOQOOOQOQOQOQOQOQOQOQOQOXQOOOXOOXXXQOQC 



•_ ^ N't fi <•> *" 

^ "^ 08 ^ 08 
4*4 '^3 ^ 'S ^ ..« 

l.t-s-1-si 

In C ki ki •« C 

« » 0) o> V 1: 

.£3 >.C.CX S 

; 0**2 o, a a S. 

S*^ 2 2 2 cT 

a ki d a e B, 

CO O X c» CQ C.4 




UJ 






3;^ 






^^ i^ n r^ 'v^ "^^ 



gCs^k^.S -o8bfHt^ 



d*^^ bu r "^T \*/ Q) ^ ^ 4 



a ex 






a 

3=3 






u 



Q O 58 § O ^ 
:Z3 Q C C C « 

OOOOOtt 



d 



08 



'9 *^ 



- 2 -; -3 




Tbansfebs 



721 



X 0000X0000 00 ooxooooooooxooooooooxooxooooooooooxxxxoooo 
O) 0)00)0)0 o ooooooooooooooooooooooooo 

f-1 C^ »-^ »-^ ^ *-4 *-4 f-< *-4 C<l »-< f-< »-< 



.9 







&^ 



>»^> 












I « 

^ z c^ 

«8 v:s 



5'g 









o 



o,o 5 <=> d 
•ojlfife 

e fe 8 & S) fi 

3 c e -S 






OQ 

I 

o 



s 



OQ 



■% 

d 

c8 



d 
d 

1 

c8 



O 

M 

00 

C 

a 

as 



GO 



«<-« o 





CO •« o 

o >^ d 

.^ £ d o 
fe C p ^« ^ 
tc> d I 8 

Ci» a, $S 

03 eS O 
O O O g 

'S c: d § 






^i 



e§8 

<5**^-2 fl E > "^ 





i 

o a 



^ "** .^ 00 •*5 



o 

I 

-its 



0)0 



o ^-^ 



i- 



d t- 



.^3 

; 3 

c 



0) ««>« 

s z 

e! d 

a o 

-§'1 

■5 8 

O^ 

d Qj 

^5 



B 
B 

8 

u 



" 5 o B o8 -0«a 

o - ;§ S.*o ^ "S 

8.2 « 9 fl >»§ 
•s a S 5 g « a 

£.2+3.^ d P"t* 

8i^2| 

s:a s§ Is 

P.P. 0$ a a « 



J«3 8 
g d" 
6 



d5 



^1 



~ »- 



11 
o o 
d d 

^^ 



2 

'd 

d 

•-9 



ofl' 08' g 



§ 



o a 
d « 






I '^ " 09 *^ 

qqOOO 






h 05 
03 

52 



d 



d 
■^ rt d 



ca 

I* 






ffi 



00 on 

d d 



03 
■♦* 

-fa 

c8 
O 

c 

08 



rs »^ , CO a 

cS C IT' » > >-* 

C c8 ^*-^ ^ 

^ [^ >> rt ^ 

^Uh --) d o 
•"I - <i> 2 a 

^■" p— • d E o 
9 S d aJ r 

C; 0) QJ .7 .d 
^ HH W KH HH 



00 






43 W ^-<1 



C3 ...• 



1 1 S ? s 



a^^ gas 

r oS V o u o 



I „- >^ >^ rt 

seJsx 

O u o8 08 08 




722 



Report of State Civil Service Commission 




00 00 00 00 00 00 00 

»-^ ^H »-H 1— 4 »-^ »-^ ^H 

O O) O) Od o o o 



00 00 00 00 00 00 

»-^ »-^ r^ ^H r^ ^H 

O) Od Od o o o 



OOQOOOQOOOQOQOOOOOOOOOXXX 

^S ^H F^ ^S »^ ^^ ^^ 1-^ ^S i-^ ^H »-* ^^ ^* 

Od O Od Oi Od O Cd Od O O) o^ o o o 



^H »-4 00 ^H »— t ^H 



gCOlj*-4C^^O CO CO lO C^ 00 »-^ « »-• 50 Q 1-H 1-1 »C .H 






c2 IS Jz; »-3 <J "-a 



Oj OJ "-» < t^ 









*« 

-s 

s 



(S 



CO 

■< 



o 
a 

eS 

a 
o 



00 

o 



8 



8' 






00 



§ 8 ^ 

S ^ o 



8' 

00 fc- ^ 



file 



© o_5 



8 o 



' C 5 rt 

^ aS 8 
I28S 

I o^ o 



«j.£J 



- to ju ,^ b ^ 






> o 






ccO'-jE-'Hai 



.23-0 - 

•p 2 2 3 2 fe 
§E «b ho ~ Ed 2J 

4} g o^ o.a 

Q, M B Im C] to 




fl <a * -2^ 

•illl 



8 o S g'?:S 8 



CQ 



•g<g£j 



O 80 

_ -5: .2 

" Q fl 5^.2 "g 



1^ S 8 



.280°°* 



0) o 

cS g 
5 



•S6i 



.t* J3»^ 



—i 9 



.ao-S 



0^ 



kK kK kK 

V 0) o ^ 

q o. c p, cu 

Q ^ 08 n 08 

m Gb & 5) Go 
,20090 
a d d d 




O o -r o "3 ts 



55 



2 S i 

r .. m. 

d C •-' 

3 d 23 



■ to "^ 



8 



■gtx,0 

^11 






d 

d 

o 

O 



cj d lu 



08 



d 

e8 



SSb6(&c£cSf§ 



08 . 

-5J d 

^d"| 



jS^a 






o 



3 s ^ 
•;- ^ ^ 



3 rd O * ffl '*^ 



.•O d 



>> d iS t;* . ♦» Ko 



S 




Teansfebs 



723 



QOQOQOOOOOOOQOQOOOXOOOOOCOOOOOO 
0> 0> Oi Oi Oi Oi Oi Oi Oi Oi CJi Oi Oi Oi Oi a 



00 OC xxoooooo 

O C2 OS Cd Cd O) O) 



v-lt>.v-lf-HCOCO^^v-l 



s 



rH ^H f-4 CO «-< «-< 

^ c^ ^ 



CO »-H ^H ^H ^H 1-H CO 



la 






I'g 



S5<;Z<;S'5-< 



• ^3 • ^^ • 

o ou o aj g a 




I si 



.M 

•« 

^ 






ao*** ©So. 
^ ^*"5^ a « (f 

0) >k *^ 0) ^ 03 



5 

£ 



% 






o 

§ 

-3 



Oil 0} 



_ o 




3 -■* « 






a 

E 

8 



to ««M 

.a o « 



-S 




o^ 



i 



1ll5 



3 X 



jOQ o « 3 

IP J 






lllll 

B u u C5 

»i« « a» p d 

a aa Ou t^ 

ki d d d c 
O a.' CO cc v» 



^1 

■UHU 

Elf 11 II 

g ^ d iJ a^ ou 

(« fi, d »i« d 
JS 5^ « » S 



1-^ 




d«2 

43 






^ ■•» ■♦» 

ill 

CQQQQQ 



J -S -3^ 
QQQQQQdQQQQQ 



.^ d *<[i3 " 
^ S fa"* K 

2 S 2 S'S 



I 



s 



raa 



dHU ^^^ 

d ,^ ,d ■*' S 0} 

.^S 2 .t2 _i ^ 
« « «jdra » 



iim 






APPENDIX B 



Amendments to state civil service bules 
Amendments to state civil service classification 
Requests for changes in the state civil service rules and 

classification denied 
Amendments to state civil service regulations 



[725] 



AMENDMENTS TO STATE CIVIL SERVICE RULES 

Rule VII 

Resolved, That, subject to the approval of Ihe Governor, Rule VII be and 
hereby is amended insofar as it relates to the grading of engineering posi- 
tions, by striking out the words : " In the Commission of Highways and 
Department of the State Engineer and Surveyor, engineering positions 
shall be graded as follows: " and substituting in lieu thereof the following: 
" In the Bronx Parkway Commission, Commission of Highways, and Depart- 
ment of the State Engineer and Surveyor, engineering positions shall be 
graded as follows:", thus making the grading of engineering positions whiih 
was adopted by the Civil Service Commission March 15, 1917, and approved 
by the Governor, March 26, 1917, for the Commission of Highways, and the 
Department of the State Engineer and Surveyor, applicable to engineer- 
ing positions in the Bronx Parkway Commission. 

(Adopted January 18, 1918. Approved by the Governor, February 16, 
1918.) 

Resolved, That, subject to the approval of the Governor, Civil Service Rule 
VII be and hereby is amended under the head " In the Supreme Court, 
county of Queens, Grade B, clerks and assistant clerks " by striking out the 
following *' salaries $2,000 to $4,500 per annum " and inserting in lieu 
thereof "salaries $2,000 to $4,000 per annum"; and under the flame head- 
ing, Grade C, court interpreters, by striking out ''salaries $1,500 to $2,000 
per annum " and inserting in lieu thereof " salaries $1,500 to $2,500 per 
annum,'' for the purpose of correcting a typographical error. 

(Adopted May 22, 1918. Approved by the Governor, June 1, 1918.) 

Rule XVI 

Resolved, That, subject to the approval of the Governor, the last sentence 
of Civil Service Rule XVI, subdivision 1, be amended to read as follows, 
the new matter being underscored : " In computing period of time under 
this subdivision, time of active service in the military or naval forces of 
the L'nited States or of the State of New York, and time of employment in 
the production, con«truction or manufacture of equipment or supplies, or 

in war relief or educatiim work, for such forces, shall not be considered. 



)» 



(Adopted March 6, 1918. Approved by Governor, Deceml)cr 16, 1918.) 

[727] 



AMENDMENTS TO STATE CIVIL SERVICE CLASSI- 
FICATION 

Food Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of State Food Commiasioni 
be and hereby is amended by adding thereto the words: "assistant dire^ 
tor, Buffalo office, bureau of distribution and transportation/' competitive 
or non-competitive examination for said position having been found to be not 
practicable. 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Cumpetitive Class, State Service, be and hereby u 
amended by adding thereto the following: " In the office of the State 
Food Commission; &.y^ assistants to thorough chairmen. Food! Council, 
Greater New York," competitive examination for these positions having 
been foimd to be not practicable. 

(Adopted December 22, 1917. Approved by the Governor, Januaiy 2, 
1918.) 

District Attorney, Onondaga County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the District Attorney, Onon- 
daga county, be and hereby is amended by adding thereto the words " fourtk 
assistant district attorney," and striking out the words " one confidential 
clerk," and substituting in lieu thereof the words ** stenographer to the 
district attorney," competitive or non-coinpetitive examination for these poei- 
tions having been found to be not practicable. 

(Adopted December 14, 1917. Approved by the Governor, January 18, 
1918.) 

Supreme Court, Appellate Division, Second Department 

Resolved, That subject to the approval of the Governor, the classification 
of positions in the Exempt Class, in the Supreme Court, Appellate Division, 
Second Department, be and hereby is amended by striking out the wordi 
" one attendant and crier " and transferring said position to the Com- 
petitive Class with change in title to " crier." 

(Adopted December 21, 1917. Approved by the Governor January 22, 
1918.) 

District Attorney, Suffolk County 

Resolveil, That, su})jeft to th(» approval of the Governor, the classificatioD 
of positions in the Kxcmpt (Mass in the office of the District Attomn, 
Suffolk county, be and liereby is amend wl by striking out the words "on« 
assistant district attorney'' and substituting in lieu thereof the wonU 
"two assistant district attorneys"' competitive or non-competitive exarnia*" 
tion for said additional position having been found to be not practicable. 

(Adopted January IS, 1918. Approved by the Governor, January 24, 191M 

[728] 



Amendments to State Civil Service Classification 729 

Department of Farms and Markets 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class, Departmental Service, be and hereby is 
amended as follows : strike out, *' In the office of the Commissioner of 
Agriculture: two deputies; one detective; secretary; counsel, Bureau of 
Licenses: chief investigator, Bureau of Licenses; five special detectives." 

"In tlie Department of Foods and Markets: the deputy; the secretary. 

" In the office of the Superintendent of Weights and Measures: the deputy; 
the second deputy" and insert: "In the Department of Farms and Markets: 
the c<immi8si()ner of agriculture; the commissioner of foods and markets; 
the secretary; one counsel; one deputy, division of agriculture; one deputy, 
division of foods and markets; the secretary, division of foodis and markets; 
aeventeen directors of bureaus, as follows: accounts, animal industry, food 
standardization, co-operative association, dairy, farmers' institutes, farm set- 
tlement, information, licenses, markets and storage, plant industry, regula- 
tive, statistics, weights and measures, New York, Buffalo, and Rochester; 
three special detectives; competitive or non-competitive examination having 
been foimd to be not practicable (the following positions heretofore exempt 
being transferred to tlio competitive class: one detective; two special detec- 
tives; chief investigator, bureau of licenses, and title changed to investigator; 
counsel, bureau of licenses; and title changed to assi'stant counsel; deputy 
and second deputy superintendents of weights and measures, and titles 
changed to assistant director, bureau of weights and measures)." 

(Adopted February 6, 1918. Approved by the Governor, February 8, 1918.) 

Supreme Court, Appellate Division 

Resolved, That, subject to the approval of the Governor the classification 
of positions in the Exempt Class in the Supreme Court, Appellate Division, 
Second Judicial Department, be and hereby is amended by adding thereto 
the words " three assistant deputy clerks," competitive^ or non-competitive 
examinations for said positions having been found to be not practicable. 

(Adopted January 18, 1018. Approved by the Governor, February 14, 
1918.) 

State Athletic Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class, departmental service, be and hereby is 
amended by striking out: "In the office of the State Athletic Commission: 
the secretary," said Commission having been abolished November 15, 1917, 
pursuant to Chapter 555, of the Laws of 1917. 

(Adopted January 24, 1018. Approved by the Governor, February 16, 
1918.) 

Banking Department 

Resolved, That, subject to the approval of the Governor, Rule XVIII, posi- 
tions in the Non-Competitive Class, be and hereby is amended as follows, 
the position eliminated being obsolete: In tlie Banking Department, strike 
out "two confidential examiners" and insert in lieu thereof "one confi- 
dential examiner." 

(Adopted February 28, 1017. Approved by the Governor, February 16, 
1918.) 



730 Report of State Civil Service Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Banking Department be and hereby 
is amended by striking out the words, ** the stenographer to the superin- 
tendent," said position being obsolete. 

(Adopted March 14, 1917. Approved by the Governor, February 16, 1018.) 

Commissioner of Charities and Corrections, Elrie Coimty 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Xon-Competitive Class in the Department of the Com- 
missioner of Cliarities and Corrections, Erie Count v, be and hereby is 
amended by striking out the words ** assistant matron, 'compensation not to 
exceed $460 per annum and maintenance at the County Home and Hospital" 
and substituting in lieu thereof the v ords " assistant matron at the County 
Home and Hospital, compensation not to exceed $510 j)er annum and main- 
tenance." 

(Adopted January 24, 1918. Approved by the Governor, February 16. 
1918.) 

County Court, Chautauqua County 

Resolved, That, subject to the approval of the Governf»r, the classification 
of positions in tlio Exempt Class in the service of Chaulauqua County, be and 
hereby is amended by striking out the words " In the Office of the CountT 
Judge; one clerk or stenographer," said exempt position not being filled. 

(Adopted May 23, 1917. Approved by the Governor, February 16, 1018.) 

Food Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in tlie office of the State Food Commission 
be and hereby is amended by adding thereto the words *' assistant secretary. 
New York office." competitive or non -competitive examination for said posi- 
tion having been found to be not practicable. 

(Adopted January 24, 1918. .Approved by the Governor, February 16. 
1918.) 

Miscellaneous 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class be and hereby is amended as follows : In the 
office of the County Clerk, Kings County, strike out: "chief clerk of law 
department; chief clerk of certificates, satisfactions, and mechanics* liens; one 
assistant deputy county clerk." (First two positions to be transferred to 
Competitive Class under titles of " clerk of law department " and " clerk of 
certificates, satisfactions, and mechanic's liens.") 

In thi> office of tlie Board of Elections, Nassau County, strike out: "two 
chief clerks, clerks or stenographers," and insert in lieu thereof: "one 
clerk; one stenographer." 

In tlie office of the District Attorney, Queens County, strike out: "One 
deputy assistant district attorney: one chief clerk; o!ie investigator; owe 
stenographer." 

(A«l()plcd September 6. 1917. Aj^p^^ved by the Go'/ornor, February 16. 
1918.) * • 



Amendments to State Civil Service Classification 731 
Newtown Battlefield Reservation Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positionB in the Non-Competitive Class be and hereby is amended by adding 
thereto tlie following : " In the Department of the Newtown Battlefield Res- 
ervation Conunidsion; the custodian," competitive examination for said posi- 
tion having been found to be not practicable. 

(Adopted Febi-uary 7, 1918. Approved by Grovemor, February 16, 1918.) 

Public Service Commission, Second District 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Public Service Commis- 
sion, Second District, be and hereby is amended by striking out the words 
" hearing and publicity clerk," said position having become obsolete on Janu- 
ary 6, 1918. 
(Adopted January 18, 1918. Approved by the Governor, February 16, 1918.) 

Board of Supervisors, Albany County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Board of Supervisors, 
Albany County, be and hereby is amended by striking out the words "clerk 
of the works, to be employed during the construction and completion of the 
new court house," said position now being obsolete. 

(Adopted January 18, 1918. Approved by the Governor, February 16, 

1918.> . , i.l/ i 

Supreme Court, First Judicial District 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Supreme Court, First Judicial Dis- 
trict, be and hereby is amended by striking out the words "one confidential 
attendant/' said position being obsolete. 

(Adopted Febixiary 7, 1918. Approved by the Governor, February 16, 
1918.) . . ^,1 g: i 

County Attorney, Westchester County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class, Westchester Coimty, be and hereby is 
amended by striking out the words "the county attorney*' under the heading 
"in the office of the Board of Supervisors" and inserting as a separate head- 
ing the following: "In the office of the county attorney, the county attor- 
ney." 

It was further 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Westchester County service, be and 
hereby is amended under the heading: "In the office of the county attorney" 
by adding thereto the words, " fir^t deputy county attorney; second deputy 
county attorney; secretary," competitive or non-competitive examination for 
said positions having been found to be not practicable. 

(Adopted January 19, 1918. Apj)rove<l by the Governor, February 16, 
1918.) 



732 Report of State CrvxL Service Comaussion 

Food Commission 

Resolved^ That, subject to the approval of the Grovcmor, the classification 
of positions in the Exempt Class in the office of the State Food Commission, 
be and hereby is amended by adding thereto the words "one confidentisl 
investigator/' competitive or non-competitive examination for said position 
having been found to be not practicable. 

(Adopted January 19, 1918. Approved by the Governor, February 20, 
1918.) 

lola Sanatorium, Monroe County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Tola Sanatorium, Monroe 
Coimty, be and hereby is amended by adding thereto the word "houw- 
keeper," competitive examination for said position having been found to be 
not practicable. 

(Adopted February 13, 1918. Approved by the Governor, February 20, 
1918.) 

Miscellaneous 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class be and hereby is amended as follows: In 
the County Court, Bronx County: strike out "one confidential court attend- 
ant; one stenographer and typewriter." 

In the Department of the Commissioner of Charities and Corrections, Erie 
County : strike out, ** deputy superintendent of penitentiary ; deputy super- 
intendent of the poor; deputy superintendent county home and hospital; sec- 
retary: office of superintendent of the poor." 

In the office of the Board of Elections, Monroe County: strike out, "one 
clerk," and change "Board of Elections " to "Commissicner of Elections," 

In the office of the County Clerk, Queens County, strike out, " financial 
clerk; deputy financial clerk; calendar clerk." 

In the office of the District Attorney, Richmond County: strike out, **onc 
special messenger and subpoena server." 

In the office of the Surrogate, Westchester County: strike out, "the trans* 
fer tax assistant." 

(Adopted September 6, 1917. Approved by the Governor, February 20, 
1918.) 

Special County Judge, Monroe County 

Resolved, tliat, subject to the approval of .the Governor, and in accordance 
with the provisions of section 13, subdivision 3, of the Civil Service Law, the 
classification of positions in the Exempt Class, Monroe County service, be 
and hen!)} is amended by adding thereto the following: ** In the office of the 
Special (rmnty Judge: one confidential clerk." 

(Adopted January 19, 1918. Approved by the Grovemor, February 26, 
1918.) 

County Treasurer, Suffolk County 

Resolved, Thar, subject to the approval of the Governor, and in accordance 
with the provisions of section 13, 'subdivision 2, of the Civil Service Law, 
the classification of positions in tlie Exempt Class, Suffolk County, be and 
hereby is amended by adding thereto the following: ''In the office of the 
County Treasurer; the private secretary." 

(Adopted February ^0, 1^\^. X^jv^on^V^ >i5afc ^^N-KtYWiT, Martjh 6, 1918.) 



Amendments to State Civil Service Classification 733 
Commissioner of Records, New York County 

Besolved. That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, New York County Service, be and 
hereby is amended by striking out the words : " In the office of the Com- 
missioner of Records, New York County: one mechanic and general repairer, 
compensation at the rate of $1,000 a year.", thus transferring the position 
of mcclianic and general repairer to the competitive class. 

(Adopted February 20, 1918. Approved by the Governor, March 5, 1918.) 

Agricultural Experiment Station, Geneva 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Kon-Competitive Class in the Agricultural Experiment 
Station at Geneva, be and hereby is amended by adding thereto the word 
" bio-chcmist," competitive examination for said position having been foimd 
to be not practicable. 

(Adopted February 27, 1918. Approved by the Grovenior, March 11, 1918.) 

Conservation Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Confiorvation Commission, 
be and hereby is amended by striking out the words *'one chauffeur, State 
Reservation, Saratoga Springs," and substituting in lieu thereof the words 
** two chauffeurs," competitive examination for said additional positions 
having been found to be not practicable. 

(Adopted March 7, 1918. Approved by the Governor, March 11, 1918.) 

Prison Department 

Resolved, That, subject to the approval of the Grovernor, and in accordance 
with the provisions of section 13, subdivision 1, of the Civil Service Law, the 
classification of positions in the Exempt Class in the Prinon Department be 
and hereby is amended by striking out the words ** ona secretary or clerk to 
the superintendent," and substituting in lieu thereof the words *'the deputy 
superintendent." 

(Adopted March 7, 1918. Approved by the Governor, March 11, 1918.) 

Oneida County Hospital 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Oneida (Jounty Hospital, be 
and hereby is amended by adding thereto the words "laboratory technician," 
competitive examination for said position having been found to be not 
practicable. 

(Adopted March 7, 1918. Approved by the Governor, March 12, 1918.) 

Register, New York County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class be and hereby is amended as follows: In 
the olfice (»f the Register, New York County ; strike out . "two special deputy 
registers; chief satisfaction clerk; the chief clerk; one assistant deputy 
register." 

(Adopted September 6, 1917. Approved by the Governor, Ma.t<:)ti VL, V^V^.N 



734: Eepobt of State Civil Sebvicb Commission 
Commissioner of Elections, Niagara County 

Resolved, That, subject to the approval of the Governor, the classificatioD 
of positions in the Exempt Glass in the Oounty Service, be and hereby ii 
amended under tlie heading '*In the offices of the Board of Elections of the 
Counties of," by striking out the word " Niagara." 

Resolved, That, subject to the approval of the Governor, and in accordaneee 
with the provisions of section 13, subdivisions 1 and 2, of the Civil Service 
Law, the classification of positions in the Exempt Class, Niagara county 
service, be and hereby is amended by adding thereto the words "In the 
office of the Commissioner of Elections: the deputy; the secretary." 
(Adopted April 10, 1918. Approved by the Governor, May 8, 1918.) 

Department of Elxcise 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Department of ISxcise, be and hereby 
is amended by adding thereto the words *' the cashier in the office of the 
Special Deputy Commissioner for the Coimty of Bronx," competitive or non- 
competitive examination for said position having been found to be not prac- 
ticable. 

(Adopted April 10, 1918. Approved by the Governor, May 8, 1918.) 

Food Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the State Food Commisdon 
be and hereby is amended by adding thereto the words "five confidential 
agents," competitive or non-competitive examination for said positions hav- 
ing been found to be not practicable. 

(Adopted May 2, 1918. Approved by the Governor, May 20, 1918.) 

Attorney-General 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Attorney Greneral, be 
and heri'by is amended by adding thereto the words ** one confidential derit, 
New York City Bureau, provided, however, that this exemption shall not 
remain in force for a period longer than three months after the termination 
of the existing war with the German empire and its allies," competitive or 
non-competitive examination for said position, under the conditions stated, 
being deemed to be not practicable. 

(Adopted May 23, 1918. Approved by the Governor, June 1, 1918.) 

Commissioner of Charities and Corrections, Erie County 

Resolved, That, subject to the approval of the Grovernor, the classification 
of positions in the non -competitive class in the Department of the Commit* 
sioner of Charities and Corrections, Erie County, be and hereby is amended 
by striking out ** one farm laborer and watchman at the County Farm« 
compensation not to exceed $730 per annum and maintenance," and substitnt* 
ing in lieu thereof the words " one farm laborer and watchman at the 
County Farm, compensation not to exceed $840 per annum and maintenance." 

(Adopted April 10, 1918. Approved by the Grovemor, June 1, 1918.) 



Amendments to State Civil Service Classification 735 
Commissioner of Charities and Corrections, Westchester County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Commissioner 
of Charities and Corrections, Westchester county, be and hereby is amended 
by adding thereto the words "meat cutter and asflistant storekeeper; baker,** 
competitive examinations for said position having been found to be not 
practicable. 

(Adopted March 1&, 1918. Approved by the Governor, June 1, 1918.) 

Commissioner of Charities and Corrections, Westchester County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Commissioner 
of Charities and Corrections, Westchester county, be and hereby is amended 
by adding thereto the word "orderly,** competitive examination for said posi- 
tion having been found to be not practicable. 

(Adopted March 21, 1918. Approved by the Governor, June 1, 1918.) 

Conservation Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Xon-Competitive Class in the Conservation Commission 
be and hereby is amended by striking out the words " two chauffeurs ** and 
substituting in lieu thereof the words " three chauffeurs,** competitive exam- 
ination for said additional position having been found to be not practicable. 

(Adopted May 22, 1918. Approved by the Gk>vernor, June 1, 1918.) 

Department of Farms and Markets 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Department of Farms and Markets, 
be and hereby is amend by striking out the words " seventeen directors of 
bureaus " and substituting in lieu thereof the words " eighteen directors of 
bureaus;** and adding to the list of bureaus, the directors of which are 
exempt, the words " State Institution Farms,** competitive or non-competi- 
tive exanrination for said position having heretofore been found to be not 
practicable. 

(Adopted March 15, 1918. Approved by the Governor, June 1, 1918.) 

Food Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the State Food 
Commission be and hereby is amended by adding thereto the words " assistant 
to the lower Manhattan Borough Chairman of the Food Council of Greater 
New York,*' competitive examination for said position having been found 
to be not practicable. 

(Adopted March 15, 1918. Approved by the Governor, June 1, 1918.) 

Department of Health 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Department of Health, be 
and hereby is amended by striking out the words "fifteen technical assist- 



736 Report of State Civil Service Commission 

ants '' and substituting in lieu thereof the words *' twenty technical assist- 
tants;*' and further amended by striking out the wordfi ''nine laboratorj 
helpers/' substituting in lieu thereof the words " fifteen laboratory helpers,' 
competitive examination for these positions having been found to be not 
practicable. 

(Adopted April 18, 1918. Approved by the Governor, June 1, 1918.) 

Department of Highways 

Resolved, That, subject to the approval of the Governor, the classificatioa 
of positions in the Non-Competitive Class in the Department of Highways, 
be and hereby is amended by striking out the words " compositor's assistant, 
compensation not to exceed $60 per month," and substituting in lieu thereof 
the words "compositor's assistant," thereby continuing the position mentioned 
in the non-competitive class but without limit as to compensaticMi. 

(Adopted April 25, 1918. Approved by the Governor, June 1, 1918.) 

Department of Highways, Onondaga County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Department of Highwaji, 
Onondaga county, be and hereby is amended by striking out the words "one 
general machinist" and substituting in lieu thereof the words " two general 
machinists," competitive examination for said positions having been found 
to be not practicable. 

(Adopted March 27, 1918. Approved by the Governor, June 1, 1918.) 

Industrial Farm, Niagara County 

Resolved, That, subject to the approval of the Governor, the classificatioii 
of positions in the Non-Competitive Class in the County Service, be and 
hereby is amended by adding thereto the following: "At the Industrial 
Farm, Niagara oounty; farmer," competitive examination for said position 
having been found to be not practicable. 

(Adopted April 11, 1918. Approved by the Governor, June 1, 1918.) 

lola Sanatorium, Monroe County 

Resolved, That subject to the approval of the Governor, the dassificatico 
of positions in the Non-Competitive Class in the Tola Sanatorium, Monroe 
county, be and liercby is amended by striking out the words " assistaoi 
resident physician, compensation not to exceed $75 per month and main- 
tenance " and substituting in lieu tlicreof tlie words " assistant resident 
physician, compensation not to exceed $1,000 per year with maintenance," 
for the purpose of increasing the limit of compensation as specified 

(Adopted March 27, 1918. Approved by the Governor, June 1, 1918.) 

Letchworth Village, Thiells 

Resolved, That, subject to the approval of the Governor, the classificatioB 
of positions in the Non-Competitive Glass in the Letchworth Village tl 
Thiells, be and hereby is amended by adding thereto the words "butcher 
and meat cutter," competitive examination for such position having be« 
found to be not praeticaljle. 

(Adopted March 27, 1918. Adopted by the Governor, June 1, 1918.) 



Amendments to State Civil Service Classification 737 

Purchasing Agent, Erie County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Clase, county service, be and hereby is 
amended by adding thereto the following: "In the office of the purchasing 
agent, Erie county; one chauffeur and laborer," competitive examination 
for such position having been foimd to be not practicable. 

(Adopted May 2, 1918. Approved by the Governor, June 1, 1918.) 

Reformatory for Women, Bedford Hills 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Reformatory for Women 
at Bedford Hills, be and hereby is amended by adding thereto the words 
*' chauffeur," competitive examination for said position having been found to 
be not practicable. 

(Adopted May 23, 1918. Approved by the Governor, June 1, 1918.) 

Secretary of State 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Secretary ot 
State, be and hereby is amended by adding thereto the words " one foreman 
of laborers,'' competitive exrjnination for said position having been found 
to be not practicable. 

(Adopted May 22, 1918. Approved by the Governor, June 1, 1918.) 

Tax Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, departmental service, be and hereby 
is amended by adding thereto the vrords ** In the office of the Tax Conunission; 
one addressograph operator,'* competitive examination for said position 
having been found to be not practicable. 

(Adopted May 22, 1918. Approved by the (governor, June 1, 1918.) 

Sheriff, Monroe County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the sheriff, Monroe county, 
be and hereby is amended by adding thereto the words " private secretary " 
competitive or non-competitive examination for said position having been 
found to be not practicable. 

(Adopted May 22, 1918. Approved by the Governor, June 1, 1918.) 

Charitable, Penal and Reformatory Institutions 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Charitable, Penal and Reform- 
atory Institutions, except State Prisons, be and hereby is amended by adding 
thereto the words " assistant steam engineer," competitive examination for 
said positions at salaries now allowed having been found to be not practi- 
cable owing to conditions incident to the existing war. 

(Adopted May 31, 1918. Approved by the Governor, June 28, 1918.) 



738 Report of State Civil Service Commission 
Commissioner of Charities and Corrections, Erie County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the (Department of the Commis- 
sioner of Charities and Corrections, Erie county, be and hereby is amended bj 
adding thereto the words " janitress, office of the Superintendent of Poor, and 
the Medical Examiners," competitive examination for said position having 
been found to be not practicable. 

(Adopted May 31, 1918. Approved by the Governor, June 28, 1918.) 

Comptroller 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Comptroller be and her^ 
is amended by striking out the words " Two Corporation Tax Commissioners " 
and substituting in lieu thereof the words " Two Corporation Tax Exam- 
iners," for the purpose of changing title to conform to provisions in the 
Appropriation Bill, being chapter 151, Laws of 1918. 

(Adopted June 7, 1918. Approved by the Governor, June 28, 1918.) 

Craig Colony, Sonyea 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Craig Colony at Sonyea, be 
and hereby is amended by striking out the word '* plimibcr " and inserting in 
lieu thereof the words '* steam fitter and plumber;" and also by adding 
thereto the words "head laundress,'' competitive examination for the posi- 
tions referred to liaving been found to be not practicable. 

(Adopted June 1-2, 1918. Approved by the Ciovtrnor, June 28, 1918.) 

Department of Excise 

Resolved, That, subject to tlie approval of tlie Governor, the classification 
of positions in the Non-Competitive Class in the Department of Excrse, be 
and hereby is amended by striking out the words *' one clerk and two 8tem»g- 
raphers in the Detective Bureau," thus transferring said positions to the 
Competitive Class under tlie title of clerk and stenographer. 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Department of Excise, be and hereby 
is amended by striking out the words ** the deputy; deputy commissioner; 
second deputy commissioner," and substituting in lieu thereof the word* 
*' three deputy commissioners," in order to comply wiih provisions of the 
appropriation bill, being Chapter 151, Laws of 1918. 

(Adopted June 7, 1918. Approved by the Governor, June 28, 1918.) 

Department of Farms and Markets 

Resolved, That, subject to the approval of the Governor, the classificatioo 
of positions in the Exempt Class in the Department of Farms and Markets, 
be and hereby is amended by striking out the words " Director, Bureau of 
Information " and substituting in lieu thereof the word^ " Secretary, Division 
of Agriculture," for the purpose of changing title to conform to the appro- 
priation bill. 

(Adopted May 31, 1018. Approved by the Governor, June 28, 1918.) 



Amendments to State Civil Service Classification 739 

State Hospital Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the oflSce of the State Hospital Gommis- 
eion be and hereby is amended by striking out the words " one collection 
attorney " and substituting in lieu thereof the words ** one counsel," for the 
purpose of changing title to conform with provision in the appropriation 
bill, being Chapter 151, Laws of 1918. 

(Adopted June 12, 1918. Approved by the Governor, June 28, 1918.) 

Health Officer, Port of New York 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Health Officer, 
Port of New York, be and hereby is amended by striking out the words 
** boarding officer and inspector. City Island, compensation not to exceed $75 
per month." 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Health Officer, 
Port of New York, be and hereby is amended by striking out the words ** one 
chauffeur " and substituting in lieu thereof the words '* chauffeur and machin- 
ist " ; also by striking out the word " plumber " and substituting in lieu 
thereof the words ''plumber and steam fitter;'' and by adding thereto the 
wordB " one foreman painter ; " said changes being made to conform to items 
in the appropriation bill, competitive examination therefor having been found 
to be not practicable. 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Health Officer, Port of 
New York, be and hereby is amended by striking out the words "chief dis- 
infector " and transferring the position to the Competitive Class under the 
title of "attendant (chief disinfector)." 

Resolved, That., subject to the approval of the GoveiT.or, the classification 
of positions in the Exempt Class in the office of the Health Officer, Port of 
New York, be and hereby is amended by striking out the words " two en- 
gineers, Hoffman's Island; two engineers, Swinburne Island; four firemen, 
Hoffman's Island; two firemen Swinburne Island,'* and substituting in lieu 
thereof " four engineers ; six firemen." 

(Adopted May 31, 1918. Approved by the Governor, June 28, 1918.) 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Health Officer, Port of 
New York, be and hereby is amended by striking out the words " confidential 
stenographer " and substituting in lieu thereof the words " confidential aide " 
in order to comply with change in title made in the annual appropriation bill, 
being Chapter 151, Laws of 1918. 

(Adopted June 7, 1918. Approved by the Governor, June 28, 1918.) 

Commissioner of Records, Bronx County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Bronx County service, be and hereby 
is amended by adding thereto the following: "In the office of the Commis- 



740 Kepoet of State Civil Service Commission? 

sioner of Records: one deputy; one superintendent," competitive or non- 
competitive examination for such positions having been found to be not prac- 
ticable. 

(Adopted June 7, 1918. Approved by the Governor, June 28, 1918.) 

Soldiers' and Sailors' Home, Bath 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the non-competitive class in the Soldiers' and Sailors' Home, 
Bath, be and hereby is amended by adding thereto the words ''clerk to the 
treasui'er,'' competitive examination for said position having been found to be 
not practicable. 

(Adopted June 7, 1918. Approved by the Governor, June 28, 1918.) 

Supreme Court, Kings County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the Supreme Court, Kings County, be 
and hereby is amended by adding thereto the words " one confidential tele- 
phone operator," competitive or non-competitive examination for said position 
having been found to be not practicable. 

(Adopted June 7, 1918. Approved by the Governor, June 28, 1918.) 

Women's Relief Corps Home, Oxford 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Women's Relief Corps Home 
at Oxford, be and hereby is amended by adding thereto the words *' cook and 
baker,'' competitive examination for said position having been found to be 
not practicable. 

(Adopted June 12, 1918. Approved by the Governor, June 28, 1918.) 

Comptroller 

Resolved. That, subject to .the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Comptroller be and 
hereby is amended by striking out the words " eighteen court and trust fund 
examiners," and substituting in lieu thereof the words, " seventeen court and 
trust fund examiners," thereby transferring one position of court and trust 
fund examiner to tlie Competitive Class with change of title to " supervising 
examiner, court and trust fimd bureau," to take effect July 1, 1918, to com* 
ply with items in the appropriation bill; provided, however, that the change 
in classification herein proposed shall not become effective in the case of any 
person holding tlie position of court and trust fund examiner June 30, 1918, 
until the person lias been examined by tlie State Civil Service Commission at 
the request of the Comptroller, and found qualified to perform the duties of 
the position of supervising examiner. 

(Adopted July 2, 1918. Approved by the Governor, July 9, 1918.) 

Dannemora State Hospital 

Resolved, That, subject to the approval of the (xovemor, the classification 
of positions in the Nou-Com;)iititive Class, be and hereby is amended under 



Amendments to State Civit> Service Classification 741 

the heading " In the State Hoapitah/' by adding thereto the words " driver 
and chau£feur, Dannemora State Hospital/' competitive examination for said 
position having been found to be not practicable. 

Adopted July 2, 1918. Approved by the Governor, July 9, 1918. 

Department of Health 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Department of Health, be 
and hereby is amended by adding thereto the words " one chauflfeur," com- 
petitive examination for said position having been found to be not practica- 
ble. 

(Adopted July 2, 1918. Approved by the Governor, July 9, 1918.) 

Great Meadow Prison 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class be and hereby is amended by add- 
ing thereto the following: ** In Great Meadow Prison; farmer," competitive 
examination for said position having been found to be not practicable. 

(Adopted July 2, 1918. Approved by the Governor, July 9, 1918.) 

Long Island School of Agriculture, Farmingdale 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the School of Agriculture on Long 
Island, Farmingdale, be and hereby is amended by adding thereto the words 
"matron or houKekeeper,*' competitive examination for said position having 
been found to be not practicable. 

(Adopted July 2, 1918. Approved ))y the Governor, July 9, 1918.) 

Monroe County Tuberculosis Sanatorium 

Resolved, That, subject to the approval of the Governor, the claissification 
of positions in the Non-Coiupetitive Class, Monroe County, be and hereby is 
amended by striking out the heading ** In the lola Sanatorium, Monroe 
County " and substituting in lieu thereof the words ** Monroe County Tuber- 
culosis Sanatorium," for the purpose of changing the classification to con- 
form with the change in title. 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Monroe County Tuberculosis 
Sanatorium be and hereby is amended by striking out the words " assistant 
resident physician, compensation not to exceed $1000 a year with mainte- 
nance," thus transferring tlie position to the Competitive Class. 

(Adopted July 2, 1918. Approved by the Governor, July 9, 1918.) 

Public Service Commission, First District 

Resolved, That, subject to the approval of the Grovemor, the classification 
of positions in the Exempt Class in the ofiice of the Public Service Oonunis- 
sion for the First District, be and hereby i-a amended by striking out the 
words ''one assistant electrical engineer," said position being obsolete; and 
by striking out the words ** assistant secretary to the commission," and sub- 



742 KErouT of State Civil Service Commissiox 

stituting in lieu thereof the words " two assistant secretaries to the com- 
mission," competitive or non -competitive examination for said additiontl 
position of assistant secretary having been found to be not praoiticable. 
(Adopted July 2, 1918. Approved by tlie Governor, July 9, 1918.) 

Department of Architecture 

Resolved, That, subject to the approval of the Governor, tlie classification 
of positions in the Exempt Class in the Department of Architecture, be and 
hereby is amended by striking out the words ** one deputy acting as assist- 
ant state architect ; one deputy acting as chief engineer," and substituting in 
lieu thereof the words "one deputy designated as assistant state architect; 
one deputy designated tea chief engineer," effective July 1, 1918, for the pur- 
pose of changing the classification to conform with the provisions of section 
7 of chapter 111, Laws of 1014 and title in the appropriation bill. 

(Adopted July 11, 1918. Approved by the Governor, July 26, 1918.) 

Auburn Prison 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, be and hereby is amended by 
adding thereto the words **In Auburn Prison; chauffeur and coachman," 
effective July 1, 1918, competitive examination for said position having been 
found to be not practicable. 

(Adopted July 10, 1918. Approved by the Governor, July 26, 1918.) 

Comptroller 

Resolved, That, subject to the approval of the Governor the classification 
of positions in the Exempt Class in the oflSce of the Comptroller, be and 
hereby is amended by striking out the words "chief clerk, secured debt tax 
bureau, Albany office; chief clerk, secured debt tax bureau, New York office," 
and substituting in lieu thereof the words " chief clerk, investment tax 
bureau, Albany office, chief clerk, investment tax bureau. New York office." 
effective July 1, 1918, for the purpose of changing the classification to com- 
ply with the titles enumerated in the appropriation bill. 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Comptroller, 
be and hereby is amended by adding thereto the words " one bank messenger.'' 
comj>etitive examination for said position having been found to be not 
practicable. 

(Adopted July 11, 1918. Approved by the Governor, July 26, 1918.) 

Conservation Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Conservation Commis- 
sion, be and hereby is amended by striking out the words " one special 
deputy a ttorney -general '^ and substituting in lieu thereof the words **one 
counsel," and by striking out the words "three confidential agents," and 
inserting in lieu thereof the words "one chief confidential agent; two con- 
fidential agents," effective July 1, 1918, for the purpose of changing the 
classification to conform with the titles carried in the appropriation bill. 

(Adopted July 11, 1918. Approved by the Governor, July 26, 1918.) 



Amendments to State Civil Service Classification 743 

Commission on Feeble Minded 

Resolved, That, subject to the approval of the Governor, and in accordance 
with the provisions of Section 13, eubdivision 2 of the Civil Service Law, 
the classification of positions in the Exempt Class be and hereby is amended 
by adding thereto the following: ''In the office of the Commission an 
Feeble Minded; the secretary." 

(Adopted July 11, 1918. Approved by the Governor, July 26, 1918.) 

Superintendent of Elections 

Resolved, That, subject to the approval of the Governor, the classificatioiv 
of positions in the Exempt Class in the office of the State Superintendent 
of Elections, be and hereby is amended by striking out the words " the 
stenographer." and substituting in lieu thereof the words "the chief stenog- 
rapher," effeirtive July 1, 1918, for the purpose of changing the title in the 
classiiication to conform with that in the appropriation bill. 

(Adopted July 10. lOlS. Approved by the Governor, July 26, 1918.) 

Industrial Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Industrial Commission, 
be and hereby is amended by striking out the words *' one assistant coimsel,*' 
and substituting in lieu thereof the words ** two assistant counsels," com- 
petitive examination for said additional position having been found to be not 
practicable. 

(Adopted July 3, 1918. Approved by the Governor, July 26, 1918.) 

Department of PubJic Buildings 

ResolviHl, That, Kubj<?ct to the approval of the Governor, the classification 
of positions in the Exempt Class in the Department of Public Buildings, be 
and hereby is amended by striking out the words " the custodian of the 
Senate committee rooms; the custo<Han of Assembly property," and substi- 
titing in lieu thereof the words "custodian of Senate; custodian of Assem- 
bly," effective July 1, 1918, in order to change the classification to conform 
with titles of poi^itions in the appropriation bill. 

(Adopted July 11. 1918. Approved by the Governor, July 26, 1918.) 

Secretary of State 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Sexiretary of State, 
lie and hereby is amended by striking out the words "one assistant to the 
first deputy secretary of State; one confidential stenographer to the first 
deputy secretary of State," and substituting in lieu thereof the words "one 
assistant to deputy; one confidential stenographer to deputy," effective 
July 1, 1918, for the purpose of changing the dassification to conform with 
titles in the appropriation bill, Ix'ing Chapter 151, Laws of 1918. 

(Adopted July 11, 1918. Approved by the Governor, July 26, 1918.) 



744 Repokt of State Civil Service Commission 

Sing Sing Prison 

Resolved, That, subject to the approval of the Governor, the classification 
of poditions in the Non<:!ompetitive Class in Sing Sing Prison, be and 
hereby is amended by adding thereto the words "driver and chauflfeur," 
effective July 1, 1918, competitive examination for said position having been 
found to be not practicable. 

(Adopted July 11, 1918. Approved by the Governor, July 26, 1918.) 

Banking Department 

Resolved, That, subject to the approval of the Governor and in accordance 
with the provision of section 13, subdivision 1, of the Civil Service Law, 
the classifiaction of positions in the Exempt Class in the Banking Depart- 
ment, be and hereby is amended by striking out the words " three deputies " 
and substituting in lieu thereof the words "four deputies." 

(Adopted July 27, 1918, Approved by the Governor, July 31, 1918.) 

District Attorney, Bronx County 

Resolved, Tliat, subject to the approval of the Governor, the classilication of 
positions in the Exempt Class in the office of the District Attorney. Bronx 
county, be and hereby is amended by striking out the words " five assistant 
district attorneys; four deputy assistant district attorneys" and substi- 
tuting in lieu thereof the words "eight assistant district attorneys; one 
deputy assistant attorney " to comply with the provisions of Chapter 632, 
Laws of 1918. 

(Adopted July 27, 1918. Approved by tlje Governor, July 31, 1918.) 

Farms and Markets 

Resolved, That, subject to the approval of the Governor, the classification of 
positions in the Exempt Class in the Department of Farms and Markets 
be and hereby is amended by striking out the word« " Director State Insti- 
tution Farms " and substituting in lieu thereof the words ** Deputy Commis* 
sioner and Director;'* and by striking out the words "Director Farm 
Settlement Bureau " and substituting in lieu thereof the words *' Director 
Farm Settlement and Labor Bureau/' effective July 1, 1918, in order to 
conform to the titles specified in the appropriation bill. 

(Adopted July 27. 191S. Approved by the Governor. .July 31, 1018.) 

Charitable, Penal and Reformatory Institutions 

Resolved, That, subject to the approval of the Governor, the classificatitw 
of positions in the Xon-Competitive Class in the Charitable, Penal and 
Reformatory Institutions, except State Prisons, ibe and hereby is amended 
by striking out the words " assistant steam engineer,'* and substituting in 
lieu thereof the words " assistant engineer or assistant engineer and elec- 
trician," for the purpose of complying with titles in the appropriation bill. 

(Adopted July 27, 1918. Approved by the Governor, August 3, 1918.) 



Amendments to State Civil Service Classification 745 

State Hospital Commission 

Resolved, That, subject to the approval of the Governor, the classification 
(»f positions in the Non-Competitive Class in the office of the State Hospital 
Commission, be and hereby is amended by striking out the words " interpreter 
and transportation attendunt, office State Board of Alienists,^' thus trans- 
ferring said position to the Competitive Class, with change oi title to 
" interpreter," to comply with provision in the appropriation bill. 

(Adopted J\ily 27, 1918. Approved by the Governor, August 3, 1918.) 

State Hospital Service 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, in the State Hospital Service, 
be and hereby is amended by adding thereto the words " fireman and dynamo 
tender, Dannemora State Hospital," for the purpose of complying with title 
in the appropriation bill. 

(Adopted July 27, 1918. Approved by the Governor, August 3, 1918.) 

Niagara County Sanatorium 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, in the county service, be and 
hereby i.«« amended by adding thereto the following: "In the Niagara County 
Sanatorium: Cook; fireman; interne; laboratory assistant; laundryman; 
laundress; orderly," competitive examination for said positions having 
been found to be not practicable. 

(Adopted July 27, 1918. Approved by the Governor, August 3, 1918.) 

Pleasant Valley Sanatorium, Steuben County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non- Competitive Class, county service, be and hereby 
is amended by adding thereto the following: "In the Pleasant Valley 
Sanatorium, Steuben county: Cook; laundryman; janitor; one bookkeeper 

and stenographer, compensation $25 a month and maintenance, provided the 
appointee is a patient at the Sanatorium," competitive examination for said 
positions having been found to be not practicable. 

(Adopted July 27, 1918. Approved by the Governor, August 3, 1918.) 

Board of Port Wardens 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the ofilce of the Board* of Port Wardens, 
be and hereby is amended by adding thereto the words ** clerk typist, pro- 
vided however, that this exemption shall not remain in force for a period 
longer than three months after the termination of the existing war with 
the German Empire and its Allies," competitive or non-competitive examina- 
tion for said positions, under the conditions stated, being deemed to be not 
practicable. 

(Adopted July 27, 1918. Approved by the Governor, August 3, lOI^A 



746 Eeport of State Civil Service Commission 
Commissioner of Charities and Corrections, Erie County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Department of the Com- 
missioner of Charities and Corrections, Erie county, be and hereby is amended 
by adding thereto the words " nurses at the County Hospital," competitive 
examination for said positions having been found to be not practicable. 

(Adopted August 2, 1918. Approved by the Governor, August 6, 1918.) 

Commissioner of Charities and Corrections, Erie County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Department of the Commis- 
sioner of Charities and Corrections, Erie county, be and hereby is amended 
by adding thereto the words " trained attendant," competitive examination for 
said position having been found to be not practicable. 

(Adopted September 13, 1918. Approved by the Governor, September 21, 
1918.) 

State Agricultural and Industrial School, Industry 

Resolved, That, subject to the approval of the Grovernor, the classification 
of positions in the Non -Competitive Cla«8, in the State Agricultural and 
Industrial School at Industry, insofar as it relates to the requirements that 
the matron of a farm cottage shall be th« wife of a supervisor, be and hereb? 
is amended so as to permit of the nomination and examination of Miss Mtrr 
Bott, sister of instructor in tailoring and supervisor of cottage, (Jeorge A. 
Bott, as matron, to take the place of Miss Bott, deceased. 

(Adopted September 13, 1918. Approved by the Governor September 21. 
1918.) 

Department of Public Works 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Department of Public 
Works, be and hereby is amended by striking out the words " four chauffeurs" 
and substituting in lieu thereof the words " seven chauffeurs," competitiie 
examination for said position having been found to be not practicable. 

(Adopted September 13, 1918. Approved by the Governor, September 21, 
1918.) 

Attorney-General 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of thie Attorney-General, b^ 
and. hereby is amended by striking out the words " twenty-nine deputies;" 
and the classification of positions in the Exempt Class in the ofl&ce of tke 
Conservation Commission by striking out the words "one deputy attorney- 
general; five assistant deputies attorney -general, appointed pursuant to 8e^ 
tion 9, chapter 318, laws of 1915," and substituting in lieu thereof under 
the heading *' In the office of the Attorney -General : thirty-two deputies; 
three aseistant deputies altoxive^'-^ncral, appointed pursuant to sectioB 



Amendments to State Civil Sebvice ■Classification 747 

9, cliapter 918, Laws of 1915," competitive or non-competitive examination 
for the two additional positions of deputy having been found to be not 
practicable. 

(Adopted October 7, 1918. Approved by the Governor, October 31, 1918.) 

Court of Appeals 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in tlie Exempt Class in the Court of Appeals be amended by 
striking out the words *^ All positions in the Court of Appeals, includ- 
ing all places to which appointments are made by the clerk of the Court 
of Appeals, except crier and messenger; one clerk to each retired judge of 
the Court of Appeals acting as referee,'' and inserting in lieu thereof the 
words ** All positions in the Court of Appeals including all places to which 
appointments are made by the clerk of the Court of Appeals, except crier; 
one clerk to each retired judge of the Court of Appeals acting as referee," 
thus transferring one position of messenger from the Competitive to the 
Exempt Class, competitive or non-competitive examination for said position 
having been found to be not practicable. 

(Adopted October 25, 1918. Approved by the Governor, November 15, 
1918.) 

Department of Farms and Markets 

Resolved, That, subject to the approval of the Governor, the classificatioB 
of positions in the Exempt Class, iiii the Department of Farms and Markets, 
be and hereby is amended by striking out the words " sixteen directors of 
bureaus, as follows: Accounts, animal industry, food standardization, 
co-operative association's, dairy, farmers' institutes, farm settlement and 
labor, licenses, markets and storage, plant industry, regulative, statistics, 
weights and measures, Now York, Buffalo and Rochester; three special 
detectives," competitive or non-competitive examination having been found 
to be not practicable (the following positions heretofore exempt being 
tran«terre<l to the Competitive Class: ''one detective; two spc^cial detectives; 
chief investigator, bureau of licenses, and title changed to investigators; 
counsel, bureau of licenses, and title changed to assistant counsel; deputy 
and second deputy superintendents of weights and measures, and title changed 
to assistant director, b\ireau of weiglits and measures"), and substituting in 
lieu thereof as follows: "three special detectives; fourteen directors • of 
bureaus as follows: Accounts, animal industry, food standardization, 
co-operative associations, dairy, farm settlement and labor, licenses, markets 
and storage, plant industry, regulative, statistics, weighta and measures, 
Xew York and Buffalo," thus eliminating from the classification the 
obsolete positions of director of the bureau of farmers' institutes, and director 
of the bureau of the Rochester office; and further by striking out words 
which were merely explanatory of the classification adopted by resolution of 
February 6, 1918, approved February 8, 1918. 

(Adopted September 26, 1918. Approved by the Governor, November 15, 

IQIfi \ 



748 Report of State Civil Service Commission 

State Hospital Service 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Ck)mpetitive Class in the State Hospital service be 
amended by strikinf^ out the words " one fireman, fire departments, Cen- 
tral Islip and Kings Park State Hospitals," and substituting in lieu thereof 
the words " in the fire departments of the Central Islip, Kings Park and 
Manhattan State Hospitals, one fireman each," competitive examination for 
said position having been found to be not practicable. 

(Adopted November 7, 1918. Approved by the Grovernor, November 15, 
1918.) 

Mohansic Lake Reservation Commission 

Resolved, That, subject to the approval of the Governor, and in accordance 
with the provisions of section 13, subdivision 12, of the Civil Service Law, the 
classification of positions in the Exempt Class, be and hereby is amended by 
adding thereto the following: " In the office of the Mohansic Lake Reser- 
vation Commission: The secretary." 

(Adopted October 25, 1918. Approved by the Governor, November 15, 
1918.) 

Conservation Commission 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class under the Conservation Com- 
mission be and hereby is amended by adding thereto the words, "forest 
rangers," competitive examination for said position having been found 
to be not practicable. 

(Adopted February 15, 1917. Approved by the Governor, November 30, 
1918.) 

Comptroller 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the office of the Comptroller, be and 
hereby is amended by striking out the words " twenty examiners of trans- 
fers of stock " and substituting in lieu thereof the words " twenty-one 
stock transfer tax examiners," thus changing the title of the position to con- 
form with that carried in the appropriation bill, and exempting an additional 
position, competitive or non-competitive examination for which has hereto- 
fore been found to be not practicable. 

(Adopted November 29, 1918. Approved by the Governor, December 16, 
1018.) 

Conservation Commission 

Resolvtxl That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the Conservation Commission, 
be and hereby is amended by striking out the words " three chauffeur8» 



Amendments to State Civil Service Classification 749 

State Reservation, Saratoga Springs" and substituting in lieu thereof the 
words "four chauffeurs," competitive examination, for said position having 
been found to be not practicable. 

(Adopted November 30, 1918. Approved by the Governor, December 16, 
1018.) 

County Clerk, Bronx County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class be and hereby is amended as follows: In 
the office of the County Clerk, Bronx County, strike out: "equity clerk act- 
ing also as law clerk; one confidential stenographer (transfer to Competi- 
tive Class under title of "stenographer.") 

(Adopted September 6, 1918. Approve<l by the Governor, December 16, 
1918.) 

County Court, Monroe County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class in the county court, Monroe county, be and 
hereby is amended by striking out the words " one confidential clerk, as 
provided by section 196 of the Judiciary Law,** and substituting in lieu thereof 
"one confidential clerk, as provided by section 196 of the Judiciary Law, 
who shall act also as special clerk in children's cases," competitive or non- 
competitive examination for said position having been found to be not 
practicable. 

(Adopted November 30, 1918. Approved by the Governor, December 16, 
1918.) 

County Home, Onondaga County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, county service, be amended by 
striking out the words " In the office of tht* Superintendent of the Poor, 
Onondaga county: nurse; fireman; attendant; carpenter; chauffeur," and 
substituting in lieu thereof the wonls " In the County Home, Onondaga 
county: nurMo; fireman; attendant; carpenter; chauffeur," for the pur- 
pose of amending the classification to conform to the provisions of chapter 
235, I^ws of 1911. 

(Adopted December 12, 191S. Approved by Ihe Governor, December 16, 
1918.) 

Monroe County Tuberculosis Sanatorium 

Resolved, That, subject to the approval f)f the Governor, the classification 
of positions in the Non-Competitive Class in the Monroe county tubercu- 
losis sanatorium be and hereby is amended by striking out the words ** interne 
with salary of $25 per month and maintenance/' said position Ijeing obsolete. 

(Adopted Noveml)er 29, 1918. Approved by the Governor, . Deceml)er 16, 
1918.) 

Pawling Sanitarium, Rensselaer County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, county service, be and hereby 
is amended by striking out the words '* In the Lakeview sanitarium, Rensse- 
laer county: cook; orderly; clinical assistant'* and substituting in lieu 
thereof the words " In the Pawling sanitarium, Rensselaer couivt'^ \ q.tw^ TfiaJtt^-^ 



T50 Report of State Civil Service Commission 

and head nurse; laboratory assisftant; cook; orderly; clinical assistant," 
for the purpose of changing the title of the institution and by adding to 
the Non-Competitive Class the positions of matron and head nurse, and 
laboratory assistant, competitive examination for said positions having been 
found to be not practicable. 

(Adopted November 30, 1918. Approved' by the Governor, December 16, 
1918.) 

Narcotic Drug Control 

Resolved, That, subject to the approval of the Governor, and in accord- 
ance with the provisions of sections 1 and 2 of the Civil Service Law, the 
classification of positions in the Kxempt Class in the State Service be and 
hereby is amended by adding thereto the following: "In the Department 
of Narcotic Drug Control: First deputy; second deputy; third deputy; 
secretary," these positions being established by section 422, chapter 639, 
Laws of 1918. 

(Adopted December 12, 1918. Approved by the Governor, December 16, 
1918.) 

Onondaga County Service 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the £xempt Class, Onond'aga county service, in the office of 
the Superintendent of the Poor, be and hereby is amended by striking out 
the words "one keeper; one matron,'' and by adding to the classification of 
positions in the Exempt Class, Onondaga county service, the words "In 
the County Home: the keeper; one matron,'' for the purpose of amending 
the classification to conform to the provisions of chapter 235, Laws of 1911. 

(Adopted December 12, 1918. Approved by the Governor, December 16, 
1918.) 

Pleasant Valley Sanatorium 

Resolved, That, subject to the approval of the Governor, the classificatiun 
of positions in the Non-Competitive Class in the Pleasant Valley sanatorium, 
Steuben county, be and hereby is amended by adding thereto the word 
" laundress,*' competitive examination for said position having been found 
to be not practicable. 

(Adopted November 30, 1918. Approved by the Governor, December 16. 
1918.) 

Board of Supervisors, Albany County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class under the Board of Supervisors, Albany 
county, be and liereby is amended by striking out the words: "Architectural 
adviser," said position now being obsolete. 

(Adopted November 27, 1918. Approved by the Governor, December 16, 
1918.) 

Superintendent of Weights and Measures 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Exempt Class be and hereby is amended as follows: In 
the office of the Superintendent of Weights and Measures, strike out: "Tbe 
second deputy." 

(Adopted September 6, IftYI. Ai^^toved by the Governor, December 16, 
1918.) 



Amendments to State Civil Service Classification 751 
Commissioner of Charities and Corrections, Westchester Coimty 

. Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class in the office of the Commissioner 
of Charities and Corrections, Westchester county, be and hereby is amended 
by striking out the words "three fellowship students, county penitentiary, 
$500 a year and maintenance while at the institution," said position being 
obsolete. 

(Adopted December 19, 1918. Approved by the Governor, December 30, 
1918.) 

Rocky Crest Sanatorium, Cattaraugus County 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the Non-Competitive Class, in the Rocky Crest sanatorium, 
Cattaraugus county, be and hereby is amended by adding thereto the word 
" housekeeper," competitive examination for said position having been found 
to be not practicable. 

(Adopted December 19, 1918. Approved by the Governor, December 30, 
1918.) 

State College of Forestry, Syracuse University 

Whereas: The Attorney-General has held in communica/tion dated Novem- 
ber 20, 1918, to the "Dean of the New York State College of Forestry, 
Syracuse University, Syracuse, that the employees of said college are 
in the civil service of tlie State of New York and are, therefore, subject to the 
provisions of the civil service law and rules; and 

WTiereas: It is the opinion of the Attorney-General, January, 1911, that 
action should be taken by the Commission providing in substance that where 
by operation of law, action of the Commission, or otherwise, positions in 
the service of a civil division, subject to the civil service rules, are changed 
in classification so as to pass from the unclassified to the classified service, 
or from the exempt to the competitive class of the classified service, the 
incumbents of the positions shall be deemed legally in office and may continue 
therein without examination; 

Therefore, be it 

Resolved, That, subject to the approval of the Governor the provisions of 
the civil service law and rules be extended to the offices, places and employ- 
ments at the State College of Forestry, Syracuse University, Syracuse, 
effective December 16. 1918, and the persons holding positions in the classified 
service on that date shall be deemed to be legally in office and may continue 
therein without examination. 

It was also 

Resolved, That, subject to the approval of the Governor, the classification 
of positions in the exempt class. State service, be and hereby is amended by 
adding thereto the following: 

" In the State College of Forestry, Syracuse University : Secretary, 
Board of Trustees; assistant treasurer (treasurer of university)." 



752 Report of State Civil Service Commission 

It was also 

Resolved, That, subject to the approval of the Governor, the following 
positions at the Stp,te College of Forestry, Syracuse University, filled- as 
indicated on December 16, 1918, be recognized as being in the competitiTe 
class of the classified civil service of the State: 

Cashier J.W.Webber $1,600 OOaywr 

Secretary to dean Lillian Lang 1,000 00 " 

Bookkeeper Helen H. Hopkins 960 00 ' 

Stenographer Ruby W. Howe 900 00 " 

Stenographer Maude R. Miller 840 00 " 

Librarian Eleanor Church 850 00 * 

Register Edna E. Whiteley 840 00 * 

Clerk, filing and mailing Fred Parsellfl 640 00 " 

Janitor (superintendent of building) A. M. Francis 900 00 ** 

Engineer and assistant janitor John Bany 900 00 

Fireman CharlesWise 860 00 " 

Assistant firenum W. G. Finch 840 00 * 

Bookkeeper Wilbur Bradder 400 00 * 

Stenographer C. Lucile Tanner 900 00 * 

It was also 

Resolved, That, subject to the approval of the Governor, the following 
positions at the State College of Forestry, Syracuse, New York, filled a» 
indicated on December 16, 1918, be recognized as being in the non-competitive 
class of the classified civil service of the State: 

Nurseryman C. F. Baker $840 OOayear 

Foreman Delmar L. Sage 840 00 * 

(Adopted December 12, 1918. Approved by the Governor, December 30. 
1018.) 



REQUESTS FOR CHANGES IN THE STATE CIVIL 
SERVICE RULES AND CLASSIFICATION DENIED 

County Judge and Surrogate, Richmond County; 

Resolved, That the application of County Judge and Surrogate Tiernan, 
Richmond County, for classification in the Exempt Class of the position of 
secretary to the County Judge, be and hereby is denied, aB the Commission 
does not feel that it can exempt this position as the provision of the statute 
allowing the County Judge and Surrogate one exempt jmsition is met in the 
position of confidential clerk. 

(January 18, 1918.) 

County Treasurer, Suffolk County 

Resolved, That the application of the County Treasurer of Suffolk county 
for classification in the Exempt ClaBs of the position of private secretary to 
the co\mty treasurer, be and hereby is denied. 

(January 19, 1918.) 

Treasurer, Erie County 

Resolved, That the application of Treasurer Bard of Erie county for classi- 
fication in the Non-Competitive Class of the position of messenger, be and 
hereby is denied, as it is contrary to the policy of the Commission to place 
the position of messenger either in the exempt or the non-competitive class. 

(January 24, 1918.) 

District Attorney, Suffolk County 

Resolved, Tliai the application of District Attorney Young, Suffolk county, 
for classification in the J^xempt Class of the position of confidential clerk, 
salary $500 a year, be and hereby is denied, as the Conunission believes that 
competitive examination for the position of confidential clerk is entirely prac- 
ticable. 

(January 24, 1018.) 

Attorney-General 

R(»solved, That the application of the Attorney General for classification in 
the Exempt Class of one position of *' secretary to the deputy in charge of the 
Court of Claims Bureau," be and hereby is denied, as the Commission believes 
that it would bo entirely practicable to fill the place either by promotion or 
appointment as the result of competitive examination. 

(February 7, 1018.) 

Food Commission 

Resolved, That the application of the Food Commission for classification in 
the Exempt Class of ten positions of supervisor of crop and meat production 
and conservation, be and hereby is denied as the ten positions referred to 
are not permanent in character. 

(February 27, 1018.) 

[753] 



754 Eepobt of State Civil Service Commission 

State Comptroller 

Resolved, That the application of the State Comptroller for classification in 
the Exempt Class of the position of confidential messenger, $1500 a year, be 
and hereby is denied, as the Commission is of the opinion that upon the in- 
formation furnished it is practicable to fill the place as the result of competi- 
tive examination. 

(February 27, 1918.) 

Commissioner of Charities and Corrections, Westchester County 

Resolved, That the application of the Commissioner of Charities and Cor- 
rections, Westchester county, for classification in the Labor Cla^s of the 
positions of meat cutter and assistant storekeeper, and baker, be and hereby 
is denied. 

(March 15, 1918.) 

Department of Elxcise 

Resolved, That the application f>f Commissioner of Excise Sisson for classi- 
fication in the Exempt Class of tlie position of assistant cashier, $1800 per 
year, and position of assistant purchasing agent, $1200 a year, be and hereby 
is denied, as the Commission is of the opinion that upon the information fur- 
nished it is practicable to fill the places as the result of competitive examina- 
tion. 

(April 10, 1918.) 

Board of Supervisors, Nassau County 

Resolved, That the application of the Board of Supervisors, Nassau county, 
for clasbificatioii as exempt of position of superintendent of buildings, be and 
hereby is denied, as the Commission believes that a special examination could 
be held subject to detailed specifications to be submitted. 

(May 31, 1918.) 

Custodial Asylum, Rome 

Resolved, That the application of Superintendent Bernstein, State Custodial 
Asylum at Rome, for classification as Non-Competitive of the positions of 
head carpenter and head farmer, be and hereby is denied, as the Commission 
believes that competitive examination appears to be practicable for filling the 
places with compensation at $1200 a year and maintenance. 

(July 2, 1918.; 

Department of Elxcise 

Resolved, That tlie application of Commissioner of Excise Sisson for classi- 
fication in the Exempt CIhss of the position of cashier in the offiw of the 
special <lcputy conmiissioner of excise for the counties of Richmond, On<»n- 
daga and Nassau, be and hereby is denied, as the Commiission is of the opinion 
that competitive examination for the place is entirely practicable. 

(July 2, 1918.) 

Food Commission 

Resolved, That the application of the State Food Commission for classifi- 
cation as exempt of the position of " assistant to the Publicity Director in 



Changes in State Civil Service Eules Denied 755 

charge of the Foreign Press " be and hereby is denied upon the information 
presented, as the Commission feels that the place is one which it is practica- 
ble to fill as the result of competitive examination. 
(July 2, 1918.) 

Great Meadow Prison 

Resolved, That the application of Agent and Warden Homer of Great 
Meadow Prison, requesting that the position of farmer at Great Meadow 
Prison be included in the Labor Class be and hereby is denied. 

(July 2, 1918.) 

Letchworth Village 

Resolved, That the application of Superintendent Little, Letchworth Village, 
for classification as non-competitive of the position of farm manager, salary 
$1200 a year and maintenance, be and hereby is denied, as positions of this 
character are generally classified as competitive. 

(July 2, 1918.) 

Secretary of State 

Resolved, That the application of Secretary of 2!i^ate Hugo, for classifica- 
tion as exempt of two additional positions of caisliier, Automobile Bureau, 
be and hereby is denied. It appearing from the correspondence and the records 
in the office of the Commission that there are now three exempt positions of 
cashier in the Xew York office. Automobile Bureau, it was the opinion of the 
Commission that the request for exemption of a fourth ])osition of cashier in 
the New York office should be denied. 

(July 2, 1018.) 

State Commission for the Blind 

Resolved, That the application of the State Commission for the Blind for 
classification as exempt of the position of bookkeeper, be and hereby is denied, 
as the Commission feels that it cannot see its way clear to exempt the 
pfjsition from examination, as places of this character are usually competi- 
tive. 

(July 3, 1918.) 

Fiscal Supervisor of State Charities 

Resolved, That the application of Fiscal Supervi^sor of State Charities 
Utter for classification as exempt of the positions of confidential clerk $1000 
a year, and confidential inspector, $2400 a year be, and hereby are denied on 
the information presented. 

(July 3, 1918.) 

Secretary of State 

Resolved, That the application of the Secretary of State for classification as 
exempt of the position of cashier in the Automobile Bureau. Albany office, 
salary ;f900 a year, be and hereby is denied, as the Commission iB of the 
opinion that it is practicable to fill the place as the result of competitive ex- 
amination. 

(July 10, 1918.) 



756 Report of State Civil Service Commission 

Department of Excise 

Resolved, That the application of the Commissioner of Excise for classifica- 
tion as exempt of the position of watchman in the Brooklyn office of his de- 
partment for a period from September 1, to October 31, 1918, be and hereby is 
denied as it is the opinion of the Commission that as the emplo}'roent rtf 
the watchman is limited to the certificate issuing period, it would not be td- 
yisable to add another place to the Exempt Class. 

(July 27, 1918.) 

State Commission on Feeble Minded 

Resolved, That the application of Walter B. James, M. D., Chairman, Stat€ 
Commission on Feeble-Minded, for classification as exempt of the position of 
registrar in his department, be and hereby is denied, as the Conomission is of 
the opinion that competitive examination for the place is not practicable. 

(July 27, 1918.) 

Banking Department 

Resolved, That the application of Superintendent of Banks George I. Skin- 
ner, for classification as exempt or non-competitive of one additional position 
of confidential examiner in his department, be and hereby is denied, as the 
Commission is not satisfied that the position in question is one that can not 
properly be filled as the result of examination, and in view of the fact that 
a new eligible list for the position of bank examiner has been recently esttb- 
lished with due co-operation with the Banking Department. 

(Septeml>er 13, 1918.) 

State Comptroller 

Resolved. That the application of the Comptroller for classification as ex- 
empt of the position of deputy transfer tax assistant, Surrogate's office, Xev 
York county, be- and hereby is denied, no satisfactory reason having been 
shown that competitive examination for the place is not practicable. 

(September 13, 1918.) 

State Food Commission 

Resolved, That the application of the State Food Commission for classifict- 
tion in the Exempt Class of the position of assistant director of the Bureau of 
CoiiHervation for the State outside of the city of New York, be and hereby is 
denie<l, as the Commission is of the opinion that the position should be com- 
petitive and that a special examination should be held. 

(October 7, 1918.) 

County Auditor, Suffolk County 

Resolved, That the application of County Auditor Corwin, Suffolk county, 
for elassilieation as non-competitive of the position of jail physician be and 
hereby is denied, in view of the prevailing practice of the Commission to carry 
the position of jail physician in the Competitive Class. 

(October 7, 1918.) 



AMENDMENTS TO STATE CIVIL SERVICE 

REGULATIONS 

Regulation IV 

ResolvLHl, That Regulation .IV, siibdiviRion 6, be amended by adding at the 
end thereof the words: " candidateH for fish and game protector, Conservation 
Commission, must be at least 6 feet 8 inches in height." 

(February 20, 1918.) 

Resolved, Thai Regulation IV, subdivision 6, relating to the limit of age at 
the time of examination, be and hereby is amended so as to provide that the 
minimum age limits of candidates for the position of assistant supervisor, 
Juvenile Placement Department, Bureau of Employment, State Industrial 
Commission, be fixed at eighteen years instead of twenty-one years, provided 
that all persons appointed to the Juvenile Placement work between the ages 
of eighteen and twenty-one years shall not be assigned to the regular work 
of placing and advising juveniles, but that until after the appointee's twenty- 
first year he shall be ai^signed to clerical and review work only. 

(February 21, 1918.) 

Resolved, That Regulation IV. subdivision 5, fixing the limits of age at the 
time of examination for certain positions, be and hereby is amended by add- 
ing to the list of positions for which the minimum age is eighteen years the 
words: •* bookkeeper, fourth grade." 

(February 27, 1918.) 

Resolved, That Regulation IV, subdivision 5, relating to limits of age at 
the time of examination, be and hereby is amended by adding thereto the fol- 
lowing: "Junior statistical clerk, grade 5, minimum, eighteen years." 

(April 10, 1918.) 

Resolved, That Regulation IV, subdivision 5, relating to the limits of age 
at the time of examination, be and hereby is amended so as to provide that 
the minimum age limit of candidates for position of telephone operator shall 
be 18 years instead of 21 years. 

Resolved, That Regulation IV, subdivision 6, be amended by striking out 
the words, " candidates for fish and game protector, Conservation Commission, 
must be at least 5 feet 8 inches in height," and substituting in lieu thereof 
the words " candidates for fish and game protector. Conservation Commis- 
sion, must be at least 5 feet 7 inches in height, provided, however that prefer- 
ence will be given to candidates not less than 5 feet 9 inches in height who 
also have superior physical qualifications." 

(May 22, 1918.) 

Resolvtd, That Regidaton IV, subdivision 5, with reference to the limits of 
age at the time of examination, iw and hereby is amended so as to provide 
that the minimum age of candidates for the position of messenger shall be 
sixteen years instead of eighteen years, said amendment to become effective 
July 1, 1918. 

(July 2, 1918.) 

[7571 



758 Report of State Civil Service Commission 

Resolved, That Regulation IV, subdivision 5, with reference to the limits 
of age at the time of examination, be and hereby is amended so as to provide 
that the minimum age for the position of bodckeeper, fifth grade, shall be 
nineteen years instead of twenty-one years. 

(July 27, 1918.) 

Resolved, That Regulation IV, subdiviision 5, relating to Iimit« of age at 
time of examinations, be and hereby is amended by striking out the minimiun 
age of sixteen years for applicants for position of clerk, and substituting in 
lieu thereof a minimum age of fifteen years, provided that this change shall 
not remain in force for a period longer than six montlrs after the termination 
of the existing war with the German Empire. 

(November 7, 1918.) 

Regulation VII 

Resolved, That Regulation VII, subdivision 6, be and hereby is amended bv 
adding thereto the following: " Subject to the provision of section 14 of 
the Civil Service Law, certifications from the eligible lists for the positions 
of senior market inspector, market inspector, senior food distribution inves- 
tigator nnd food distribution investigator, State Food Commission, shall be 
made by groups as follows: Group 1. Residents of the First and Second 
Judicial Districts. Group 2. Residents of the other Judicial Districts. 

(April 18, 1918.) 

Resolved, That Regiilation VII, subdivision 6, prescribing list of positions, 
the duties of which are confined to a locality outside of Albany county, for 
which certification shall be made by judicial districts, be and hereby is 
amended in the first part thereof by adding thereto the words " farm mana- 
ger." 

Resolved, That Regulation VII, subdivision 6, prescribing list of positions, 
the duties of which are confined to a locality outside of Albany county, for 
which certification shall l>e made by judicial districts, be and hereby is 
amended m the first part thereof by adding thereto the word " cashier." 

Resolved, That Regulation VII, subdivision 6, prescribing list of positions, 
the duties of which are confined to a IcK-ality outside of Albany county, for 
which certification shall be made by judicial districts, be and hereby is 
amended in the first part thereof by adding thereto the words " head car- 
penter, head farmer." 

(July 2, 1918.) 

Resolveil, That Regulation VII, subdivision 6, be and hereby is amended by 
striking out the followinc:: ** f^ibjoct to the provisions of section 14 of the 
Civil Service Law, certifications from the eligible list for the position of prison 
guard shall be made by groups, as follows: 

Group 1. Sing Sing Prison. Residents of the first, second and ninth judicial 
districts. 

Group II. Clinton and Great Meadow Prisons. Residents of the third and 
fourth judicial districts. 

Gjroup III. Auburn Prison. Residents of the fifth, sixth, seventh and eighth 
judicial districts. 

(July 10, 1918.) 



Amendments to State Civil Service Regulations 759 

Regulation XI 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading *' In the Onondaga County Penitentiary," by 
striking out the words: "matron (wife of superintendent)'* and substituting 
in lieu thoreof the wordw: *' head matron (wife of superintendent)." 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " In the Onondaga Coimty Tuberculosis Sana- 
torium," by adding the words: "kitchen hclp<»r: aHsistant kitchen helper." 

Resolved, That Regulation XI, pcwiitions classed as laborers, be and hereby 
is amended under the heading *' In the office of the Superintendent of Build- 
ings, Westchester County,'" by striking out the words: "cleaners, county 
court house, comi)enHation not to exceed $70 per month," and inserting in lieu 
thereof the words: " deanerni, county court house, compensation not to exceed 
$100 per month." 

(January 18, 1018.) 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading. " In the office of the Superintendent of Build- 
ings, Westchester County," I)y striking out the words: *'■ cleaners, county court 
house, compensation not to excetd $70 per month," and inserting the words: 
*' laborers and cleaners, county court house, compensation not to exceed $100 
per month." , 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading: ** In the Onondaga County Tuberculosis Sana- 
torium," by adding thereto the word " waiter," competitive or non-competitive 
examination for said position having been found to l>e not practicable. 

(February 13, 1918.) 

Resolved, That Regulation XT. positions classeil as laborers, be and hereby 
is amended under the heading " In the Bronx Parkway Commission " by »trik- 
ing out the words " laborer or t ree trimmer, compensation not to exceed $3 
per day," and inserting in lieu thereof the words " laborer or tree trimmer, 
compensation not to exceed $4 per day." 

(March 15, 1918.) 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
i» amended imder the heading: *' In the office of the Superintendent of the 
Poor, Ulster county," by striking out the words " gardener, compensation 
not to exceed $15 per month " and substituting in lieu thereof the words 
** gardener, compensation not to exceed $25 per month." 

Resolved, That Regulation XT, positions classed as laborers be and hereby 
is amended under the heading " In the office of the Commissioner of Charities 
and Corrections, Westchester county;" by adding thereto the word "gar- 
dener," competitive examination for such position having been found to be 
not practicable. 

(May 2, 1918.) 

Resolved, That Regulation XT, positionis classed as laborers be and hereby 
is amended under the heading " in Sing Sing Prison " by adding thereto the 
word ** domestic," examination for said position having been found to be not 
practicable. 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading "In the State School of Agriculture and 



760 Report of State Civil Service Commission 

Domestic Science, Delhi " by adding thereto the word " teamster," competi- 
tive or non-competitive examination for said position having been foimd to 
be not practicable. 

Resolved, Tliat Regulation XI, positions classed as laborers, be and hereb? 
is amended under the heading *' In the Department of Highways, Onondaga 
county " by striking out the words " steam shovel operator, compensation not 
to exceed $125 per month when employed " and substituting in lieu thereof 
the words ** steam shovel operator, compensation not to exceed $150 per 
month when employed." 
(May 22, 1918.) 

Resolvcxl, Thai Regulation XI, positions classed as laborers be and hereby 
is amendwl under the heading *' In the office of the Health Officer, of the 
Port of Xew York," by striking out the words "deckhand; painter's helper; 
six laborers engaged in fumigating work. compensation not to exceed $75 per 
month, *' and sulrstituting in lieu thereof ''attendant, whose duties shall be 
keeping boats clean, walks in order, fumigating, helping in mechanical occu- 
pations, laundry work or ordinary manual labor." 
(May 31, 1918.) 

Re8olve<l, That, Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading ** In the State College for Teachers at Albany" 
by striking out the words *' laborer and watehman " to take effect June 15, 
1918, it appearing that the persons employed in this position are not en- 
gaged at ordinary manual labor. 
(June 7, 1918.) 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading: " State Charitable and Reformatory Institu- 
tions" by adding thereto the words ''assistant baker, Custodial Asylum at 
Rome," competitive or non-competitive examination for said position being 
deemed to be not practicable. 

Resolved, That Regulation XT. positions classed as laborers, be and hereby 
is amended under the lioadinp " In the Department of Highways, Onondaga 
county," by striking out tlio words '* skilled laborers, compensation not to 
exceed $100 per month wlicii employed" and substituting in lieu thereof the 
words "skilled laborers, eonipensation not to exceed $115 per month when 
employed." 

Resolved, That Regulation XI, positions classed as laborers be and hereby 
is amended under tlie heading ** State Charitable, Penal and Reformatory 
Institutions " by adding tliereto tlie words " assistant steam fitter and 
plumber, Craig Colony at Sonyea," competitive or non -competitive examina- 
tion for said position liaving been foinid to be not practicable. 
(June 12, 1918.) 

Resolved, That Regulation XI, positions elasHinl a's laborers, be and hereby 
is amended inuler the lieadin^ '' In the Univeraity of the State of New York" 
l>y striking out the words - apprentice to compositor " and substituting in 
lieu thereof tlie words " compositor's apprentice," "said change to become 
effective July 1, 1918. 

ResolvcHl, Tliat Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading ** In the State School of Agriculture on Long 
Island, Farmingdale," by adding thereto the words '*cook; janitor in dormi- 
tories; vegetable man*, head wvvvtev, dish washer." 



Amendments to State Civil Service Regulations 761 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended by striking out the heading " In the lola Sanatorium, Monroe 
county •*' and substituting in lieu thereof " Monroe Coimty Tuberculosis Sana- 
torium.** if 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " In the Department of the Trustees of the 
City and County Hall, Erie county " by adding thereto the words " laborer- 
fuel man," competitive or non-competitive examination for said position hav- 
ing been found to be not practicable. 

(July 2, 1918.) 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " County Service " by inserting therein the fol- 
lowing : " In the Pleasant Valley Sanatorium, Steuben coimty ; kitchen 
helper; waitress,*' competitive or non-competitive examination for said posi- 
tion having been found to be not practicable. 

Resolve<l, that Regulation XT, positions classed as laborers, be and hereby 
is amended under the heading ** In the Office of the Health Officer of the 
Port of Now York " by adding thereto the words *' boatman and laborer for 
service at City Island," competitive or non-competitive examination for said 
position having been found to be not practicable. 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading ** In the office of tlio Health Officer of the 
Port of Xew York," by adding thereto the words " laundry helper," competi- 
tive or non-competitive examination for said position having been found to 
be not practicable. 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " In the office of the Conservation Commis- 
sion " by striking out the words " laborer employed as guide and woodsman, 
compensation not to exceed $2.50 per day," and substituting in lieu thereof 
the words " laborer employed as guide and woodsman, compensation not to 
exceed $3 per day." 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " county service " by adding thereto the fol- 
lowing: "In the Niagara County Sanatorium: laborer; maid.", competi- 
tive or non-competitive examination for said positions having been found to 
be not practicable. 

(July 27, 1918.) 

Resolved, That Regulation XT, positions classed as laborer, be and hereby 
is amended imder the htading " In the Bronx Parkway Commission," by 
adding thereto tlie word " janitress," competitive or non-competitive exami- 
nation for f-aid position having been found to be not practicable. 

Resolved, That Regulation XT, positions classed as laborers, be and hereby 
is amended under the heading " In the office of the Conservation Commis- 
sion," by striking out the words " laborer employed as guide and woodsman, 
compensation not to exceed $3 per day " and substituting in lieu thereof the 
words *' l^aborer employed as guide and womlsman, compensation not to ex- 
ceed $90 a month." 

(September 13, 1918.) 



762 Report of State Civil Service Commission 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " In the Oswego County Tuberculosis Hospi- 
tal " by adding thereto the word " orderly," competitive or non-competitife 
eicamination for said position having been found to be not practicable. 

(October 7, 1918.) 

Resolved, That Regulation XI, i>ositioniB classed as laborers, be and hereb? 
is amended under the heading ** In the office of the Sheriff, Suffolk county." 
by adding thereto the words "matron and supervising jani tress (wife of 
Sheriff),'* competitive or non-competitive examination for said position hav- 
ing been found to be not practicable. 

Resolved, That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading ** In the Department of Highways, Onondaga 
county," by striking out the words ** steam shovel operator, compensation 
not to exceed $150 per month when employed " and substituting in lieu 
thereof the words * 'steam shovel operator, compensation not to exceed $175 
per month when employ etl." 

(October 21, 1918.) 

Resolv(H], That Regulation XI, positions classed as laborers, be and hereby 
is amended under the heading " county service " by striking out the words 
"In tht (Lakeview Sanatarium, Rensselaer county: domestic; cleaner," and 
substituting in lieu thereof tlie words " In the Pawling Sanitarium, Rensse- 
laer county: domestic; cleaner; laborer," for the purpose of changing the 
title of the inHtitution and adding to the classification the position of 
" laborer," for which con«pctitive or non-competitive examination is not 
practicable. 

Resolved, That Regulation XI, positions classed as laborers be and hereby 
is amended under the heading " In the Pleasant Valley Sanatorium, Steuben 
county " by adding tlie words " assistant cook," competitive or non-competi- 
tive examination for said position having been found to be not practicable. 

(November 30, 1918.) 

Resolved, That Regulation XT, poHitions classed as laborers, be and hereby 
is amendiHl under the heading " county service " by striking out the words 
"In the office of the Superintendent of the Poor, Onondaga county: waitress; 
laundress; teamster; fanner; cook; Tscamstress; janitor; orderly; kitchen 
helper; kitchen girl; ward liclper; laborer," and substituting in lieu thereof 
"In the County Home, Onondaga county: waitress; laundress; teamster; 
farmer; cook, seamstress; janitor; orderly; kitchen helper; kitchen girl: 
ward helper; laborer." 

(December 12, 1918.) 

Resolved, That Regulation XI, positions cla8se<l as laborers, be and hereby 
is amended by abiding tlicivlo the words '* In the State College of Forestry, 
Syracuse University: Ysirdnian; teamster; laborer;" competitive or non- 
competitive examination f(;r said positions having been found to be not prac- 
ticable. 

(December 12, 1018.) 

Resoh'ed, That Regulation XI, positicms classed as laborers, be and hereby 
is amended under the heading "In the Erie County Lodging House" by 



Amendments to State Civil Sekvice Eeoulations 703 

adding thereto tlie wurds *' laundryman and laborer/' competitive or non- 
competitive examination for said positions having been found to be not 
practicable. 

Resoh'cd, That Regulation XI. positions classed as laborers, be and hereby 
is amended under the heading ** In the Homestead Sanatorium, Saratoga 
county " by adding thereto the word " cleaner," conrpetitive or non-com- 
petitive examination for said position having been found to be not practicable. 

(December 12, 1918.) 



APPENDIX C 



Digest of Court Decisions 
Opinion of Attorney-General 



[765] 



ft] 



DIGEST OF COURT DECISIONS 
Civil Service Law 

-4 ppointment of One Standing Second on Eligible List — When Not an Infring- 

ment of the Letter of the Statute 

At the time of the enactment of chapter 628 of the Laws of 1917, by which 
" Riker's Island," theretofore used as a dumping ground, was made the loca- 
tion of a new correctional institution unlike any then existing in the city 
and called in the statute ** The Municipal Farm of The City of New York," the 
position of warden at Hiker's Island was vacant. The name of B, the only 
keeper under the existing rules Avith respect to promotion who had served a 
sufficient length of time to be entitled to take an examination for the position 
of head keeper or deputy warden, and who at the time was serving as a 
deputy warden of the Tombs prison, having been alone certified for appoint- 
ment by the local civil service commission, B, at the suggestion of the com- 
missioner of corrections, signed a declination of his appointment and said 
commissioner thereupon made a new requisition for the certification of addi- 
tional names, explaining at length the nature of the duties of the new position 
and that a more correct title therefor would be siiperintendent, the title used 
in similar institutions in diiTerent parts of the country, and calling attention 
to the fact that the experience and other qualifications required for the 
examination given to e^4tablish an eligible list for superintendents of indus- 
tries in the city were much greater than those required for warden of a par- 
ticular institution of the department of correction. The local civil service 
commission thereupon certified a hist of three names taken from the list of 
those eligible for appointment as superintendent of industries in the depart- 
ment of correction. Hcld^ that the appointment of II, who stood second on 
the list, not only did not infringe the letter of the Civil Service Law but was 
in a conspicuous degree an observance of the spirit thereof. (0*Reilley t;. 
Lewis, 105 Misc. Rep. 380.) 

By chapter 211 of the Laws of 1918, section 22-a, which provides for a 
separate eligible list for persons in Finleral military, naval or marine service, 
was added to the Civil Service Law. 

COHOES 

Exempt Fncman — Ptotcction Against Removal Without Cause 

Section 22 of the Civil Servic*^ Law protects an exempt fireman against 
removal without cause from the office of commissioner of public safety of a 
municipality. Under section 62 of the charter of the city of Cohoes the 
mayor is vested with power to remove from office the commissioner of public 
aaCety, and where the written charges made by the mayor against said com- 
missioner, who is an exempt fireman, consist of a recital of acts on his part 
concerning the propriety and legality of which there may be a difference of 
opinion, and a liearing of the charges before the mayor may or may not lead 
to the conclusion that there was misconduct on the part of relator, a per- 
manent writ of prohibition will be denied and an order will be granted 
authorizing the mayor to proceed as if an alternative writ of prohibition had 
not issued. (People ex rcl. Kennedy v. Foley, 104 Misc. Rep. 684.) 

1767[ 



768 Report of State Civil Seevice Commission 

MOUNT VERNON (CITY OF) 

Appontment of Police Sergeants from Patrolmen — L<PW8 1909, Chapter 476 
Under the charter of the city of Mount Vernon, as amended* by Laws of 
1909, chapter 476, the appointment of police sergeants from patrolmen is not 
at the pleasure of the commissiontr so as to admit the argument that such 
appointees are fro« from the civil service provisions of the Constitution, the 
statutes and the rules prescribed by the city authorities the words *'at 
pleasure " as used in said statute refer only to the demotion of police sergeants 
by the commissioner of police and do not mean that demotion may be made 
upon the mere caprice or whim of the commissioner. The duties of a police 
sergeant, even if they include such superintendence of the members of the 
force as requires a report of the performance of their various duties, do not 
necessarily " involve trust and confidence which are personal to the appointing 
officer," so that the tests of civil service applied to patrolmen cannot result 
in the indication of thoee who as sergeants will perform their whole duties. 
(People ex rel. Curtis t\ Hogeboom, 185 App. Div. 777.) 

Municipal Civil Service Commission 

No Power to Annul Eligible List for Promotion from Position of Nurse io 

Supervising Nurse 

Where a municipal civil service commission has promulgated a list of eligi- 
bles for promotion it has no power to annul such action* That upon an 
examination held under the direction of a municipal civil service commission, 
for promotion from the position of nurse to that of supervising nurse, acting 
supervising nurses were permitted to rate themselves and other nurses as to 
previous experienco, did not justify a revocation of the list of eligibles pro- 
mulgated after said examination, where the commission before promulgating 
the list refused to cancel the examination on such ground, it appearing that 
said ratings, which wore merely tentative, were subsequently reviewed by 
three separate bodies. The fact that several nurses at the top of the list 
voluntarily waived their precedence in favor of an acting supervising nur^e 
so tliat she might retain her position could not have the effect of annulling 
the list previously establislicd. A division of the list into two classes, one 
relating to child hygiene, the otlier to preventable diseases, with the result 
that a nurse far down the general list might nevertheless have a higher 
rating in one division and thub receive an appointment in advance of a 
nurse outranking her on the general list, finds neither w^arrant in any 
statute nor in the commission's own regulations. (People ex rel. Finnegan r. 
McBride, 104 Misc. Rep. 153.) Upon afiirming the order of the Special 
Term granting relator's motion for a peremptory writ of mandamus, the 
court (185 App. Div. 482), said: ** Such an order as the one in this case was 
approved in Peope ex rel. Fowler v. Markowitz, 175 App. Div. 710, 713; affd., 
220 N. Y. 669." 

State Department of Excise 

Special Agent — Doubt as to Cause of Removal 
The order for an alternative writ of mandamus granted in People ex rel. 
Cahill V. Green, 103 Mi.sc. Rep. 717, upon the application of relator, an 



Amendments to State Civil Service Kegulations 709 

exempt fireman, for reinstatement as a special agent in the State Department 
of £2ccise was unanimously affirmed (182 App. Div. 903) upon the opinion of 
Chester J., at Special Term wherein he says: *' Because of the doubt thrown 
upon the cauw of removal by reason of the alleged oral statement claimed to 
have been made to the petitioner by the defendant it seems to me that a 
proper cattc is presented for an alternative writ, in order that the real facts 
may be ascertained, before the court is called upon to apply any measure 
of relief." 

YONKERS (CITY OF) 
Removal of Veteran Fireman from Position of Probation Officer Must he on 

Charges 

Where a veteran volunteer fireman has been appointed to the position of chief 
probation officer of the court of special sessions in the city of Yonkers, as said 
position is classified in the competitive class by the municipal civil service 
commission with the approval of the mayor and of the State Civil Service 
Commission, said probation officer cannot be removed without charges and 
without a hearing at the pleasure of the city judge. (People ex rel. Garrity 
t?. Walsh, 181 App. Div. 118.) 

25 



OPINION OF ATTORNEY-GENERAL 

Civil Service Law, § 9 — Classified and Unclassified Service ~ 

Poundmaster 

The poundmaster of the city of Mount Vernon is not the head of a 
department of government but is in the classified civil Bervice of the city. 

STATEMENT 

The office of poundmaster in the city of Mount Vernon, for 
many years classified by the Municipal Civil Service Commission, 
with the approval of the State Civil Ser\-ice Commission, in the 
non-competitive class, was the subject of a resolution of the 
Municipal Civil Service Commission, on March 25, 1918, which 
provides : 

" Resolved, That the position of poundmaster, now classed under the 
Rules of the Municipal Civil Service Commission of the City of Mount 
Vernon, New York, in the noncompetitive class, be changed so that the 
isaid position shall be in the unclassified service for the reason that 
pursuant to secti<m 12, article 2, of the Charter of the City of Mount 
Vernon, enacted March 22, 1892, said position was made an appointive 
office at $500 per annum and the incumbent thereof is the head of the 
department." 

INQUIRY 

Was this resolution proper, valid or effective ? 

OPINIOX 

I am satisfied that the Legislature in enacting section 9 of the 
Civil Service Law (originally enacted as section 8 of chapter 370 
of the Laws of 1899) and providing therein that "the head or 
heads of any department of the government '' should be in the 
unclassified service had no intention of keeping such positions as 
poundmaster out of the scope of the civil service examination 
svstem. 

Section 9 of the Civil Service Law provides that certain officer^ 
including " the head or heads of any department of the goveru- 
ment," shall be in the unclassified service and that all officers not 
enumerated as in the unclassified service shall be in the classified 
serv'ice. Appointments in the classified service must be made in 
accordance with the provisions of the Civil Service Law and the 
rules promulgated thereunder and salaries may only be paid to 



Amendments to State Civil Service Kegulations 771 

persons in the classified service after proper certification by the 
Civil Service Commission under section 20 of the Civil Service 
Law. 

The original Civil Service Law (chapter '354: of the Laws of 
1883) provided in section 7 that certain State offices should not be 
subject to its operation and in section 8 that employees in certain 
city departments should not be subject to its general provisions. 
After amendments by chapter 681 of the Laws of 1894, section 1, 
and chapter 186 of the Laws of 1898, section 1, this part of those 
sections of the original statute was rephrased and became section 8 
of the consolidated Civil Service Law (chapter 370 of the Laws 
of 1899) ; and it was in this consolidation for the first time that 
the phrase " the head or heads of any department of the govern- 
ment " was used in defining a group of positions or offices which 
were excepted from the operation of the Civil Service Law. 

The Constitution provides (article V, section 9) that appoint- 
ments and promotions in the civil service of the State, and of all 
the civil divisions thereof, including cities and villages, shall be 
made according to merit and fitness to be ascertained, so far as 
practicable by examinations, which, so far as practicable, shall be 
competitive. Offices and positions in the unclassified service fall 
into two classes: (a) those in which examination as a basis for 
appointment is impracticable and (b) those in which the examina- 
tion is provided for under the Education Law rather than under 
the Civil Service Law. The Legislature has r^arded examination 
as impracticable as a basis for selection of the officers in the first 
group, including " the head or heads of any department of the 
government." The reason is found in the importance of the offices. 
The incumbents should be selected because of their well-known 
ability and responsibility and because their appointing officers are 
held by the electorate responsible for their acts. 

In a city it is obvious that the heads of such departments as the 
department of public safety, the department of public works, etc., 
hold positions of vital importance to the welfare of the community 
and for their behavior in office, including the appointment of 
subordinates, the mayor who appoints them is held responsible by 
the people and his power of appointment should be unrestricted 



772 Report of State Civil Sbbvice Commission 

by any requirement for examination; but it is also obvious thai 
the same is not true of a poundkeeper. 

The charter of the city of Mount Vernon gives a list of officers 
to be appointed by the mayor (Laws of 1911, chapter 82, section 
12). They are commissioner of public works, corporation counsel, 
city clerk, fire commissioner, conmiissioner of charities, health 
officer, one constable for each ward and the poundmaster. The 
fact that these are all mentioned in the same section or that they 
are all appointed by the mayor does not put them all in the same 
branch of the civil service. It is obvious that the fire commissioner 
is the head of a department. It is also obvious that a constable is 
not the head of a department and I think it is almost as obvious 
that the poundmaster is not the head of a department. 

I think " a department of the government " is meant by the 
Legislature to indicate one of the important branches in which 
there are under the " head " a number of subordinate officers anJ 
employees. In cities the police department and fire department 
are obvious examples but I do not think that every independent 
officer who does not happen to be subordinate to any other officer 
is by reason of his independence the head of a department of the 
government. 

Although the phrase " head of a department " was first used in 
the list of positions in the unclassified service with the consolida- 
tion of 1899, the phrase " head of a department '' appeared in 
other parts of the Civil Service Law considerably earlier, particu- 
larly in those parts of the statute forbidding political influence 
over subordinates. In one of the acts I find the phrase '* no head 
of a department or other appointing officer " and it seems to me 
that this phrase gives us the key to what was in the mind of the 
Legislature in putting heads of departments in the unclassificJ 
service. The heads of departments, as the L^islature uses the 
phrase, are " apix^inting officers '^ and because of their power of 
appointment, the ability to exercise which is obviously not 
susceptible of test by examination, they have been placed in the 
unclassified service. This power of appointment rather than inJ(^ 
pendence of action is really what justifies placing the head of a 
department properly in the unclassified service; and consequently 
by his power of appointment rather than by his independence of 



Amendments to State Civil Service Regulations 773 

action must we judge whether a certain officer is or is not " the 
head of a department of the government " within the meaning of 
the phrase as found in section 9 of the Civil Service Law. 

The poundmaster of the city of Mount Vernon has no power of 
appointment. The pound is not a department of the government 
and he is not at the head of anything. He is merely an officer 
appointed by the mayor and acting independently of any superior 
officer, subject to control only by the mayor's power of removal. 
It is perfectly clear to me that the office of poundmaster is in the 
classified sennce under section 9 of the Civil Service Law and that 
the Ihmicipal Civil Service Commission had no power to 
adopt the resolution quoted above and the resolution should be 
disregarded. 

ilERTOX E. LEWIS, 

A ttonxey-General. 

To Hon. Joifn C. Birdseye, Secretary, State Civil Service Com- 
missicrtu Albany, N. Y. 
Dated, August 3, 1918. 



INDEX TO CIVIL LIST 



State Depabtments page 

Agricultural Experiment Station, Geneva 56 

Agriculture, Schoharie School of, Cobleskill 60 

Agriculture and Domestic Science, School of, Delhi 61 

Agriculture, Long Island School of, Farmingdale 59 

Agriculture, School of, MorrisviUe 62 

Architecture 63 

Attorney-General 67 

Banking 71 

Blind, Commission for the 74 

Bridge and Tunnel Commission 75 

Bronx Parkway Conmiission 76 

Charities, Board of 78 

Civil Service Commission 81 

Comptroller 83 

Conservation Commission W 

Elections, Superintendent of 106 

Embalming Examiners, Board of Ill 

Engineer and Surveyor Ill 

Excise 125 

Executive 131 

F-air Commission 133 

Farms and Markets 134 

Feeble-minded, Commission on 145 

Fire Island State Park Commission 145 

Fiscal Supervisor of State Charities 145 

Food Commission 147 

Forestry. College of, Syracuse University 153 

General Herkimer Home Commission 155 

Grant Cottage, Mt. McGregor 155 

Health 155 

Health Council, Public 165 

Health Officer, Port of New York 165 

Highway Commission 168 

Hospital Developnrent Commission 188 

Hospital Commission 189 

Indian Reservations 191 

Industrial Commission 191 

Institute for Study of Malignant Disease 21(1 

Insurance 218 

Land Office, Commissioners of 223 

Military Training Commission 228 

[7751 



776 Index to Civil List 

PAGE 

Mohansic Lake Reservation Commisaion 225 

Monuments Commission 226 

Narcotic Drug Control 226 

Nautical School 227 

Newtown Battlefield Reservation Conmiission 227 

Niagara Reservation Commission 22S 

Port Wardens, Board of 229 

Prisons, Commission of 230 

Prison Department .' 230 

Prisons, Board of Parole for 232 

Prisons, Conmiission on new 232 

Probation Commission 233 

Psychiatric Institute 234 

Public Buildings 234 

Public Buildings, Trustees of 237 

Public Service Commission, First District 238 

Public Service Commission, Second District 279 

Public Works 284 

Racing Commission 297 

Schuyler Mansion, Trustees of 298 

Secretarv of State 298 

Tax Commission 305 

Treasurer 300 

University of State of New York 310 

Washington's Headquarters, Newburgh 325 

Watkins Glen Reservation 325 

State Coubts 

Appeals, Court of 327 

Claims, Court of 329 

Supreme Court, First District 330 

Supreme Court, Second District 339 

Supreme Court, Tliird District 345 

Supreme Court, Fourtli District 345 

vSupreme Court, Fifth jDistrict 346 

Supreme Court, Sixth District 347 

Supreme Court, Seventli District 347 

Supreme Court, Eighth District 348 

Supreme Court, Ninth District 350 

Supreme Court, Appellate Division, First Department 351 

Supreme Court, Appellate Division, Second Department 353 

Supreme Court, Appellate Term, Second Department 344 

Supreme Court, Appellate Division, Third Department 354 

Supreme Court, Appellate Division. Fourth Department 355 

Supreme Court, Referees 356 

State Reporter 356 

Supreme Court Reporter 357 

Miscellaneous Reporter 357 






Index to Civil List 777 

State Normal Schools page 

Albany (New York State College for Teachers) 358 

Brockport 361 

Buffalo 363 

Cortland 366 

Fredonia .366 

Geneseo 368 

New Paltz 370 

Oneonta 371 

Oswego 373 

Plattsburg 375 

Potsdam 376 

State Hospitals fob the Insane 

Binghamton 379 

Brooklyn 381 

Buffalo 382 

Central Islip 384 

Dannemora 386 

Gowanda 387 

Hudson River 388 

Kings Park 390 

Manhattan 393 

Matteawan 396 

Middletown 397 

Rochester 398 

St. Lawrence 399 

Utica 401 

Willard 403 

State Charitable, Penal ajtd Refobmatort Institutions 

Auburn Prison 405 

Auburn Prison for Women 400 

Albion, House of Refuge 422 

Batavia, School for the Blind 424 

Bath, Soldiers' and Sailors' Home 425 

Bedford, Reformatory for Women 428 

Clinton Prison 410 

Elmira, New York State Reformatory 430 

Great Meadow Prison 414 

Hudson, Training School for Girls 435 

Industry, Agricultural and Industrial School 438 

Iroquois, Thomas Indian School 443 

Napanoch, Eastern New York Reformatory 444 

Newark, Custodial Asylum 446 

Oxford, Women's Relief Corps Home 447 

Ray Brook, Hospital for Incipient Tuberculosis 449 



778 Index to Civil List 



PAGE 



Rome, Custodial Asylum 451 

Sing Sing Prison 417 

Sonyea, Craig Colony 453 

Syracuse, Institution for Feeble-Minded Children 456 

Thiells, Letchworth Village 45S 

Valatie, Farm for Women 422 

West Haverstraw, Hospital for Crippled and Deformed Children 461 

Counties 

Albany 463 

Bronx 470 

Chautauqua 4S1 

Erie 483 

Kings 501 

Monroe 519 

Nassau 532 

New York • • 53S 

Niagara 569 

Oneida • • 574 

Onondaga 580 

Orange • 592 

Queens 597 

Rensselaer 605 

Richmond • • 611 

Suffolk 614 

Ulster 619 

Westchester 623 

County probation officers, sealers of weights and measures, superintendents 

of highways, and county tuberculosis sanatoriums. in counties the 

entire service of which has not been classified: 

Probation officers 633 

Sealers of weights and measures 634 

Superintendents of highways 636 

Visiting nurses 637 

Tuberculosis sanatoriums 638 

Villages 

Ilion 644 

Ossining 646 

Peekskill ; 64S 

Port Chester 651 

Police service, towns and villages, Westchester county 653 



GENERAL INDEX 



PAGb 

Agriculture, Long Island School of, Farmingdale, classification amended. 741 

Agricultural Experiment Station, Geneva, classification amended 733 

Agricultural and Industrial School, Industry, classification amended 746 

Albany county, classification amended: 

board of supervisors 731, 750 

Amendments : 

to State Civil Service rules 727 

to State Civil Service classification 728 

to State Civil Service regulations 757 

Appointments : 

during the year without examination, under rule VIII, sub. 5 693 

under rule VIII, sub. 10 694 

Architecture, department of, classification amended 742 

Athletic CoDQsnission, classification amended 729 

Attorney-General, opinion of, regarding Civil Service law and rules 770 

classification amended 734, 746 

request for change in classification denied 753 

Auburn prison, classification amended 742 

Banking department: 

classification amended 729, 744 

request for change in classification denied 756 

Bath, soldiers' and sailors' home, classification amended 740 

Bedford, reformatory for women, classification amended 737 

Blind, commission for, request for change in classification denied 755 

Bronx county, classification amended: 

county clerk 749 

county court 732 

conmiissioner of records 739 

district attorney 744 

Cattaraugus county, classification amended: 

Rocky Crest Sanatorium 751 

Charitable, penal and reformatory institutions, classification amended. 737, 744 

Chautauqua county, classification amended: 

coimty court 730 

Chief examiner's annual report 29 

Civil list 56-661 

Classification, civil service: 

amendments to 728-752 

requests for changes in, denied 753-756 

table showing number of positions in the unclassified and classified 
service, except laborers 47 

[779] 



780 General Index 

Competitive class: page 

list of examinations in, during year 665 

list of examinations open to non-residents and non-citizens 674 

competitive promotion examinations 675 

appointments during year without examination under rule VIII, 

subdivision 5 693 

appointments under rule VIII, subdivision 10 6M 

transfers in, during year 719 

Competitive examinations. See Examinations 

Comptroller, State : 

classification amended 738, 740, 742, 748 

request for change in classification denied 754, 756 

Conservation Commission, classification amended 733, 735, 742, 746 

County service. See names of counties 

Court of Appeals, classification amended 747 

Courts, digest of decisions of, relating to civil service law 767 

Craig Colony, Sonyea, classification amended 736 

Dannemora State Hospital, classification amended 740 

Decisions of court, relating to civil service, digest of 767 

Elections, Superintendent of, classification amended 743 

Employment. See Appointments. 
Erie county: 

classification amended : 

commissioner of charities and corrections. .730, 732, 734, 738,746 

purchasing agent 737 

request for change in classification denied: 

treasurer 753 

Examinations : 

statistical tables of 665-692 

held during year: 

open competitive 665 

competitive, open to non-residents and non-citizens 674 

comrpetitive promotion 675 

non-com pet it ive promotion 679 

non-competitive provisional 680 

non-oompetitive, rule VIII, subdivision 10 684 

non-competitive, rated at Albany 686 

non-competitive, rated by institution boards of examiners 689 

Excise, Department of: 

classification amended 734, 738 

request for change in classification denied 754, 756 

Farms and Markets, department of, classification amended 729 

735, 738, 744, 747 

Feeble-Minded, Commission on: 

classification amended 743 

request for change in classification denied 756 

Fiscal Supervisor of State Charities, request for change in clasaiftcation 
denied 756 



General Index 781 

Food Commission : faqe 

classification amended 728, 730, 732, 734, 735 

request for change in classification denied 753, 754, 756 

Forestry, College of, Syracuse University, classification amended 751 

Great Meadow prison: 

classification am^ided 741 

request for change in classification denied 755 

Health, Department of, classification amended 735, 741 

Health OflScer, Port of New York, classification amended 739 

Highways, Department of, classification amended 736 

Hospital Commission, classification emended 739, 745 

Hospitals, state, classification amended , 745, 748 

Industrial Commission, classification amended 743 

Industry, Agricultural and Industrial School, classification amended . . 746 

Kings county, classification amended: 

county clerk 730 

supreme court 740 

Letchworth Village, Tliiells: 

clasHification amended 736 

request for change in classification denied 755 

List of CommiRsioners. Chief Examiners and Secretaries since the enact- 
ment of the Civil Service Law 44 

Mohansic Lake Reservation Commission, classification amended 748 

Monroe county, classification amended: 

board of elections 732 

county court 749 

sheriff 737 

special county judge 732 

tuberculosis sanatorium 732, 736, 741, 749 

Narcotic Drug Control, Department of, classification amended 750 

Nassau county: 

classification anrended: 

board of elections 730 

request for change in classification denied: 

board of supervisors 754 

Newtown Battlefield Reservation Commission, classification amended .... 731 

New York county, classification amended: 

commissioner of records 733 

register 733 

Niagara county, classification amended: 

commissioner of elections 734 

industrial farm 736 

sanatorium 745 

Non-competitive examinations. See Examinations. 

Oneida county, classification amended: 

hospital ; 733 



782 Genebal Index 

Onondaga county, classification amended: Pagb 

district attorney 72S 

highway department 736 

superintendent of the poor 749, 750 

Opinion of Attorney-General on Civil Service Law and rules 770 

Organization of the Commission 39 

Oxford, Women's Relief Corps Home, classification amended 740 

Port Wardens, Board of, classification amended 745 

Prison Department, classification amended 733 

Prison service. See specific name of prison. 
Promotion examination. See Examinations. 
Provisional appointments. See Appointments. 
Provisional examinations. See Examinations. 

Public Buildings, Superintendent of, classification amended 743 

Public Service Commission, First District, classification amended 741 

Public Service Commission, Second District, classification amended .... 731 
Public Works, Department of, classification amended 746 

Queens county, classification amended: 

county clerk 732 

district attorney 730 

Regulations, Civil Service, amendments to 757 

Rensselaer county, classification amended: 

Pawling Sanatorium 749 

Report of the Conmiission 7 

Riclunond county: 

classification amended: 

district attorney 732 

request for change in classification denied: 

county judge and surrogate 753 

Rome Custodial Asylum, change in classification denied 754 

Rules, Civil Service: 

amendments to 727 

request for change in classification denied 753 

Secretary of State: 

classification amended 737, 743 

request for change in classification denied 755 

Sing Sing prison, classification amended 744 

State boards, commissions and departments. See specific name of 

State hospitals. See specific name of 

State institutions. See specific name of. 

Statistical table of examinations 665-692 

Steuben county, classification amended: 

Pleasant Valley Sanatorium 745 750 



General Index 7 S3 

Suffolk county: Page 

classifieation amended : 

county treasurer 732 

district attorney 728 

request for change in classification denied: 

auditor 756 

district attorney 753 

treasurer 753 

Supreme Court, Appellate Division, Second Department, classification 

amended 728, 729 

Supreme Court, First District, classification amended 731 

Table of Contents 5 

Tax Commission, classification amended 737 

Transfers, list of. during year 719 

Weights and Measures, Superintendent of, classification amended 750 

Westchester county: 

classification amended: 

commissioner of charities and corrections 735,751 

county attorney , 731 

surrogate 732 

request for clian<j(» in classification denied: 

commissioner of charitie* and corrections 754